Google Ads

Google Ads

Bible Wheel Book

Google Ads

+ Reply to Thread
Page 55 of 55 FirstFirst ... 5455152535455
Results 541 to 547 of 547
  1. #541
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    675
    The above cube is an extension of Shcherbaks work. For each face of the cube I counted one instance of each amino acid present, and summed the side chain masses.

    So, for example, on a face where SerIV occurs 4 times, I would only count one instance of SerIV.

    Also I adhered to Shcherbaks rule that Proline has a side chain of 42 - 1.

    That each dimension forms a mathematical series is interesting on its own irrespective of any religious meaning attached to it.

  2. #542
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    675
    The Genetic Cube shows that the centre of the cube shares the same mass sum as the 8 corners - 369

    The patterns that Shcherbak found in the masses of the amino acids, are curiously similar to the patterns found in the frequencies of each aminoacid in the human genome.

    I carried out a count of the frequency of occurrence of each codon in chromosome 1 of human dna, then inserted the count into the genetic code table to see if any patterns emerged.

    You can see the results here -

    https://www.youtube.com/watch?v=83-BOMoyBnI

    What pattern will appear if these frequency numbers are entered into the genetic cube?? I will have to find out

  3. #543
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    675

    First Semantic Message in the Genetic Code and in DNA

    Here is a video that I just published about a semantic message that Shcherbak found in the genetic code. I used software to find out if it also occurs in DNA as the most frequently occurring pattern or sequence between a STOP signal and a START signal. It does.

    https://www.youtube.com/watch?v=k7eLTcReVtU

  4. #544
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    675

    The "Unknown" Regions of DNA

    In each chromosome of human DNA there are long stretches of DNA that scientists have not yet managed to read. As you know, DNA consists of As, Ts, Cs or Gs, but when scientists do not know the base in a particular position they just use an N instead, which acts as a place holder, because scientists have not yet determined the bases in those positions. These regions of Ns can be extensive, millions of bases long - and the reason why these regions are still un-sequenced seems strange.

    I decided to create some software that counts the length of these N regions, measured in codons (each 3 bases long). I looked in Chromosome 1.

    The results are a bit weird, and definitely unexpected.

    Results

    Here are the length of the N regions in Chromosome 1 - 6665 33321 33323 33323 28997 33321 33323 1067 33323 255 109 1067 1489 11996147 33323 33321

    Notice the common occurrence of 333 and 666. These unknown regions are not of random length. No doubt there may be some mechanical reason why this is so. I just find it strange that what we don't know just happens to occupy spaces with these sizes. I was very surprised by these results and decided to look at all the human chromosomes to see if the unknown regions in them also followed mathematical patterns.


    Here are the length of the N regions in Chromosome 20 - 39989 415 781 301 33323 3657 3603 979 11059 619 4017 185 319 713 261 627 179 33323 20625 33323 33323 33323 1669 229

    Here are the length of the N regions in Chromosome 19 - 39989 33321 4305 33323

    Here are the length of the N regions in Chromosome 18 - 6667 33323 1777 4499 411 33323 33323 635

    Here are the length of the N regions in Chromosome 17 - 39989 27191 477 12165 367 33323 147 33323 227 191 249 271 637 379 133 295 33323 33323 963 277

    Here are the length of the N regions in Chromosome 16 - 6667 33323 33323 33321 33323 33321 2773 359 161 33323 4441 5398267

    Here are the length of the N regions in Chromosome 15 - 11329697 131 33321 26951 32389 33323 33321 33321 33323

    Here are the length of the N regions in Chromosome 14 - 10663241 321 211 1957 5235 1651 33323 99967 66645

    Here are the length of the N regions in Chromosome 13 - 10663243 79975 33323 33323 33321 33323 33323

    Here are the length of the N regions in Chromosome 12 - 6667 667 33321 4631 33323 3179 1149 403 133 667

    Here are the length of the N regions in Chromosome 11 - 39989 171279 66643 66645 16457 125

    Here are the length of the N regions in Chromosome 10 - 6667 28945 3693 3219 145 107 297 3431 2947 2259 1619 1947 33321 66645 99967 59981 201 33323

    Here are the length of the N regions in Chromosome 9 - 6665 2261 501 9329 353 2659 139 1089 729 613 3217 9996789 33323 33321 33323 33323 33323 33321 66645 33323 33321 33321 33321 33323 33321 66645 33321 33323 33321 33321 133291 199935 1629

    Here are the length of the N regions in Chromosome 8 - 39987 33323 33323 33323 33321 33321

    Here are the length of the N regions in Chromosome 7 - 6665 1597 33323 33323 33321 33321 1929 33323 33321 33321

    Here are the length of the N regions in Chromosome 6 - 39987 66645 266581 4023 545 33323 33323

    Here are the length of the N regions in Chromosome 5 - 6665 33323 33323 3045 1563 3665 4267 4387 251 1741 1709 5345 3791 2865 33323 665 667

    Here are the length of the N regions in Chromosome 4 - 6665 3229 3837 12661 33321 8845 3999 99967 33323 33321 28383 33321

    Here are the length of the N regions in Chromosome 3 - 6665 2353 33323 4341 1527 7739 373 33323

    Here are the length of the N regions in Chromosome 2 - 6665 665 667 667 133291 45317 666451 33323 33321 135289 33321 259

    There also appears to be an additional pattern here. The largest regions of Ns in each chromosome are -

    11996147 in Chr 1 : 11996147 = 359.99 x 33323
    5398267 in Chr 16 : 5398267 = 161.99 x 33323
    11329697 in Chr 15 : 11329697 = 339.99 x 33323
    10663241 in Chr 14 : 10663241 = 319.99 x 33323
    79975 in Chr 13 : 79975 = 2.39999 x 33323
    39989 in Chr 20, 19, 17 : 39989 = 1.2000 x 33323 : note that 39989 - 6666 = 33323
    59981 in Chr 10 : 59981 = 1.7999 x 33323
    199935 in chr 9 : 199935 = 5.9999 x 33323
    266581 in chr 6 : 266581 = 7.9999 x 33323
    133291 in chr 2 : 133291 = 3.9999 x 33323


    I guess you can see that something interesting is going on here. The unknown regions of DNA have sizes that are not random at all.

    A message might lie in these regions. So the answer may lie not in what we do know, but in what we don't know - in those blacked out regions of DNA (yet "unread"). Blacked out, yet they retain the size / silhouette of something familiar. The question arises as to why these regions are unread. The answer we are told is that our current DNA reading techniques find it hard to read these particular regions, because they are encoded in a different way from the other regions.


    So we know two things about these regions -

    1. The size of these regions is a triple digit number or multiple of that
    2. The content of these regions is encoded in a way that is very different from other regions - making it hard for scientists to decipher using current techniques.

    I'd say that qualifies as an object of curiosity.

    What I will need to do is run through the software again and record the exact position of each unknown region within each chromosome, and their distance apart. Once I have the exact positions, then I will need to contact researchers to find out what is in these regions that makes it unreadable at present.

    I have to say that it is extremely odd that the size of the unknown region that every chromosome begins with is either 6667, 6665, or 39989 (and 39989 = 6666 + 33323)

    So effectively, every chromosome BEGINS with an unknown region of size 6667 or 6665 or 6666. This is truely weird. I never expected this at all. Common sense would suggest that unknown regions (regions as yet un-sequenced) should be of random sizes. I have to stress that my software measured the size of every unknown region that was longer than 100 codons. It did not miss any out. So what you have here is not filtered or selected. You have all the data. It is as it is.

    Later, I will include all regions with less than 100 codons long.

    I have created a quick video to share these results with the academic community at large - https://www.youtube.com/watch?v=67G1...ature=youtu.be
    Last edited by Craig.Paardekooper; 06-16-2018 at 07:04 AM.

  5. #545
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    675

    Errata

    I noticed a bug in my software. It counted each codon twice, so the patterns still apply but all N-region lengths should all be divided by 2

    PS. I just rescanned some chromosomes and included N-regions with size > 10. The results are even more amazing. It is truly bizarre that the length of un-sequenced regions should fall into these mathematical patterns.

    What is really puzzling is that scientists know HOW MANY letters are un-sequenced, but claim not to know what the letters are!!. I suppose it is possible that this information is being withheld, but such a claim would mean hundreds of scientists have literally redacted the DNA sequence at many key points and replaced the bases with meaningless NNNNNNNs, which is unlikely.

    The only alternative explanation is that the un-sequenced areas are not sequenced because they are hard to sequence - which would necessitate them having a very different sequence to the rest of DNA.

    These are the only two possible explanations - either they have sequenced it but are not telling, or they haven't because they don't know how to. Both are incredible though, especially the latter, because it suggests that in some way the un-sequenced areas are qualitatively different.
    Last edited by Craig.Paardekooper; 06-17-2018 at 12:59 AM.

  6. #546
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    675

    FULL PAPER on Unsequenced Region

    A Curious Pattern in Regions of Unsequenced DNA - Part 1
    By Craig Paardekooper June 2018

    Initial Search

    This discovery was prompted by one of Shcherbak's patterns. Shcherbak had found a semantic message embedded in the genetic code which suggested that multiples of 222 might be a frequent occurrence when the MASSES of amino-acids are summed, between a STOP and START codon. Prompted by Shcherbak's work, I used software to COUNT the number of codons between every STOP codon to see if any pattern emerged. As I was doing this, I noticed that the number of codons between successive STOP codons was often a multiple of 333, but these multiples occurred across un-sequenced regions. This led me to ask if the published lengths of un-sequenced regions themselves were related to multiples of 111, 222 or 333.

    Aim

    Measurement of the length of all UN-SEQUENCED regions within the human genome to find out if they are mathematically related to multiples of 111, 222 or 333.

    Background

    In each chromosome of human DNA there are long stretches of DNA that scientists have not yet managed to read. As you know, DNA consists of As, Ts, Cs or Gs, but when scientists do not know the base in a particular position they just use an N instead, which acts as a place holder, because scientists have not yet determined the bases in those positions. These regions of Ns can be extensive, millions of bases long - but it is a mystery why these regions are still un-sequenced.

    For example, here is a typical small sequence taken from Chromosome 20

    NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNGTCCATTACACTGCACTCCATTCGACTTCATTCCACTTC ACTCCACTCCCTTACACTCCACTCCATTCCACACCACTCCATTCGATTGC ACTCCATTCCACTCCATTCGACTCCACTCCACTCGATTCTTTTCCATTCC ACTCCATTCCACTCCACTACACTCTTTTCCTCTGCACTCCTCTCCACTCC ACTCCACTCTTCTCCAATCCACACCATTCCATTCCAGTCCACTCCATTCC TTTCCAGTCCATTCCACTCAAATTCATTCCATTCCACTACACTACACTTG ACTCCATTCCATTCCACTCCAGTCCACTCCACTCCATTCCACTCCAATCC ATTCCATTTCACTCCAATCCTTTCTATTCCACCCCACGCCACTGCTCTCC ACTTCATTCCGCTCCATTCCACTCCACTGTACTCCACTCCACTCCATTCC ATTCCACTCCATTCCATTCCTCTCCAATCCATTCTACTCTACTCTATTCC ACTCCATACCATTCCACTCCACTCCACTCCATTTGACTCCACTACATTCC ACTCCACTGTACTCCATACCACTCCACTCCACTCTATTCCATTCCGCTCC AACCCATTCCACTCCATTCCTCTCTGTTCCATGCAACTCCACTCCATTCC ACCCAATTCCATTCCACTCCACTCCACTCCATTCCACTCCACTCCACTCC TCTCCATTCCACTCCACTCCTCTCCATTCCACTCCAGTCCATTCCATTCC ACTCAACTCCATTTTATTCCACTCCACTGCCGCCCACTCCATTTCATTCG ACTCCATTCCATTCCCCTCCATTCCATTCCATTAAATTTTATTCCATTCC ATTCCATTCCACTCCACTACTCTCCATTCCAATCCACTCCATTCCACTCG AGTTCATTCTATTCCCTTCCATTCCACTCCATTGCATTCCAATCCACTCC GTTCCATTCCCCTGCTCTCCATTCCACTCAATTCCATTAAACTCCACTCC ACTTCATTCCATTCTATTCCATTCCATTCCATTCCTCTCCATTCCAATCC ATTCCATTCCACTCCTCTCAAATCCATTTCATTCCACACCAATCTACTCC ACTCCATTCCATTCACTTCCACTCCACTCCAATCCACTCTACTCGACTCC TCTCCATTCCACTCCTCCATTCCACTCTATTCCTTTCCATTCCACTCAAC TCCATTCCATTCCAATCCACTCCACTCTCTTCCACTCCAGTCCATTCCAT TCCTCTCCACTCCATTCCATTCCATTCCACTCCATTCCATTCCACTCCAC TCCATTCCATTCCACTGCATTCCATTCCACTCCACTCCATTCCCTTCCAC TCCACTCCTCCCACTACATTCCACTCCATTCCATTCCATTTCACTCCACT CCACTCAATTCCACTCCATTCTATTCCATTCCACTCCATTGCATTCCAGT CCTCTCCATTGCACTACTGTTCCTTCCACTCCACTCCACTCCACACCCCT CCATTCCATTCCACCCCACTGCACTCCACTCCACTCGACTCCACCTCTCT CCACTCTACAACATTCTATTCCTTTCCACTACACTCCACTCGATTCCACT CCACTCCACTCCATTCCATTCCACTCCATTCCATTCCACTCCACTCCACT CCTTTCTATTCCACTCCGCTCCATTCCATTCCACTCCATTCTATTCCATT GCATTTCATACCATTCCATACCATTCCTTTCCTTTTAGTTCCACTGCACT CCACTGCACTCCTTTCTAAACCACTCCATTCCACTCCACTACATTCGAAT CCATTCCATTCCACTCCAATCCATTCCACTAAACTCCATTCCACTCTATT CCTCACCATTCCATTCCACTCCACTCAACTTCACTCCTATCCACTCCATT CCATTCCATTCCACTCCACTCCACACCACTCCTCTCCATTCCATTCCATT CCATTCTATTCCACTCCACTCCACTCCTTTCCACTCCACTATATTCCACT CCACTCCACTCGACTCCCCTCCACTCCATTCCACTACACTCCACTTCACT CCACTTCACTCCAGTCTTCTCCATTGAATTCCATTCCATTCCACTCCAGT CCATTCCATTCCACACCACTTCATTCCATTACAATCCATTCGATTCCTTT CAATGCCACTCCAATCCATTCCACTCCACTCCACTCCATTCCAGTTCACC GCATTCCAATCCTCTCCACTGTACTCCACTCCATTCCACTCAATTCCATT CCTCTCCATTCCATTCCATGCCACACATTTCAGTTCGATTCCATTCCTCT CCATTCCATTAAATTCCATTCCATTCCATTCCACTCCACTTCACTCCATT CAACTCCACTGCATTCCACTGCACTCCATTCAACTCCATTCAATTCCATT CCATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNCCACTGTACTCCACTCCACTCCAATCCGCTCCACTCAATGCCAT TCCACTCGATTCCACTCCAATCCACTCGTCTCCAGTCCACTCCATTCTAT TCCTCTCCACCCCATTCTATTCCACTCCACTCCATTCCACTCCACTCACT CCATTCCACTCCACTCCATTCCACTCCACTCCAATCCATTCCATTCCATT CCACTCCATTCCACTCCATTCCCATCCAATCCATTCCACTCCACTCCATT CCAGTCCACTCCACTCGATTCCACTCCAGTCCATTCCACTGCACTCCATT CCATGA

    Method

    I decided to create some software that counts the length of these N regions, measured in codons (each 3 bases long). You can view the code in appendix 1. To start with, I only looked in Chromosome 1.

    The results were a bit weird, and definitely unexpected.

    Results

    Here are the length of the N regions in Chromosome 1 - 6665 33321 33323 33323 28997 33321 33323 1067 33323 255 109 1067 1489 11996147 33323 33321

    Notice the common occurrence of 333 and 666. These unknown regions are not of random length. No doubt there may be some mechanical reason why this is so. I just find it strange that what we don't know just happens to occupy spaces with these sizes.

    Extending the search to the other chromosomes:

    I was very surprised by these results and decided to look at all the human chromosomes to see if the unknown regions in them also followed mathematical patterns.

    Here are the length of the N regions in Chromosome 20 - 39989 415 781 301 33323 3657 3603 979 11059 619 4017 185 319 713 261 627 179 33323 20625 33323 33323 33323 1669 229

    Here are the length of the N regions in Chromosome 19 - 39989 33321 4305 33323

    Here are the length of the N regions in Chromosome 18 - 6667 33323 1777 4499 411 33323 33323 635

    Here are the length of the N regions in Chromosome 17 - 39989 27191 477 12165 367 33323 147 33323 227 191 249 271 637 379 133 295 33323 33323 963 277

    Here are the length of the N regions in Chromosome 16 - 6667 33323 33323 33321 33323 33321 2773 359 161 33323 4441 5398267

    Here are the length of the N regions in Chromosome 15 - 11329697 131 33321 26951 32389 33323 33321 33321 33323

    Here are the length of the N regions in Chromosome 14 - 10663241 321 211 1957 5235 1651 33323 99967 66645

    Here are the length of the N regions in Chromosome 13 - 10663243 79975 33323 33323 33321 33323 33323

    Here are the length of the N regions in Chromosome 12 - 6667 667 33321 4631 33323 3179 1149 403 133 667

    Here are the length of the N regions in Chromosome 11 - 39989 171279 66643 66645 16457 125

    Here are the length of the N regions in Chromosome 10 - 6667 28945 3693 3219 145 107 297 3431 2947 2259 1619 1947 33321 66645 99967 59981 201 33323

    Here are the length of the N regions in Chromosome 9 - 6665 2261 501 9329 353 2659 139 1089 729 613 3217 9996789 33323 33321 33323 33323 33323 33321 66645 33323 33321 33321 33321 33323 33321 66645 33321 33323 33321 33321 133291 199935 1629

    Here are the length of the N regions in Chromosome 8 - 39987 33323 33323 33323 33321 33321

    Here are the length of the N regions in Chromosome 7 - 6665 1597 33323 33323 33321 33321 1929 33323 33321 33321

    Here are the length of the N regions in Chromosome 6 - 39987 66645 266581 4023 545 33323 33323

    Here are the length of the N regions in Chromosome 5 - 6665 33323 33323 3045 1563 3665 4267 4387 251 1741 1709 5345 3791 2865 33323 665 667

    Here are the length of the N regions in Chromosome 4 - 6665 3229 3837 12661 33321 8845 3999 99967 33323 33321 28383 33321

    Here are the length of the N regions in Chromosome 3 - 6665 2353 33323 4341 1527 7739 373 33323

    Here are the length of the N regions in Chromosome 2 - 6665 665 667 667 133291 45317 666451 33323 33321 135289 33321 259

    There also appears to be an additional pattern here. The largest regions of Ns in each chromosome are -

    11996147 in Chr 1 : 11996147 = 359.99 x 33323
    5398267 in Chr 16 : 5398267 = 161.99 x 33323
    11329697 in Chr 15 : 11329697 = 339.99 x 33323
    10663241 in Chr 14 : 10663241 = 319.99 x 33323
    79975 in Chr 13 : 79975 = 2.39999 x 33323
    39989 in Chr 20, 19, 17 : 39989 = 1.2000 x 33323 : note that 39989 - 6666 = 33323
    59981 in Chr 10 : 59981 = 1.7999 x 33323
    199935 in chr 9 : 199935 = 5.9999 x 33323
    266581 in chr 6 : 266581 = 7.9999 x 33323
    133291 in chr 2 : 133291 = 3.9999 x 33323


    Discussion

    I guess you can see that something interesting is going on here. The unknown regions of DNA have sizes that are not random at all.

    The size of these regions itself embodies information - numerical patterns - which indicates that the actual content of these regions might be significant in its information content. So it is possible that these regions might contain answers concerning our origins. It is ironic that the answers may lie not in what we do know, but in what we don't know - in those blacked out regions of DNA (yet "unread"). Blacked out, yet they retain the size / silhouette of something familiar.

    The question arises as to why these regions are unread. The answer we are told is that our current DNA reading techniques find it hard to read these particular regions, because they are encoded in a different way from the other regions.

    So we know two things about these regions -

    1. The size of these regions is a triple digit number or multiple of that
    2. The content of these regions is encoded in a way that is very different from other regions - making it hard for scientists to decipher using current techniques.

    I'd say that qualifies as an object of curiosity.

    What I will need to do is run through the software again and record the exact position of each unknown region within each chromosome, and their distance apart. Once I have the exact positions, then I will need to contact researchers to find out what is in these regions that makes it unreadable at present.

    I have to say that it is extremely odd that the size of the unknown region with which most of the chromosomes start is either 6667, 6665, or 39989 (and 39989 = 6666 + 33323)

    So effectively, every chromosome BEGINS with an unknown region of size 6667 or 6665 or 6666. This is truly weird. I never expected this at all.
    Common sense would suggest that unknown regions (regions as yet un-sequenced) should be of random sizes. I have to stress that my software measured the size of every unknown/ un-sequenced region that was of length greater than 100 codons. It did not miss any out. So what you have here is not filtered or selected. You have all the data. It is as it is.

    Possible source of error

    I was scanning each chromosome in batches of 90 lines = 90 x 70 bases. Hopefully this did not introduce any reading frame shift which would affect the codon count.

    Further Investigation

    As mentioned in the results above, my software measured the size of every un-sequenced region that was of length greater than 100 codons. I did this so that any patterns in the larger regions would be more discernable. However, it would be interesting to examine the size of all N-regions of length 2 codons and upwards.

    Software

    I noticed that there was a bug in my software, such that I was counting each codon twice. So the actual N-region lengths should all be divided by 2.
    The coding for the software is provided in Appendix 1


    A Curious Pattern in Regions of Un-sequenced DNA - Part 2

    This is a follow on from the previous experiment. Here I have checked over and corrected any bugs in my software - which is now far more simple and elegant.
    As before I am measuring the length of the un-sequenced regions (N-regions) within each chromosome of human DNA. However, this time I am extending the analysis to shorter N-regions as well. I am measuring all N-regions with length greater than 2 codons.


    Chromosome 22:

    3502209 16660 16660 16661 16661 16660 16660 16661 16660 16661 16660 16660 16661 16661 16661 16660 16661 33 2617 825 33 32 33 33 32 32 33 32 33 32 33 33 32 33322 7721 377 185 32 164 33322 16661 16660 500

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    7004418 33320 33320 33322 33322 33320 33320 33322 33320 33322 33320 33320 33322 33322 33322 33320 33322 66 5234 1650 66 64 66 66 64 64 66 64 66 64 66 66 64 66644 15442 754 370 64 328 66644 33322 33320 1000


    Chromosome 21:

    1669464 16661 16660 16661 16661 16660 16660 16660 16661 16661 16660 16661 16660 16661 16660 16660 16660 16661 16660 16660 16660 33322 16661 49983 33322 16661 16661 33 33 32 32 33 33 33 33 32 33 33 32 16661 6 3 33 3 16660 3

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    3338928 33322 33320 33322 33322 33320 33320 33320 33322 33322 33320 33322 33320 33322 33320 33320 33320 33322 33320 33320 33320 66644 33322 99966 66644 33322 33322 66 66 64 64 66 66 66 66 64 66 66 64 33322 12 6 66 6 33320 6

    3338928 = 3332262 + 6666


    Chromosome 20:

    19994 207 33 7 390 150 16661 32 33 1828 33 32 32 32 33 33 33 33 33 33 33 32 1801 32 32 33 33 33 33 33 33 32 33 33 33 33 489 6 6 49 20 5529 6 309 6 6 2008 33 32 33 33 33 92 6 159 9 356 14 6 16 16 12 130 313 30 6 89 32 33 32 33 32 16661 10312 16661 16661 16661 834 114

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    39988 414 66 14 780 300 33322 64 66 3656 66 64 64 64 66 66 66 66 66 66 66 64 3602 64 64 66 66 66 66 66 66 64 66 66 66 66 978 12 12 98 40 11058 12 618 12 12 4016 66 64 66 66 66 184 12 318 18 712 28 12 32 32 24 260 626 60 12 178 64 66 64 66 64 33322 20624 33322 33322 33322 1668 228

    I think you will agree that these results are astonishing. The sizes don't look random at all. The most commonly occurring N-region lengths are 33322 codons and 66 codons, both consisting of repeating digits! Whats more the digits are related such that 66 = 22 x 3 or 33 x 2.

    What is more, the first N-region, of length 39988 = 6666 + 33322, so the whole chromosome opens with this fascinating combination of the two lengths.
    So, by allowing the software to measure the shorter length sequences, it has revealed even more coincidence around double digit pattern.

    Chromosome 19 :

    19994 16660 32 32 33 2152 33 16661

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    39988 33320 64 64 66 4304 66 33322

    Once again, the first region is a combination of 6666 + 33322, and the key numbers are all present. There is no way that this looks random

    Chromosome 18:

    3333 16661 33 33 888 33 32 33 33 32 33 32 32 33 32 32 2249 33 32 33 32 33 33 33 33 33 32 33 205 14 33 32 16661 16661 317

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -
    6666 33322 66 66 1776 66 64 66 66 64 66 64 64 66 64 64 4498 66 64 66 64 66 66 66 66 66 64 66 410 28 66 64 33322 33322 634

    Here the regions of 6666 and 33322 the first two N-regions to occur. Note the high frequency of rep digits. Note also the appearance of 888.

    Chromosome 17:

    19994 13595 238 6082 6 6 33 183 16661 73 16661 33 33 33 32 33 33 32 33 113 23 95 124 135 318 189 6 66 147 36 33 16661 16661 481 138

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    39988 27190 476 12164 12 12 66 366 33322 146 33322 66 66 66 64 66 66 64 66 226 46 190 248 270 636 378 12 132 294 72 66 33322 33322 962 276

    Once again, the first N-region in the chromosome has length 6666 + 33322, and the high frequency of 66 is apparent.

    Chromosome 16:

    3333 16661 16661 16660 16661 16660 1386 179 80 16661 33 33 32 33 33 32 33 33 2220 2699133

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6666 33322 33322 33320 33322 33320 2772 358 160 33322 66 66 64 66 66 64 66 66 4440 5398266

    666, 333, 444, 66, 22 the region sizes are frequently based around repeating digits!

    Chromosome 15 :

    5664848 65 6 33 33 33 33 32 33 16660 13475 16194 16661 16660 16660 16661

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    11329696 130 12 66 66 66 66 64 66 33320 26950 32388 33322 33320 33320 33322

    Chromosome 14:

    5331620 33 160 105 978 32 2617 825 32 33 33 33 32 32 32 32 33 32 33 33 32 16661 49983 33322

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    10663240 66 320 210 1956 64 5234 1650 64 66 66 66 64 64 64 64 66 64 66 66 64 33322 99966 66644



    Chromosome 13:

    5331621 33 32 32 32 33 33 33 33 32 33 33 32 39987 16661 16661 16660 16661 16661

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    10663242 66 64 64 64 66 66 66 66 64 66 66 64 79974 33322 33322 33320 33322 33322

    Chromosome 12:

    3333 333 16660 33 33 33 2315 33 33 32 33 32 33 33 16661 1589 574 6 6 201 31 66 32 333

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6666 666 33320 66 66 66 4630 66 66 64 66 64 66 66 33322 3178 1148 12 12 402 62 132 64 666

    It is worth noting the appearance of numerical palindromes such as 16661. Shcherbak?s semantic pattern was one long palindrome of bases whose corresponding aminoacid masses summed to a multiple of 111.

    Chromosome 11 :

    19994 85639 32 32 33 32 33 33 33 32 33 33 33321 33322 8228 62

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    39988 171278 64 64 66 64 66 66 66 64 66 66 66642 66644 16456 124

    39988 = 6666 + 33322


    Chromosome 10:

    3333 14472 1846 1609 72 53 6 6 6 148 6 32 6 1715 1473 6 1129 6 809 37 973 6 16660 33 32 33 33 33 32 32 33322 49983 29990 100 33 16661

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6666 28944 3692 3218 144 106 12 12 12 296 12 64 12 3430 2946 12 2258 12 1618 74 1946 12 33320 66 64 66 66 66 64 64 66644 99966 59980 200 66 33322

    Chromosome 9:

    3332 3 27 3 1130 250 4664 6 6 176 6 1329 69 544 364 306 1608 33 33 4998394 16661 16660 16661 16661 16661 16660 33322 16661 16660 16660 16660 16661 16660 33322 16660 16661 16660 16660 66645 99967 814

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6664 6 54 6 2260 500 9328 12 12 352 12 2658 138 1088 728 612 3216 66 66 9996788 33322 33320 33322 33322 33322 33320 66644 33322 33320 33320 33320 33322 33320 66644 33320 33322 33320 33320 133290 199934 1628

    Chromosome 8:

    19993 16661 16661 16661 33 33 33 33 33 16660 16660

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    39986 33322 33322 33322 66 66 66 66 66 33320 33320

    Chromosome 7:

    3332 798 16661 33 32 32 33 33 16661 15 16660 16660 964 16661 16660 16660

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6664 1596 33322 66 64 64 66 66 33322 30 33320 33320 1928 33322 33320 33320

    Chromosome 6:

    19993 33322 32 33 133290 2011 272 32 33 32 33 16661 16661

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    39986 66644 64 66 266580 4022 544 64 66 64 66 33322 33322

    Chromosome 5:

    3332 16661 16661 33 33 33 33 32 32 32 33 32 1522 38 781 33 33 33 1832 33 33 2133 33 2193 125 870 854 2672 33 1895 1432 33 33 16661 332 333

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6664 33322 33322 66 66 66 66 64 64 64 66 64 3044 76 1562 66 66 66 3664 66 66 4266 66 4386 250 1740 1708 5344 66 3790 2864 66 66 33322 664 666


    Chromosome 4:

    3332 1614 1918 6330 16660 4422 6 1999 49983 16661 33 33 32 32 16660 14191 16660

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6664 3228 3836 12660 33320 8844 12 3998 99966 33322 66 66 64 64 33320 28382 33320

    Chromosome 3:

    3332 32 1176 6 16661 33 32 2170 763 3869 186 49 31 6 6 33 33 33 16661

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6664 64 2352 12 33322 66 64 4340 1526 7738 372 98 62 12 12 66 66 66 33322

    Chromosome 2

    3332 332 333 333 66645 22658 333225 16661 32 32 32 33 33 33 33 32 33 16660 67644 16660 129

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6664 664 666 666 133290 45316 666450 33322 64 64 64 66 66 66 66 64 66 33320 135288 33320 258

    Chromosome 1

    3332 16660 16661 16661 14498 16660 16661 533 33 32 33 32 33 33 33 32 33 33 33 33 32 33 33 33 33 33 33 33 33 33 33 33 32 33 33 33 33 32 33 32 32 33 33 33 33 33 32 33 33 33 32 32 32 16661 33 32 32 33 33 32 32 33 33 33 33 33 127 54 7 21 6 533 744 5998073 16661 16660

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6664 33320 33322 33322 28996 33320 33322 1066 66 64 66 64 66 66 66 64 66 66 66 66 64 66 66 66 66 66 66 66 66 66 66 66 64 66 66 66 66 64 66 64 64 66 66 66 66 66 64 66 66 66 64 64 64 33322 66 64 64 66 66 64 64 66 66 66 66 66 254 108 14 42 12 1066 1488 11996146 33322 33320

    Chromosome Y

    3333 16661 29482 24 61196 32 2752 16660 282 683 16660 16660 16661 4129 476 331 828 908 109 16661 8 268 178 744 225 507 552 193 358 299 302 529 209 7 260 172 84 297 272 259 16661 89 12 601 6 46 6 109 16660 632 168 99 5331 9996789 16661

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6666 33322 58964 48 122392 64 5504 33320 564 1366 33320 33320 33322 8258 952 662 1656 1816 218 33322 16 536 356 1488 450 1014 1104 386 716 598 604 1058 418 14 520 344 168 594 544 518 33322 178 24 1202 12 92 12 218 33320 1264 336 198 10662 19993578 33322

    Chromosome X

    3333 16661 29482 24 61196 32 62171 59980 16661 16660 32 33 33 33 32 33 32 32 32 33 32 32 16660 16660 33322 12591 16661 16660

    Multiplying all these N-region lengths by 2 will help bring out the pattern, thus -

    6666 33322 58964 48 122392 64 124342 119960 33322 33320 64 66 66 66 64 66 64 64 64 66 64 64 33320 33320 66644 25182 33322 33320

    Two Possible Explanations

    What is really puzzling is that scientists know HOW MANY letters are un-sequenced, but claim not to know what the letters are!!. I suppose it is possible that this information is being withheld, but such a claim would mean hundreds of scientists have literally redacted the DNA sequence at many key points and replaced the As, Cs, Ts and Gs with meaningless NNNNNNNs, which is unlikely.

    The only alternative explanation is that the un-sequenced areas are not sequenced because they are hard to sequence - which would necessitate them having a very different sequence to the rest of DNA.

    These are the only two possible explanations -
    • 1. either they HAVE sequenced it but are not telling
    • 2. or they HAVEN'T sequenced it because they don't know how to.

    Both explanations are incredible, especially the latter, because it suggests that in some way the un-sequenced areas are qualitatively different to the rest of the DNA!

    Conclusion

    It has been clearly demonstrated that the lengths of un-sequenced regions of DNA are often multiples of 333 or 66 codons, and therefore non-random.

    So we have a size, but no sequence - a shape, but no content. However, take away any object and it leaves behind an imprint. Take away its appearance, and its shape remains in the form of a shadow or silhouette - and this shape contains information. By measuring the size of what is unknown, the shape or shadow that emerges carries enough information to show that the contents must be very significant.

    It is intriguing that chromosomes X, Y, 1, 2, 3, 4, 5, 7, 9, 10, 12, 16, 18 all begin with an un-sequenced region of length 6666/2, and chromosomes 6, 8, 11, 19, 20 all begin with an un-sequenced region of length (6666 + 33322)/2.



    References

    1. The DNA sequence for all human chromosomes was downloaded here -
    https://www.ncbi.nlm.nih.gov/genome/?term=human

    2. Shcherbaks semantic patterns
    https://arxiv.org/ftp/arxiv/papers/1303/1303.6739.pdf



    Appendix 1 : Coding

    The following is the coding that I created for this project. I have not included the public variables or imports.

    Private Sub Button1_Click(sender As System.Object, e As System.EventArgs) Handles Button1.Click
    Dim Multiline As String = ""
    N = 90
    For x = 1 To 1 Step 20
    Count = 0
    Dim path As String = "C:\Users\CRAIG\Downloads\chimp" & x & ".fasta"
    Dim Chromosome As String = "Chromosome" & x
    Dim sr As StreamReader = New StreamReader(path)

    Do While (sr.Peek() >= 0)
    Count += 1
    If Count Mod N <> 0 Then
    Application.DoEvents()
    Multiline &= sr.ReadLine
    Else
    ProcessLines(Multiline, x)
    Multiline = ""
    End If
    Loop
    Next
    End Sub
    Sub ProcessLines(MultiLine, Chromosome)
    Dim bin2 As String = ""
    If MultiLine.Length > 3 Then
    For y As Integer = 0 To MultiLine.length - 3 Step 3
    bin2 = MultiLine.SubString(y, 3)
    If bin2 = "NNN" Then
    StartStopCounter += 1
    Else
    If StartStopCounter > 2 Then
    ConvertToColour2(StartStopCounter)
    End If
    StartStopCounter = 0
    End If
    Label1.Text = Chromosome & " " & Count * 70
    Next
    End If
    End Sub

    Sub ConvertToColour2(Myinput As Long)
    With RichTextBox1
    .SelectionColor = Color.Black
    .SelectionFont = New Font(.Font, FontStyle.Bold)
    .AppendText(Myinput & " ")
    End With
    MultiplyBy2 &= Myinput * 2 & " "
    End Sub
    Last edited by Craig.Paardekooper; 06-17-2018 at 05:29 AM.

  7. #547
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    675

    Possible Reason for Triple Digit sizes

    The most common sizes are 33322, 3333, 333, 33 and 3 codons long.

    There are 3 bases in each codon, so these sizes correspond to 100,000 , 10,000, 1000 and 100 and 10 bases respectively.

    16661 corresponds to a sequencing chunk of 3 x 16661 = 50000 bases
    6666 corresponds to a sequencing chunk of 3 x 6666 = 20000 bases
    and so on

    I found out that sequencing involves chopping up the DNA into pieces of equal length, then sequencing those pieces, then reassembling them in the correct order by pattern matching. It is just like a jigsaw is made. The original picture is chopped up into small jigsaw pieces, then the user reassembles them by pattern recognition.

    I looked online and found out that sequencing used to be done in small chunks of 1000 bases, but they have scaled it up, so that it now does chunks of 10,000 or 100,000 bases at a time.

    When they have a chunk that they have sequenced BUT they cannot fit back into the jigsaw, because it does not possess enough features to identify its location, then that sequenced piece is left out, and there exists a gap of say 10,000 bases or 3333 codons.

    So this is how all the patterns arose that I discovered. They are all artifacts of the sequencing process rather than of any nonhuman origin.

    Still, it was a fun exercise.
    Last edited by Craig.Paardekooper; 06-18-2018 at 03:04 AM.

Thread Information

Users Browsing this Thread

There are currently 8 users browsing this thread. (0 members and 8 guests)

Tags for this Thread

Bookmarks

Posting Permissions

  • You may not post new threads
  • You may post replies
  • You may not post attachments
  • You may edit your posts
  •