PDA

View Full Version : Has God's Signature been found in the Genetic Code



Pages : [1] 2 3

Craig.Paardekooper
09-08-2008, 02:59 AM
THE FOLLOWING INFORMATION IS UPDATED CONTINUALLY TO REFLECT THE MOST RECENT CONTENT
LATEST UPDATE - January 23rd 2014 (other articles by Craig) (http://www.craigdemo.co.uk)


Abstract

This section of the blog is a summary of some very interesting mathematical patterns recently discovered by scientists in the Genetic Code. In serves as a summary for the postings which follow, and is updated each time something new is discovered. The patterns are quite beautiful, and they are a fairly strong indicator of Intelligent Design. However, in addition, these patterns bear a surprising resemblance to similar patterns found encoded in the Genesis narrative.


Background

Previously, Vernon Jenkins, discovered a mathematical pattern encoded within the Hebrew text of the Old Testament creation narratives. His work is displayed here - -http://www.otherbiblecode.com.

Here is the central pattern found encoded in Genesis 1 v 1

http://www.craigdemo.co.uk/triangle.gif

I was deeply impressed by the mathematical consistency of the patterns that Vernon discovered and I studied his work from the year 2000 onwards, ie for about 6 years, contributing insights now and then. One of the things I discovered early on was the occurence of the ratio 1: 1.2732 in Genesis 1, the ratio for a squared circle. This led Vernon to the discovery of pi in Genesis 1. See http://homepage.virgin.net/vernon.jenkins/Pi_File.htm. This, inturn, led Peter Bluer to the discovery of e in Genesis 1 also.



Putting the Pieces Together

The patterns that Vernon discovered in Genesis were very clear and strong. Intuitively I felt that these patterns were unlikely to be the product of chance; rather, they seemed the product of intelligent thought. I surmised that if God had encoded the patterns in the creation narrative, then perhaps the same patterns would be found in the things that God created - ie in the living things He made - the same Signature on both His works.

It didn't take me long before I began looking at genetics. In our generation we have become familiar with the genetic code as THE repository of all the information and instructions necessary for life, so my attention turned to the genetic code to see if Vernon's patterns were found there.

Initially I sent out an email to Vernon, Iain Strachnan and Richard McGough asking them if they were aware of any occurrence of Vernon's patterns in the newly published human genome. Nothing came to light, and for a few months I allowed my thoughts about the subject to gather dust.

Then, as 2006 drew to an end, I decided to look at the current research of scientists from around the world. I soon discovered that over the last decade many scientists have begun* exploring the mathematical patterns found within DNA.

Vernon's pattern was intriguing. It served as a guide telling me where to look, and what to keep my eyes open for. As I studied the research, Vernon's patterns served as a kind of "treasure map" suggesting what I might find, and where to probe deeper....



Results


January 2007 : In January 2007,* I came across the work of Shcherbak, a mathematician and geneticist. Shcherbak had written several papers on a curious mathematical pattern that he had found in the genetic code. I obtained his papers at the British Library, and made a careful study of them - and produced a simplified booklet that I published online. What was quite surprising was the resemblance between Shcherbak's genetic patterns and those found by Vernon in the creation narratives. I remember the moment I saw the similarity - I was so struck that I forgot to breath. Time seemed to freeze. For several days I was completely stunned - in a state resembling amazement and shock - like walking in a dream - everyday life continued around me, but reality had shifted under my feet. I knew that this was going to have an impact. Our world views would be changed forever.

I have summarised Shcherbak’s work in a booklet found here.

http://www.freewebs.com/genetics37/shcherbakPages.htm See "Genetic Patterns"


February 2007 : In February 2007 I created a website where I gathered a bibliography of current research on mathematical patterns within the genetic code - found here -

http://www.freewebs.com/genetics37

I sent this information to Vernon Jenkins, Richard McGough and Iain Strachnan. Vernon has since independently investigated and peer reviewed Shcherbak's findings. He has confirmed these resemblances and has created his own web page where the findings are clearly depicted -

http://www.whatabeginning.com/Misc/Genetics/Genetics_VS.htm

Then Peter Bluer, a friend of Vernon's, wrote about these findings in his online pdf here, adding some discoveries of his own -

http://www.biblemaths.com/dna.pdf


February 2010 : Three years passed by, then in February 2010, prompted by Steve Coneglan to carry on the genetics research, I made a careful study of the work of another geneticist - M. M. Rakocevic. The resemblances between Rakocevic's genetic patterns and those in the creation narratives are astounding. Here is an example -

http://www.craigdemo.co.uk/AminoAcidMassHorizontal.jpg

The diagram above shows the 20 amino acids that are the building blocks for ALL living creatures on our planet. The figure next to each amino acid is it's accepted molecular mass (relative to Carbon 12) as can be found on Wikipedia or in any accurate biochemistry manual.

These findings have been submitted to Vernon Jenkins, Steve Coneglan, Richard McGough and Peter Bluer. Steve Coneglan has peer reviewed Rakocevic's work and confirmed the accuracy of these startling patterns.

http://www.craigdemo.co.uk/aminoacidmass.htm

Peter Bluer has also reviewed these findings and independently confirmed the accuracy of the numbers. He has confirmed both the vertical and horizontal symmetry found in the amino acid table, and has proceeded to find some new patterns where by the amino acid table divides symmetrically into 3 x 666 and 703 + 37. He found these new patterns by moving one column whilst still preserving all the original patterns.

You can view his patterns here -

http://www.craigdemo.co.uk/aminoexcel.xls

Vernon Jenkins is intending to publish these new findings on his website at www.otherbiblecode.com. Here is Vernon's web page -

Vernon's new web page on Rakocevic's pattern (http://www.whatabeginning.com/Misc/Genetics/Addendum/Rakbou.htm)


Apart from the horizontal AND vertical symmetry, incredible in itself, the occurrence of both of the key numbers from Vernon's pattern, 666 and 703, is immediately obvious. The result is quite stunning.


December 2010 : Most recently, in early December 2010, I became aware of the extraordinary research of Jean Claude Perez, a french geneticist and mathematician. This very year he published a very interesting discovery that shows some very remarkable symmetries within the genetic code. These symmetries are perfect balances in the frequency of occurrence of the 64 codons within the human genome. I found this article quite helpful -

http://www.craigdemo.co.uk/perez.htm

You can read Perez's paper here - http://www.resurgence.be/pdf/ADN-perez.pdf

I have carefully studied his paper, and his findings are truely accurate and remarkable. Not only are perfect symmetries revealed, but also these symmetries are based on the ratios 1 and phi (the Golden Ratio). I would highly recommend reading and making a copy of his paper.


February 2011 : In February 2011 I took a closer look at the pattern discovered by Rakocevic. Closer analysis revealed a new set of patterns shown in the diagram below.

http://www.craigdemo.co.uk/amino7.jpg

We can see the developing pattern.

The outer columns = 2 x 666 + 2 x 37

The inner columns = 2 x 703 - 2 x 37

The odd columns = 2 x 703 - 2 x 73

The even columns = 2 x 666 + 2 x 73


February 13th 2011 : On February 13th Steve Coneglan, using more accurate figures for the mass of each amino acid, was able to confirm that my observations were correct PRECISELY. Here are his equations (C1 + column 1, C2 = Column 2, C3 = Column 3, C4 = Column 4)

C2 + C3 = 828.87 + 503.50 = 1332.37 = (2 x 703) - (2 x 37) + 0.37
C1 + C4 = 755.77 + 649.86 = 1405.63 = (2 x 666) + (2 x 37) - 0.37

C1 + C3 = 755.77 + 503.50 = 1259.27 = (2 x 703) - (2 x 73) - 0.73
C2 + C4 = 828.87 + 649.86 = 1478.73 = (2 x 666) + (2 x 73) + 0.73


February 25th 2011 : I published my paper on Rakocevic's patterns here - The Creation of the Genetic Code (http://www.craigdemo.co.uk/geneticscode1.pdf)


March 4th 2011 : I received a copy of a paper written by Stephen Coneglan. Stephen had taken a deeper look at Rakocevic's table and had rearranged the amino acids by their chemical properties so that they are symmetrically placed. When Stephen did this he found that the numerical pattern that emerged possessed precise symmetry both vertically and horizontally.

Here is a link to his paper - Stephens Paper (http://www.craigdemo.co.uk/rakocevicpaper2.doc)


March 12th 2011 : Stephen sent to me an updated version of his paper that includes much new material in the appendices. Here is the updated version -
Updated Version (http://www.craigdemo.co.uk/stephenbook.doc)

In this paper Stephen demonstrates that when the amino acids are arranged symmetrically according to several of their chemical properties, then a very precise numerical symmetry emerges. On 13th March I shall email these results to Shcherbak, Perez and Rakocevic, since their feedback would be invaluable.


March 19th 2011 : I submitted two papers to Shcherbak for review - The Creation of the Genetic Code (http://www.craigdemo.co.uk/geneticscode1.pdf) and Updated Version (http://www.craigdemo.co.uk/stephenbook.doc).

Here is the response we received from Shcherbak -


Dear Craig,

thank for your longstanding interest to my research. You have attached two articles. Article by Stephen Coneglan updates 5x4 table of 20 canonical amino acids published by Miloje Rakocevic in JTB while your article gives geometrical interpretation to these results. I think that Miloje Rakocevic finding became even more brilliant due to your scrupulous research.

However, pure mathematical approach to the genetic code and its numerical parameters threatens to be the scholastic one. To avoid scholasticism I try, for example, to interpret my results as instruction on possible universal arithmetic grammar of genomes. By the way, I recommend you to pay attention to the second Chargaff's rule (see attached articles). This phenomenon and its total power may be a continuation of the genetic code arithmetical order, this time in genomes. Therefore we – I and my young colleague Maxim Makukov – are searching now for analogous numerical grammar in genomes.

There are two squared numbers of total sum 2x37^2=2738 in your articles. On the other hand there is equation 12^2+35^2=37^2 among Pythagorean numbers. I would like to ask you and Stephen: is it possible to bisect regularly 5x4 table and its total sum producing the same equations 12^2+35^2=37^2 and 12^2+35^2=37^2? I ask this question because the genetic code has shown already the first Pythagorean number.

Yours sincerely

Vladimir



July 9th 2011 : Steve Coneglan forwarded to me his latest revision of his work on the amino acids. It is now a 63 page booklet.

A New Table of the Amino Acids (http://www.craigdemo.co.uk/aminoacids.doc)


March 6th 2013 : Shcherbak and Makukov announce the discovery of a "Biological Seti"


Latest News"The “Wow! signal” of the terrestrial genetic code.” Vladimir I. shCherbak

The journal publication cited by the article does exist, “The “Wow! signal” of the terrestrial genetic code.” Vladimir I. shCherbak, Maxim A. Makukov, The “Wow! signal” of the terrestrial genetic code, Icarus, Available online 6 March 2013, ISSN 0019-1035.

Is An Alien Message Embedded In Our Genetic Code?


Vladimir I. shCherbak of al-Farabi Kazakh National University of Kazakhstan, and Maxim A. Makukov of the Fesenkov Astrophysical Institute, hypothesize that an intelligent signal embedded in our genetic code would be a mathematical and semantic message that cannot be accounted for by Darwinian evolution. They call it “biological SETI.” What’s more, they argue that the scheme has much greater longevity and chance of detecting E.T. than a transient extraterrestrial radio transmission.

Writing in the journal Icarus, they assert: “Once fixed, the code might stay unchanged over cosmological timescales; in fact, it is the most durable construct known. Therefore it represents an exceptionally reliable storage for an intelligent signature. Once the genome is appropriately rewritten the new code with a signature will stay frozen in the cell and its progeny, which might then be delivered through space and time.”

To pass the designer label test, any patterns in the genetic code must be highly statistically significant and possess intelligent-like features that are inconsistent with any natural know process, say the authors.

They go on to argue that their detailed analysis that the human genome (map here) displays a thorough precision-type orderliness in the mapping between DNA’s nucleotides and amino acids. “Simple arrangements of the code reveal an ensemble of arithmetical and ideographical patterns of symbolic language.” They say this includes the use of decimal notation, logical transformations, and the use of the abstract symbol of zero. “Accurate and systematic, these underlying patterns appear as a product of precision logic and nontrivial computing,” they assert. This latest publication of Shcherbak and his co worker Makukov, is a must-read. It was published only this month - April 2013 - so this really is hot of the press. It seems that the mathematical patterns within the genetic code are a "biological Seti" - a deliberate message built into the very fabric of all life.......

So it seems that our generation is perched on the edge of a revolution in thought - a profound paradigm shift that will open up new vistas of ideas, a world where finally mind or soul will have a place.

Here is the abstract to Shcherbak and Makukov's latest paper -


Abstract

It has been repeatedly proposed to expand the scope for SETI, and one of the suggested alternatives to radio is the biological media. Genomic DNA is already used on Earth to store non-biological information. Though smaller in capacity, but stronger in noise immunity is the genetic code. The code is a flexible mapping between codons and amino acids, and this flexibility allows modifying the code artificially. But once fixed, the code might stay unchanged over cosmological timescales; in fact, it is the most durable construct known. Therefore it represents an exceptionally reliable storage for an intelligent signature, if that conforms to biological and thermodynamic requirements. As the actual scenario for the origin of terrestrial life is far from being settled, the proposal that it might have been seeded intentionally cannot be ruled out. A statistically strong intelligent-like “signal” in the genetic code is then a testable consequence of such scenario. Here we show that the terrestrial code displays a thorough precision-type orderliness matching the criteria to be considered an informational signal. Simple arrangements of the code reveal an ensemble of arithmetical and ideographical patterns of the same symbolic language. Accurate and systematic, these underlying patterns appear as a product of precision logic and nontrivial computing rather than of stochastic processes (the null hypothesis that they are due to chance coupled with presumable evolutionary pathways is rejected with P-value < 10–13). The patterns are profound to the extent that the code mapping itself is uniquely deduced from their algebraic representation. The signal displays readily recognizable hallmarks of artificiality, among which are the symbol of zero, the privileged decimal syntax and semantical symmetries. Besides, extraction of the signal involves logically straightforward but abstract operations, making the patterns essentially irreducible to any natural origin. Plausible ways of embedding the signal into the code and possible interpretation of its content are discussed. Overall, while the code is nearly optimized biologically, its limited capacity is used extremely efficiently to pass non-biological information

Shcherbak's full paper can be read here -

http://arxiv.org/ftp/arxiv/papers/1303/1303.6739.pdf


April 22nd 2013 - A tidal wave of interest

There has been a huge response to Shcherbak's latest paper. Hundreds of websites are talking about it. People are making videos about it. The discoveries are finally reaching the public consciousness. The level of interest is such that it will not subside, but rather will give birth to and seed further research world-wide. I found websites across the globe from Australia and India to Europe and America..... on every continent. This is the beginning of a Change - perhaps a new Enlightenment and a New Age. What comes from this can only be good.


January 14th 2014 - Review of Gamow

Gamow discovered that the 64 codons divide naturally into 3 groups -
1. 4 codons where all bases are identical
2. 24 codons where each base is different
3. 36 codons where two bases are the same

When the side chain nucleon numbers for these three groups are totalled we get
group 1 + group 2 = 2 x 703
group 3 = 666 + 666 + 666

Vernons Genesis 1 pattern is perfectly embodied

1048


January 23rd 2014 - Discovery of the Alphabetic Primer

If DNA contains a textual message for us, then that would obviously require a translation of codons into alphabetical letters. IF such a message exists, then I reasoned that the Genetic Code would contain a key (a bit like a map key) to enable us to make the correct translation. The key would match codons to alphabet letters and I predicted would have the following characteristics -

a) It would list all the amino acids in one place
b) The amino acids would be listed in a specific order
c) The key would indicate the beginning and end of the list, ie the start and finish - to give us the correct direction of the order
d) The key would indicate how the codons / amino acids are to be read - eg linearly or perpendicularly
e) The key will indicate how many letters in the corresponding alphabet
f) When the aminoacids were ordered in the correct sequence, they would reveal a simple message ( a bit like when you get the right combination for a safe, then the safe opens). The message would be something like "Beginning and End"

Well, I had searched for such a primer in the dna of the human genome. I had searched through several million bases using software that I had created. I was looking for a sequence of DNA where all 20 amino acids and stop signals occurred in one place. I did not find it then.

But on January 23rd, at 2am I awoke - and decided to look again at Scherbak's patterns found within the genetic code itself, rather than in dna sequences. That's when I came across something that fitted all the characteristics of the Primer.

As you can see below, when the amino acids were arranged according to their redundancy class, perfect balances appeared between the sidechains and standard blocks, all multiples of 37. Also, when the aminoacids in each redundancy class were further ordered by their nucleon number, a series of symmetrical patterns spontaneously appeared across the amino acid codons. These patterns contained a message - START START AAA STOP STOP and each pattern summed to 222.

This strongly suggests that the aminoacids were meant to be read in this order by us, suggesting that if they do correspond to an alphabet, then this would be the sequence.

1716

In this first diagram notice how the sidechains and standard blocks of the redundancy groups are in perfect numerical balance



1050

In the second diagram, notice how the ordering of the amino acids by nucleon number within each redundancy group causes multiple symmetrical patterns to appear when read across the codons, each summing to 222 !!

What is really remarkable is that when DNA codes for proteins it is read from the START codon to the STOP codon - then the STOP end is capped with a G, and the START end is capped with a POLY AAA tail.

Now observe what the semantic message reads - it reads G TAG TAA AAA ATG ATG which says G STOP STOP AAA START START. Interesting isn't it.

1051

So here we have all the amino acids together in their natural quantitative order, forming perfect balances of the redundancy groups, and when further ordered by nucleon number, revealing several symmetries ACROSS codons that all sum to 222 and spell out a pattern STOP STOP AAA START START, ie Beginning and End, Alpha and Omega.

What this says to me is that the amino acids are meant to be ordered in this way to reveal a pattern - something that goes from beginning to end and is related to 222. That's why I think it may be the Primer - designed to match an alphabet of 22 characters from beginning to end.

Even if it is not the Primer, then it still shows clearly that when the amino acids are arranged in order of nucleon number they reveal patterns of symmetry that seem deliberately contrived.


Thoughts

The genetic code is highly ordered, and embodies many features that indicate intelligent design from a functional perspective. The symmetry of the mathematical patterns found in the genetic code are just another indication, albeit a very precise and powerful one. There is no proof stronger than mathematical proof.

According to Shcherbak, arithmetic found in the genetic code seems to have preceded life itself. To quote Shcherbak -


The genetic code turns out to be a syntactic structure of arithmetic, the result of unique summations that have been carried out by some primordial abacus at least three and half billion years ago.


They refute traditional ideas about the stochastic origin of the genetic code. A new order in the genetic code hardly ever went through chemical evolution and, seemingly, originally appeared as pure information like arithmetic itself.

And where could arithmetic come from other than an intelligence.

But where does an intelligence come from with the capacity to create something as complex as life? The similarity with the "signature" pattern found in Genesis 1 may provide an answer.

(Note: It seems that in our universe there is more than just matter - there is consciousness too, which cannot be reduced to matter. So consciousness must always have been present, together with matter - from the very beginning. Consciousness has the capacity to create.)



After Thought

In 1973 Mankind sent out a radio message into space. This was to see "if there was anyone out there". Perhaps there was an answer, though it came in an unexpected way.

As God would be an eternal being, existing outside of time, then from His perspective all times are present at once - so something from our future could be answered in our past..........

The Arecibo message was framed in prime numbers, so last night I got to wondering if there is any connection between Genesis 1 and the 1973 Arecibo Message. It occurred to me that because God is eternal, He could have answered the Arecibo Message in our past already.

Lets take a look at the Arecibo Message that was sent out in 1973 -

1060

The entire message consisted of 73 x 23 pixels, and the authors of the message did this deliberately, so that the message would be a "sub-prime" - that is, the multiplication of two primes.

The first line of the message was the numbers 1 to 10 - our decimal system. These numbers sum to 55

The second line of the message was a list of 5 numbers representing the atomic numbers of the 5 different atoms that make up DNA - Hydrogen = 1, Carbon = 6, Nitrogen = 7, Oxygen = 8 and Phosphorous = 15. The sum of these 5 numbers comes to 37

The third line of the message was the number of atoms in each of the 6 molecules that make up DNA. A = 14, T = 14, C = 12, G = 15, Deoxyribose = 13, Phosphate = 5. The sum of these numbers comes to 73.

The fourth line was a picture of the DNA Helix

The fifth line was a picture of Man

The sixth line showed the position of our planet in the solar system

And the Seventh line showed a picture of the Telescope dish


So the message that was sent out was a multiple of two primes 73 and 23, and was headed by three number sums - 55, 37 and 73, and 55 is the midpoint between 37 and 73.

These three numbers are like a title above a picture of our DNA, which, as you have seen, is itself framed around the Genesis 1 pattern of 37 x 73.

This message was sent out in the hope of receiving a return communication from the heavens (from space)

Was there an answer?

I think there might have been. 3500 years earlier, the Book of Genesis was written, pertaining to come from a trans-dimensional being - namely God - and it's first verse consists of a multiple of two primes, 37 and 73.....

Could Genesis have been a response to the Arecibo message? A response from an eternal being, telescoped into the past.


(other articles by Craig) (http://www.craigdemo.co.uk/craig.htm)

Victor
09-08-2008, 12:28 PM
Hello Craig,

I had never seen your http://www.freewebs.com/genetics37
page before. I wish I had time to read all that! I'll try to cover it when I get time.

Another site that I've still not read is http://ad2004.com/Biblecodes/articles/Genesisgenetics.pdf. It seems to use the (in)famous ELS Bible Codes to link Genetics and the Bible. I don't know if it is sound or not.

Victor

Craig.Paardekooper
09-08-2008, 12:34 PM
Thanks Victor for the ELS web URL. I have not seen that before.

Craig

Rose
09-09-2008, 09:31 AM
Abstract

Are there mathematical patterns in the Genetic Code??
Well, scientists are discovering new and intriguing patterns, though the reason why these patterns exist and what function they serve is as yet unknown.



Background

Previously, Vernon Jenkins, discovered a mathematical pattern encoded within the Hebrew text of the Old Testament creation narratives. His work is displayed here.

http://www.otherbiblecode.com

Then, over the last decade scientists around the world have begun* exploring the mathematical patterns found within DNA.



Putting the Pieces Together

Vernon's pattern is intriguing, and it is tempting to take a look at the genetic code, to see if, perhaps, the same pattern is there too.



Results

In 2007,* I came across the work of Shcherbak, a mathematician and geneticist. What was quite surprising was the resemblance between Shcherbak's genetic patterns and those found by Vernon in the creation narratives.* I have summarised Shcherbak’s work in a booklet found here.

http://www.craigdemo.co.uk/craig.htm

Vernon has independently investigated and confirmed these resemblances and has created his own web page where the findings are clearly depicted -

http://www.whatabeginning.com/Misc/Genetics/Genetics_VS.htm




Regards

Craig Paardekooper

Thanks Craig, :yo: for sharing those links to your site. I took a brief look at what you have and it's great :thumb:. You have presented your work in a very clear and easy to understand way.

Thanks again,

Rose

Craig.Paardekooper
09-09-2008, 10:14 AM
Dear Rose,

Thankyou for your response and encouragement. I am glad to share this information. The field of genetics is advancing all the time. I look forward to the future and what it will reveal.

Craig

Craig.Paardekooper
02-16-2010, 02:37 PM
Dear folks

I am just embarking on a new adventure through the world of genetic patterns. New patterns have come to light published by Boulay and by Rakocevic

I will be analysing these patterns over the coming months and will report back what I find.

Here is Rakocevic's research

Rakocevic 1 (http://arxiv.org/ftp/q-bio/papers/0610/0610044.pdf)

Rakocevic 2 (http://arxiv.org/ftp/arxiv/papers/0903/0903.4110.pdf)

And here is Boulay's research

Boulay (http://pagesperso-orange.fr/jean-yves.boulay/cpeng/eng.htm)

Regards

Craig

Richard Amiel McGough
02-16-2010, 05:13 PM
Dear folks

I am just embarking on a new adventure through the world of genetic patterns. New patterns have come to light published by Boulay and by Rakocevic

I will be analysing these patterns over the coming months and will report back what I find.

Here is Rakocevic's research

Rakocevic 1 (http://arxiv.org/ftp/q-bio/papers/0610/0610044.pdf)

Rakocevic 2 (http://arxiv.org/ftp/arxiv/papers/0903/0903.4110.pdf)

And here is Boulay's research

Boulay (http://pagesperso-orange.fr/jean-yves.boulay/cpeng/eng.htm)

Regards

Craig
Thanks for the links! This is a most intriguing study. I look forward to your report.

Screaming Eagle
02-16-2010, 06:53 PM
This is a little off topic, but I'd like to make sure that you're aware of the laminin molecule. If you want some indication of just how 'deep' that imprint that you're looking for is, that's a good place to look. It's essentially the 're-bar' (basic building foundation) of human proteins. Do a search and take a long look at it's structure.

Richard Amiel McGough
02-16-2010, 09:17 PM
This is a little off topic, but I'd like to make sure that you're aware of the laminin molecule. If you want some indication of just how 'deep' that imprint that you're looking for is, that's a good place to look. It's essentially the 're-bar' (basic building foundation) of human proteins. Do a search and take a long look at it's structure.
The cross-shape of the laminin molecule became quite the rage a couple years ago.

http://www.biblewheel.com/laminin.jpg

It's a nice metaphor, but is there any reason for us to think it is a "message from God?" We don't want to be gullible - God gave us a mind for a reason. This review (http://www.snopes.com/glurge/laminin.asp) from the skeptical side of the universe should help folks work out an informed view of the spiritual meaning (if any) of this molecule.

Screaming Eagle
02-17-2010, 06:45 AM
Richard,
Look up Hubble M 51. lt's a spiral galaxy and the pictures are astounding. To me it's clear evidence of His fingerprint from the deepest part of who we are to some of the farthest reaches of His creation that we've been able to record in some puny way. And it's a manifestation of His words in Colossians. It's proof enough for me.

Craig.Paardekooper
02-17-2010, 01:22 PM
Dear folks,

an extraordinary pattern has been discovered in the genetic code centred on the Gauss Algorithm.

Here are my first pages on this extra-ordinary discovery. Much more to follow....

When the 20 amino acids of the genetic code are arranged in a 4 x 5 table, it is found that the atomic sums for the rows and columns are part of the Gauss Algorithm. These numbers form perfect balances - adding to the same total.

This essay is far from complete. What is unravelling is a truely incredible pattern. I just wanted to give you this first installment.

See "The Gauss Algorithm" at http://www.craigdemo.co.uk/craig.htm


Regards

Craig

Craig.Paardekooper
02-18-2010, 05:34 AM
There has been an intensifying of research into the mathematical patterns within the genetic code. These patterns show that the code was present in a complete form prior to life itself - to quote Shcherbak -


The genetic code turns out to be a syntactic structure of arithmetic, the result of unique summations that have been carried out by some primordial abacus at least three and half billion years ago.


They refute traditional ideas about the stochastic origin of the genetic code. A new order in the genetic code hardly ever went through chemical evolution and, seemingly, originally appeared as pure information like arithmetic itself.

What is emerging from the researches of Shcherbak and others is absolutely amazing. Here are links to their latest publications -

Rakocevic - "Genetic Code as a Harmonic System (http://arxiv.org/ftp/q-bio/papers/0610/0610044.pdf)

Shcherbak - "The Arithmetic Origin of the Genetic Code (2008) (http://www.springerlink.com/content/t85w0h771510j187/)

Rakocevic - "A Harmonic Structure of the Genetic Code" (2004) (http://cat.inist.fr/?aModele=afficheN&cpsidt=15899826)

I will add further links as I discover them.

Regards

Craig

Craig.Paardekooper
02-19-2010, 11:41 AM
I am going to display each of the patterns one at a time. Here is the first one relating to the molecular masses of each of the 20 amino acids.

Amino Acid Masses (http://www.craigdemo.co.uk/aminoacidmass.htm)

Reference :
M.M Rakocevic "Journal of Theoretical Biology" 229 (2004) 221-234

Regards

Craig

Craig.Paardekooper
02-20-2010, 02:04 AM
Dear Folks

Here is a peer review of these discoveries that I received from Steve Coneglan. I believe that it is important to publish peer reviews since the scientific method insists upon such a process for evaluating new findings.


Dear Craig,

As ever, I checked your findings with a fine-toothed comb.
I'm not the kind of person who just accepts someone's word when it comes to this kind of thing.
For peer review purposes, I like all the strengths and weaknesses of an argument to be out in the open.
Your latest findings have passed the muster, and brilliantly so, adding another incredible chapter to the story of the genetic code.

I individually checked the molecular weights for each of the 20 standard amino acids on Wikipedia.
There were a few extremely slight errors in the weights of 5 amino acids that you quoted in the table you created.
Amazingly, when these are adjusted to the Wikipedia values, exact divisions of the number 037 eventuate.
Let me give you the details of the amendments that need to be made to the molecular weights for 5 of the amino acids.
After you have considered the adjustments, perhaps you might want to comment on the exactness of the number 037 at your webpage.
After all is said and done, the discovery is yours.

These are the 5 amino acids whose values should be adjusted in your table to reflect the values found for each at Wikipedia:


1.Tryptophan (W): 204.23
2.Isoleucine (I): 131.17
3.Histidine (H): 155.15
4.Leucine (L): 131.17
5.Glutamine (Q): 146.14

By adjusting the values for these 5 amino acids in your table, the following data apply in respect of the columns:

Column 1:


1.Aspartic acid: 133.1
2.Arginine: 174.2
3.Lysine: 146.19
4.Histidine: 155.15
5.Glutamic acid: 147.13

The total for Column 1 is:


•133.1 + 174.2 + 146.19 + 155.15 + 147.13 = 755.77

Column 2:


1.Asparagine: 132.12
2.Phenylalanine: 165.19
3.Tyrosine: 181.19
4.Tryptophan: 204.23
5.Glutamine: 146.14

The total for column 2 is:


•132.12 + 165.19 + 181.19 + 204.23 + 146.14 = 828.87

Column 3:


1.Alanine: 89.09
2.Proline: 115.13
3.Threonine: 119.12
4.Serine: 105.09
5.Glycine: 75.07

The total for Column 3 is:


•89.09 + 115.13 + 119.12 + 105.09 + 75.07 = 503.5

Column 4:


1.Leucine: 131.17
2.Isoleucine: 131.17
3.Methionine: 149.21
4.Cysteine: 121.16
5.Valine: 117.15

The total for Column 4 is:


•131.17 + 131.17 + 149.21 + 121.16 + 117.15 = 649.86

From the Wikipedia data, the totals for all four columns are:


1.755.77
2.828.87
3.503.5
4.649.86

The following sums apply:


•Column 1 + Column 4 = 755.77 + 649.86 = 1405.63 = (2 x 703) - 0.37
•Column 2 + Column 3 = 828.87 + 503.5 = 1332.37 = (2 x 666) + 0.37
•Column 1 + Column 2 + Column 3 + Column 4 = 755.77 + 828.87 + 503.5 + 649.86 = 2738 = 2 x 37 x 37

The adjusted totals for the 5 rows are:


1.485.48
2.585.69
3.595.71
4.585.63
5.485.49

Incredibly, the combined molecular weight for all 20 amino acids comes out to an exact integer.
That integer is 2738.
There is no decimal remainder.

I have not read Rakocevic, so I have no idea why Rakocevic created the table as a 4 x 5 template.
Does this grouping have something to do with the properties of the amino acids?
What I do know is that the difference between the sums for Columns 1 + 4, and Columns 2 + 3, is mediated by a remainder of 0.37.
This difference of 0.37 mediates the sums from being exact integer multiples of 37.
Tweaking your table to reflect these amended values might be a good idea.
The witness that Wikipedia offers to your values would be of inestimable value.
Also, I feel the function of the adjustment number 0.37 adds a bit more spice to proceedings.

Taking stock, we know from Shcherbak's work that there are 2735 nucleons total in the 20 canonical amino acids.
Allowing for the proline adjustment, in which Boulay's hypothesis is the most stimulating, 1480 of these nucleons make up the 20 bases.
We also know that these can be arranged through symmetrical positionings of the 64 codons to produce many sums that are multiples of 037.

Boulay's proline hypothesis is worth commenting on here.
He posits a neutron from the radical functioning as a proton as it connects to the base.
In this schema, we would have an extra proton (in the base) and one less neutron (in the radical).
This means that the nucleon count remains unaffected.
However, it creates an extra atom, as a single proton equates to a hydrogen atom.
If Boulay is correct, some form of exchange might be going on at the quark level to change a neutron into a proton.
This suggests that information, data processing, is at work at the subatomic level.
Even more interesting is what this does at the atomic level.
An extra hydrogen atom adjusts for the total number of atoms in the 64 codons.
Without Boulay's hypothesis, there are 1143 atoms total in the 64 codons.
With Boulay's adjustment, the four extra hydrogen atoms coded for the four proline codons bring that number up to 1147 = 31 x 37.

Returning to Shcherbak's numerical discoveries.
What your latest finding, via Rakocevic, adds to the work of Shcherbak is the fine tuning.
The decimal appendages for the molecular weights of the 20 canonical amino acids sum to 3.00.
This supplements the nucleon number of 2735, bringing it up to 2738, as 2735 + 3.00 = 2738.
It is hard to fully grasp the simplicity and the beauty of this.
Even the nucleon number gets tweaked by the actual molecular weight remainders to come to an exact multiple of 037.
Thus, Shcherbak, Rakocevic and Boulay all point to the primacy of the number 037.
Words fail me.

Stephen Coneglan

Stephen Coneglan used Wikipedia to get the most accurate molecular weights of the Amino Acids. In doing so, he has discovered that Rakocevic's pattern is even more precise and profound. The Genesis 1 pattern is precisely embodied.

In ALL living organisms there are only 20 amino acids, coded by the genetic code. The total molecular weight of all 20 amino acids comes to precisely 2738 = 2 x 37 x 37. This means that the average molecular weight for each amino acid is 37 x 3.7 precisely.

We see many balances and symmetries in the table. All the balances are centred on 37 x 3.7 (the average molecular weight for all 20 amino acids)
What is really, really incredible is how the table embodies the numbers 703 and 666 in such a symmetrical way.

The two outer columns = 2 x 703
The two inner columns = 2 x 666
The upper half = 703 + 666
The bottom half = 703 + 666

a perfect embodiment of the Genesis 1 v 1 pattern

Oddly enough, when Stephen used Wikipedia to obtain the exact molecular weights, he found that the columns summed as follows

Column 1 and 4
2 x 703 - 0.37

Column 2 and 3
2 x 666 + 0.37

This is interesting because 666 + 37 = 703 and 703 - 37 = 666. It is uncanny that the columns should balance in this way.

Look at this
(2 x 703 - 0.37) + (2 x 666 + 0.37) = 2 x 37 x 37 exactly
(2 x 703 - 0.37) - (2 x 666 + 0.37) = 2 x 37 exactly

Certainly these findings command our attention, and demand a deeper investigation. What we are looking at here does not seem like chance at all.

Could this be a literal understanding of the phrase "And the Word (373) was made flesh"?

Craig Paardekooper
March 2010

Craig.Paardekooper
02-23-2010, 04:44 AM
Dear Folks,

You have to see this! I have just finished updating the table of the amino acids. You will be interested to discover that the table now has both vertical and horizontal symmetry such that the top half = 703 + 666, and the bottom half = 703 + 666, and the two central columns = 2 x 666 and the two outer columns = 2 x 703

It is quite remarkable isn't it. It seems that Vernon really did discover the key in Genesis 1. Further understanding will be needed to flesh out this discovery. For example, a question arises as to what the fundamental unit of mass is. Is mass measured in an arbitrary unit that people created, or is it a pure dimensionless number, like a ratio relative to the mass of the fundamental particle.

Here is the link -Amino Acid Masses (http://www.craigdemo.co.uk/aminoacidmass.htm)

Regards Craig

Richard Amiel McGough
02-23-2010, 11:46 AM
Dear Folks,

You have to see this! I have just finished updating the table of the amino acids. You will be interested to discover that the table now has both vertical and horizontal symmetry such that the top half = 703 + 666, and the bottom half = 703 + 666, and the two central columns = 2 x 666 and the two outer columns = 2 x 703

It is quite remarkable isn't it. Vernon really did discover the key in Genesis 1. He did it. I can barely believe it myself.

Here is the link -Amino Acid Masses (http://www.craigdemo.co.uk/aminoacidmass.htm)

"And the Word was made flesh"

Regards Craig
Thanks for the link! It will require a little study for me to really appreciate what it means. The link to the numbers of Genesis 1:1 is very intriguing indeed!

Craig.Paardekooper
02-24-2010, 12:09 AM
The molecular masses given in the table are in grams per mole. All of the molegular masses quoted by Steve Coneglan are in grams per mole.

The molar mass of atoms of an element is given by the standard atomic weight of the element[5] multiplied by the molar mass constant, Mu = 1&#215;10–3 kg/mol = 1 g/mol

The molar mass constant is always = 1, so effectively the figures for the molar mass of each amino acid molecule = the sum of the standard atomic weights of the atoms that make up the molecule.

M(H) = 1.007 97(7) &#215; 1 g/mol = 1.007 97(7) g/mol
M(S) = 32.065(5) &#215; 1 g/mol = 32.065(5) g/mol
M(Cl) = 35.453(2) &#215; 1 g/mol = 35.453(2) g/mol
M(Fe) = 55.845(2) &#215; 1 g/mol = 55.845(2) g/mol.

Multiplying by the molar mass constant ensures that the calculation is dimensionally correct: atomic weights are dimensionless quantities (ie, pure numbers) whereas molar masses have units (in this case, g/mol).

So the ATOMIC WEIGHT always equals the molar mass, since the constant is 1.

Some elements are usually encountered as molecules, eg hydrogen (H2), sulfur (S8), chlorine (Cl2). The molar mass of molecules of these elements is the molar mass of the atoms multiplied by the number of atoms in each molecule:

M(H2) = 2 &#215; 1.007 97(7) &#215; 1 g/mol = 2.015 88(14) g/mol
M(S8) = 8 &#215; 32.065(5) &#215; 1 g/mol = 256.52(4) g/mol
M(Cl2) = 2 &#215; 35.453(2) &#215; 1 g/mol = 70.906(4) g/mol.

Atomic weight (symbol: Ar) is a DIMENSIONLESS physical quantity, the ratio of the average mass of atoms of an element (from a given source) to 1/12 of the mass of an atom of carbon-12.

A carbon atom has 6 protons, 6 neutrons and 6 electrons

Mass of proton : 1,6726 x 10^(-27) kg
Mass of neutron: 1,6749 x 10^(-27) kg
Mass of electron: 0,00091x10^(-27) kg

This means that the unit of mass used to determine the molecular masses of the amino acids =

(6 protons + 6 neutrons + 6 electrons)/12

It is therefore interesting that if we took the fundamental unit of mass as 1 proton + 1 neutron + 1 electron, then the total "mass" of the amino acids would be 37 x 37 exactly rather than 2 x 37 x 37.

In this scenario, the outer columns would add to 703 and the inner columns would add to 666. The top half of the table would sum to (703 + 666)/2 and the bottom half would sum to (703 + 666)2

It seems that the nearest we can get to a physical unit of mass is 1 proton + 1 neutron + 1 electron

So it seems that the figures in the Amino Acid table are not based on an arbitrary human unit, but rather upon the unit occurence of each of the basic atomic particles. This is a pure number, and hence dimensionless.

As an after-thought, it seems curious that science has chosen 1/12 of the carbon atom as the unit. Carbon is the basic element upon which life is based, and has a hexagonal structure. If carbon is the foundation element for life, then it seems appropriate that it 1/12 X carbon atom is the current unit.

Craig.Paardekooper
02-24-2010, 02:16 PM
All life on earth is carbon based. Organic chemistry is the study of carbon compounds

ATOMS : Carbon is the element central to all life

MOLECULES: The amino acids are the building blocks of life

So what is the mass of the amino acids relative to the mass of Carbon?

If Carbon is made the unit mass for organic molecules, then the sum of the masses of all 20 amino acids comes to (37 x 37)/6 exactly.

If we arranged the amino acids in a 4 x 5 table as in the link below, then the outer columns would sum to 703/6, and the inner columns to 666/6

The 5 rows would divide precisely in half to give (703 + 666)/12 for the upper half, and (703 + 666)/12 for the lower half

The point I am making is that relative to the mass of the central element of life, the mass of the amino acids is distributed in accordance with multiples of 37 and 6, and altogether the 20 amino acids form an arrangement with both horizontal and vertical symmetry that just happens to embody the three key numbers of Genesis 1 v 1 namely - 703, 666 and 12

Craig.Paardekooper
03-06-2010, 08:06 AM
I sent the findings to Peter Bluer, in Manchester UK. He has reviewed the research and confirmed the accuracy of the findings. He has confirmed both the vertical and horizontal symmetry found in the amino acid table.

Peter Bluer rang me today to let me know that he has also found some new patterns where by the amino acid table divides symmetrically into 3 x 666 and 703 + 37. He found these new patterns by moving one column whilst still preserving all the original patterns.

You can view his patterns here -

http://www.craigdemo.co.uk/aminoexcel.xls

Regards

Craig Paardekooper

Craig.Paardekooper
03-07-2010, 05:23 AM
Here is an update I just received from Steve Coneglan -


Greetings Craig,

Thank you for the extra details.
I have been reading Dr. Bluer's webpages for many years now.
I'd had a hiatus of a few years before checking in on his work again about three months ago.
It was there that I saw his adaptations of your findings.
His webpages are excellent resources.
Top marks to you yet again for getting in touch with Dr. Bluer.

Dr. Bluer has done an admirable job in adapting the work of the researcher Boulay.
I never understood Boulay until I read Bluer.
Now, when I look at Boulay's own webpages, his work is easy to understand.
Boulay has found amazingly integrated numerical patterns in the genetic code involving the integers 7, 11, and 13.
However, his main contribution is, I believe, his hypothesis concerning proline.
It really is quite brilliant, and I think it is a step above and beyond Shcherbak's proline hypothesis.
The net result of Boulay's proline hypothesis is a total of 1147 atoms constituting the 64 codons.
1147 = 31 x 37, this number featuring prominently on the NJ cube and the Star of Israel.
In fact, it features no less than three times symmetrically on both.
Further, Dr. Bluer points out the significance of these two prime factors.
37 is the key prime signifier of Genesis 1:1 = 37 x 73.
31 is the key prime signifier of John 1:1 = 3 x 13 x 31 x 3.

Dr. Bluer has also done further work with Shcherbak's patterns.
This work can be viewed at youtube under Dr. Peter Bluer's name.
I particularly like the way in which he summarised Shcherbak's fourth and fifth patterns.
It becomes evident that the combined nucleon total for the fourth pattern sums to 4588.
4588 = 2 x 2 x 31 x 37.
The factors 31 and 37 are once more present.
Further, the total nucleon sum for the fifth pattern is 3330.
This number appears gematrically in two places in the Bible of which I'm aware.

The first place is at 1 Peter 2:6 (one of my favourite chapters of the Bible).
The adapted Isaianic quote reads: idou tithemi en Sion lithon akrogoniaion = "Behold, I set up in Zion a chief corner stone."
This excerpt sums to 3330, and has no textual variants of which I am aware.

The second excerpt comes from 1 John 1:7.
Here, the numerical evidence heavily favours the TR rendering over the NA27/UBS version.
It is a complex numerical entity, as, indeed, is the entire verse.
The excerpt reads: to haima Iesou Christou tou huiou = "The blood of Jesus Christ the Son."
The total for the excerpt is 4440, with the underlined Christ the Son summing to 3330.
It is worth looking at the numerical structure of this excerpt.

The first word, to, sums to 370.
The next two words, haima Iesou, sum to 740.
Thus, the next two words have twice the value of the first word.
The first three words, to haima Iesou, sum to 1110.
The power set for these three words sums to 3330.
The last three words, Christou tou huiou, sum to 3330.
Thus, the last three words have three times the value of the first three words.
There is an extremely tight organisation ordering this excerpt.
It revolves around the number 37, or 370.
But that is not all!

In discussing this phenomenon with Richard, it came to his attention that the number 31 also plays a leading role in the latter portion of this verse.
Allied to this was my own investigation of the entire verse.
The number 37 plays a leading role in its organisation.
It intersects with the number 31 at exactly the place which I have excerpted.
From there, the number 31 plays the organising role to the end of the verse.
If interested, you can find some of the details at the link, below.

http://www.biblewheel.com/forum/showthread.php?t=68

A final point is worth mentioning in relation to Dr. Bluer's videos at youtube.
He includes a video excerpt in which the director of CERN is being interviewed.
The director states that there are 37 blueprints whereby energy 'knows' how to become matter.
With these 37 blueprints, physicists believe they can explain all of physical reality.
If true, I wonder what these 37 blueprints are.

Returning now to the content of your email.
I received from Vernon a link wherein the molecular weights of the 20 canonical AAs are given to the fourth decimal.
These are the figures Dr. Bluer has in his spreadsheet.
It would seem that they are even more accurate than the figures obtained from Wikipedia.
What remains is the convergence of the combined molecular weight on the number 2738.
The amended value of 2378.0169 is of interest for the fact that the first decimal place holder has no value.
This fact dictates that the integer 2738 is, for all intents and purposes, the figure that one should be working with.
Nonetheless, with each rounded to the second decimal - as at Wikipedia - the combined molecular weight of the 20 canonical AAs is 2738.00.
It is my conviction that this phenomenon ought to be incorporated into the findings thus far.
(How much genuine value is actually added by going to four decimal places anyway?
It might be useful for some[?], but rounding to two decimal places, as at Wikipedia, seems preferable, at least to me.
The only proviso would be that the process of rounding to two decimals has been used.)

Dr. Bluer has rejigged Rakocevic's 4 x 5 template of the 20 AAs to good effect.
He has a penchant for that kind of thing.
He discovered some interesting patterns from Shcherbak's work, too.
However, as I recall, these did not allow for Boulay's proline hypothesis, so I had to somewhat reluctantly lay them aside.
Boulay's work is far too detailed and beautiful in its symmetry for it not to be correct.

This time, I think Dr. Bluer might be on to something.
The pink and green celled diagram looks promising.
The numbers are very close to exact, and are therefore indexical of design.
The grid shows a pleasing symmetry in its appearance.
However, to my mind, the yellow and purple celled diagram, while close, is too inexact to consider using.
The numbers converge on 1997 and 741 rather than on 1998 and 740, and so must be reckoned as a near miss rather than a match.

The next question that needs to be asked concerns the allocation of the AAs in the grid.
Why are the AAs aligned in this manner?
What properties dictate their distribution in this manner?
I think this question needs to be answered before the findings can be presented.
Otherwise, the findings might be reckoned as mere number juggling rather than anything intrinsic to the 20 AAs themselves or their properties.
Vernon asked me this very question, and I replied that I'd like to know the answer to that question myself.

I can tell you mine and Vernon's prayers are with you in this work of yours, Craig.
You have unearthed the first realworld application for the numbers Vernon has discovered in Genesis 1:1.
I could say the same thing in relation to the numbers I have discovered concerning the 12 sons of Israel.
They map beautifully onto the work you have discovered in relation to the genetic code.
The mapping is so exact in places that coincidence, as in happenstance, has to be ruled out.
I know you concur with this view.

All good wishes and blessings as you pursue this work, Craig.
I look forward eagerly to the next turn in this tale.

Stephen

Craig.Paardekooper
03-07-2010, 11:44 AM
Here is a link to a pattern that I have already written about. The pattern was originally discovered by Shcherbak.

However, Rakocevic has noticed a further aspect that I wanted to bring to your attention -

You can see the pattern here -

http://www.craigdemo.co.uk/counting.htm

Richard Amiel McGough
03-07-2010, 12:09 PM
Here is a link to a pattern that I have already written about. The pattern was originally discovered by Shcherbak.

However, Rakocevic has noticed a further aspect that I wanted to bring to your attention -

You can see the pattern here -

http://www.craigdemo.co.uk/counting.htm
Hey Craig,

Forgive me for failing to respond to your amazing work. Frankly, I have not yet taken the time to learn enough about DNA to really appreciate your findings. I will do my best to catch up and comment more.

Many blessings my friend,

Richard

Craig.Paardekooper
03-11-2010, 03:30 PM
Scientists are discovering three interesting characteristics of the genetic code.

The genetic code contains remarkable symmetries and balances
There are many instances of cyclic permutations
Patterns centre on multiples of 37


Here is an interesting quote from Rakocevic.



If this is so, and if for the number 03710 , from all the two-digital numbers, the law of modulo ordering by way of "the same symbols" and/or "cyclic permutation" (Shcherbak, 1994, p 475) holds, then we can give an important hypothesis-prediction (Prediction 5) which follows. Position 37 and its inverse form 73 must have a specific role in the make-up and organization of all linear-generated bio-macromolecules, as nucleic acids are, for example, and proteins and their aggregations. This must also be the case for positions 03/30 & 07/70, 33 & 77, etc. On the other hand, by means of these positions, relations among all other positions in the bio-macromolecule are established (see Appendix 2). (cf Osawa et al., 1992, p 234: 'Nucleotide 37, adjoining the third anticodon position in tRNA, is often extensively modified... .In contrast, the tRNA nucleotide at position 33 is an invariant unmodified U'; Saenger, 1984, p 347: 'The hypermodified, semi-invariant base at position 37... serves to locate the codon in proper register and to prevent misreading due to frame shifting').

Reference: http://www.rakocevcode.rs

Craig.Paardekooper
03-15-2010, 05:05 AM
Dear Friends,

I have just unearthed a whole new lot of patterns that are really fabulous. It is a great blessing. I have added new references to this very up to date research on my web page here -

http://www.craigdemo.co.uk/geneticbibliography.htm

I will provide an analysis of these new patterns for everyone over the coming days.

It is absolutely amazing what has been found!

Regards

Craig

kathryn
03-16-2010, 04:52 PM
Craig...thank you so much for all of your wonderful work. Very, very exciting!

Craig.Paardekooper
03-20-2010, 01:03 PM
Thanks Katherine for your encouragement. It is not easy to understand the papers on genetics, but I am reading a bit each day, and the patterns are slowly unfolding. I have just added a paper by Negadi to the bibliography. It is quite an interesting one.

We can only go one small step at a time, but each step slowly gives rise to a clearer picture of the awesome nature of the genetic code.

Craig.Paardekooper
03-21-2010, 10:13 PM
Vernon's work on Genesis 1 v 1 found that Genesis 1 was built around multiples of 6 and perfect numbers.

See - http://homepage.virgin.net/vernon.jenkins/sixes.htm


So it is interesting that the genetic code also contains this feature.

See - http://arxiv.org/ftp/arxiv/papers/0903/0903.4110.pdf

I have added this reference to the Genetics Bibliography

Victor
03-22-2010, 02:54 PM
You're on a roll, bro!

It is such a big thing that 37, 666 and 703 proeminently appear in both the structure of the aminoacids that make up the genetic code and in the opening words of Scripture! This seems very promising!

Many blessings,
Victor

Craig.Paardekooper
03-26-2010, 01:20 PM
When the 20 amino acids of the genetic code are arranged in a 4 x 5 table, it is found that the atomic sums for the rows and columns are part of the Gauss Algorithm.

See "The Gauss Algorithm" at http://www.craigdemo.co.uk/gauss.htm

The Gauss Algorithm is a way of summing all the numbers from 1 to x. In other words the Gauss Algorithm defines every TRIANGULAR NUMBER.

Vernon Jenkins found that Genesis 1 v 1 is structured around triangular numbers......

Craig.Paardekooper
03-29-2010, 01:51 PM
Dear readers,

With regards to this diagram -

http://www.craigdemo.co.uk/AminoAcidMassHorizontal.jpg

I was pondering it today and noticed something that may be significant

There are 5 rows that form symmetrical summations. As previously noted row 1 = row5 and row 2 = row 4

What I noticed today was that when we subtract the central row from 37 x 37, we get 1369 - 595.71 = 773.29 = 703 + 70.3

What this means is that the upper half of the table can also be represented as Central Row + 703 + 70.3

Upper Half = Bottom Half = Central Row + 703 + 70.3

Upper Half = Bottom Half = 703 + 666

and the central row itself = 666 - 70.3



This seems significant since the top half = bottom half = 37 x 37.

Remember that the difference between 666 and 703 characterised the columns, viz 703 - 666 = 37

We found before that the two outer columns differ from the two central columns by 2 x 703 - 2 x 666

We now find that the four outer rows differ from the central row by 2 x 703 + 2 x 70.3


I can only say that I am amazed, to the point of astonishment. This is so surreal and bizarre........ It feels unreal, like I am living in a dream. Yet I know it is real.


(Note: Row1 + row2 + row4 + row5 = 666 + 703 + 703 + 70.3

This looks like a reflection of the pattern 703 + 666 + 666 + 666)

kathryn
03-29-2010, 04:28 PM
That is absolutely amazing Craig! Wow!!

e1000yb
03-31-2010, 03:57 AM
Dear all,
I am new here and sorry if that is off topic. Please indicate a better place.

I have started recently some research on Wheat Genomics. Will you be surprised to know that bread wheat has a polyploid genome with three homoeologous sets of 7 chromosome pairs (AABBDD genome, 2n = 6x = 42 [2]).

Would Jesus have known this when he said that he is the Bread of Life>?

John 6:35 (King James Version)

"And Jesus said unto them, I am the bread of life. He that cometh to me shall never hunger; and he that believeth on me shall never thirst."


I thought I post this here for your delight and praise of God.
Many Blessings.

Nathalie

Craig.Paardekooper
03-31-2010, 08:29 AM
Welcome to this forum. Thanks for your response. It is cool that you are involved in genetics research.

Please feel free to contribute any insights you have regarding the mathematical patterns in the genetic code. Your insights are much appreciated.

Regards

Craig

Craig.Paardekooper
04-04-2010, 12:47 AM
The Genetic Code and the 12 Sons of Israel

Here is a circular depiction of the genetic code table.

http://www.craigdemo.co.uk/circulargenetictable.jpg

Each of these amino acids consists of a standard section consisting of 74 nucleons, and a unique section. (The standard part of every amino acid has 74 nucleons, with the exception of Proline that has 73. Shcherbak made a conceptual transfer of one nucleon from the unique part of Proline to the Standard part, thereby raising the standard part of proline to 74, and equalizing it with all the other amino acids. In doing so, Shcherbak unlocked the patterns found in the diagram above.) The numbers around the outside represent the total number of nucleons within each amino acid.

The following patterns were discovered and have been peer reviewed by a number of independent scientists, all of whom are non-Christians and hold an evolutionary view of the origin of life. It therefore comes as quite a surprise to see what they have found.

I have added a blue line through the center of the diagram.

When we add all the numbers on the right we get 44 x 37. In fact the sum of the STANDARD PARTS on the right comes to 22 x 37 = 814, and the sum of the UNIQUE PARTS on the right comes to 22 x 37 = 814

Now, when we add all the numbers on the left we get 41 x 37. Infact the sum of the STANDARD PARTS on the left comes to 24 x 37 = 888, and the sum of the UNIQUE PARTS on the left comes to 17 x 37 = 629



It is curious that multiples of 37 should appear on both sides.
It is also curious that there should be an exact balance on the right between the standard parts and the unique parts.



But what is truly bizarre is that the total pattern should coincide with the breastplate matrix - the diagram depicting the 12 sons of Israel.

http://craigdemo.co.uk/MS_new.gif



This diagram depicts the 12 sons of Israel, and their gematria. The genesis (birth) of the 12 sons is the culmination of the Book of Genesis.

Please notice that

the vertical axis sums to 888, and subdivides into 259 and 629
the two diagonal axes sum to 814 + 1480



So it would seem that the Genetic Code pattern is embodied in names of the 12 Sons!

The coincidence between the genetic code and the names might not be an accident. The Bible claims that Israel and his 12 sons were God's people - a group set apart to represent God. If God helped establish the nation of Israel, it would make sense that the pattern of the genetic code would be found encoded in the names. It would be a sign that the God who created all life, also had a hand in the genesis (birth) of the sons of Israel.



What is even more bizarre is the single Name that the total pattern spells out

If we take the sum of all the standard parts on the left we get 888

If we take the sum of all the standard parts on the right we get 814

888 + 814 (Cyclic permutation of Jesus Christ = 888 + 1480)



If we take all the unique parts on the left we get 888 - 259

If we take all the unique parts on the right we get 814

259 is the gematria of the first born son of Israel, Reuben, and Reuben's name means "See a Son"

So this too spells out Jesus Christ, the First born



So the Genetic pattern not only spells out the names of the 12 sons of Israel. In total it spells out a singular Name - the name of the Jewish Messiah. Such a discovery is internally consistent and makes intuitive sense.



The appearance of the gematria for Jesus Christ (The Son of Israel) within the genetic pattern (and the breastplate matrix) is extraordinarily odd.

What has the human condition to do with the name of the Jewish Messiah? Why is every cell within our bodies encoded with His Name? One could say - "Because Jesus Christ is the Creator, and God has placed His Name in us". But why the name of a suffering servant- someone who died on a cross? ......
Could it be that such suffering is the MEANING of the human condition - to carry our own cross - to overcome suffering with compassion - the transcendence of the ego? Perhaps we are meant to be "suffering servants". It is almost like an identity printed upon us.


Even the form in which the name of Jesus Christ is encoded seems to suggest crucifixion.

http://craigdemo.co.uk/MS_new.gif

The Star of the 12 Sons of Israel has 3 axes.

The vertical axis has the form of an “I” and has a value of 888. this is the numerical value of Jesus.

The two other axes have the form of an X. They both have exactly the same value, 1147, so they are like equal limbs of a cross X. Their total value is 2294 = 1480 + 814. 1480 is the numerical value of Christ. And 814 is a cyclic permutation of 1480.

AXIS 1 = 888 = Jesus

AXIS 2 = 31 x 37

AXIS 3 = 31 x 37

Axes 2 and 3 really do spell out Christ. Here is the proof -

31 x 37 + 31 x 37 = 1480 + 814 cyclic permutations of Christ

13 x 37 + 13 x 37 = 481 + 481 cyclic permutations of Christ

13 x 37 + 13 x 37 = 148 + 814 cyclic permutations of Christ

31 x 37 + 13 x 37 = 1480 + 148 cyclic permutations of Christ

31 x 37 + 13 x 37 = 814 + 814 cyclic permutations of Christ

So the vertical axis forms an Iota I which stands for Jesus

So the other two axes form a Chi X which stands for Christ.



The vertical 888 axis has the only multiple of 37 in the star = 259 = “see a son” – the firstborn son of Israel - Reuben. Interestingly, each of the other two axis is made up of 259 and 888 - meaning "see a son - Jesus" - and indicating that Jesus is the Firstborn

AXIS 1 = 888 ( + contains 259, the only name that is a multiple of 37)

AXIS 2 = 259 + 888

AXIS 3 = 259 + 888



So the names of the 12 sons embody the name if Jesus Christ in the form of the Iota Chi. The "I" crucified upon an "X".

In the original Greek text, "Jesus Christ" is written IHSOUS XRISTOS. The initials of Jesus Christ, IX, is one of the oldest and most popular christian symbols.

http://www.craigdemo.co.uk/ichthus-acrostic.jpg


In summary,

the total for the standard parts of the amino acids comes to 888 + 814
the total for the unique parts of the amino acids comes to 3 x 13 x 37 = (888 - 259) + 814.

It is interesting that both the standard and the unique summations result in numbers of such striking significance.

This is all very bizarre. Such a strange discovery is hard to come to terms with. It doesn't PROVE anything, yet it does beckon us to go deeper. To look deeper.

To that end, I have begun a study of Bioinformatics. Bioinformatics is the science of mathematical patterns in the genetic code. Many text books have already been written on this subject, which is fast becoming the cornerstone of biology. In bioinformatics, computer programs are used to analyse the sequence of bases in the genetic code and discover patterns. Since the completion of the discovery of the human genome in 2003, this science has really taken off.

Actually, as a young science, bioinformatics has not yet become inaccessible. It's discoveries are plain and simple to grasp, and it's tools are basic computer programs for pattern detection. There is a flood of information that should become coherent as the inner patterns unfold. Because we know where to look and what to look out for, we should make some interesting discoveries.

I have added the above patterns to my website here -

http://www.craigdemo.co.uk/geneticsbreastplateintro.htm

Craig.Paardekooper
04-04-2010, 01:41 AM
Vernon Jenkins has prepared a updated page on patterns in the genetic code that you can view here -

http://www.whatabeginning.com/Misc/Genetics/Rakbou.htm

It is not complete yet, but it is quite interesting

Regards

Craig

Rose
04-04-2010, 08:36 AM
The Genetic Code and the 12 Sons of Israel

Here is a circular depiction of the genetic code table.

http://www.craigdemo.co.uk/circulargenetictable.jpg

Each of these amino acids consists of a standard section consisting of 74 nucleons, and a unique section. (The standard part of every amino acid has 74 nucleons, with the exception of Proline that has 73. Shcherbak made a conceptual transfer of one nucleon from the unique part of Proline to the Standard part, thereby raising the standard part of proline to 74, and equalizing it with all the other amino acids. In doing so, Shcherbak unlocked the patterns found in the diagram above.) The numbers around the outside represent the total number of nucleons within each amino acid.

The following patterns were discovered and have been peer reviewed by a number of independent scientists, all of whom are non-Christians and hold an evolutionary view of the origin of life. It therefore comes as quite a surprise to see what they have found.

I have added a blue line through the center of the diagram.

When we add all the numbers on the right we get 44 x 37. In fact the sum of the STANDARD PARTS on the right comes to 22 x 37 = 814, and the sum of the UNIQUE PARTS on the right comes to 22 x 37 = 814

Now, when we add all the numbers on the left we get 41 x 37. Infact the sum of the STANDARD PARTS on the left comes to 24 x 37 = 888, and the sum of the UNIQUE PARTS on the left comes to 17 x 37 = 629



It is curious that multiples of 37 should appear on both sides.
It is also curious that there should be an exact balance on the right between the standard parts and the unique parts.



But what is truly bizarre is that the total pattern should coincide with the breastplate matrix - the diagram depicting the 12 sons of Israel.

http://craigdemo.co.uk/MS_new.gif



This diagram depicts the 12 sons of Israel, and their gematria. The genesis (birth) of the 12 sons is the culmination of the Book of Genesis.

Please notice that

the vertical axis sums to 888, and subdivides into 259 and 629
the two diagonal axes sum to 814 + 1480



So it would seem that the Genetic Code pattern is embodied in names of the 12 Sons!

The coincidence between the genetic code and the names might not be an accident. The Bible claims that Israel and his 12 sons were God's people - a group set apart to represent God. If God helped establish the nation of Israel, it would make sense that the pattern of the genetic code would be found encoded in the names. It would be a sign that the God who created all life, also had a hand in the genesis (birth) of the sons of Israel.



What is even more bizarre is the single Name that the total pattern spells out

If we take the sum of all the standard parts on the left we get 888

If we take the sum of all the standard parts on the right we get 814

888 + 814 (Cyclic permutation of Jesus Christ = 888 + 1480)



If we take all the unique parts on the left we get 888 - 259

If we take all the unique parts on the right we get 814

259 is the gematria of the first born son of Israel, Reuben, and Reuben's name means "See a Son"

So this too spells out Jesus Christ, the First born



So the Genetic pattern not only spells out the names of the 12 sons of Israel. In total it spells out a singular Name - the name of the Jewish Messiah. Such a discovery is internally consistent and makes intuitive sense.



The appearance of the gematria for Jesus Christ (The Son of Israel) within the genetic pattern (and the breastplate matrix) is extraordinarily odd.

What has the human condition to do with the name of the Jewish Messiah? Why is every cell within our bodies encoded with His Name? One could say - "Because Jesus Christ is the Creator, and God has placed His Name in us". But why the name of a suffering servant- someone who died on a cross? ......
Could it be that such suffering is the MEANING of the human condition - to carry our own cross - to overcome suffering with compassion - the transcendence of the ego? Perhaps we are meant to be "suffering servants". It is almost like an identity printed upon us.


Even the form in which the name of Jesus Christ is encoded seems to suggest crucifixion.

http://craigdemo.co.uk/MS_new.gif

The Star of the 12 Sons of Israel has 3 axes.

The vertical axis has the form of an 'I' and has a value of 888. this is the numerical value of Jesus.

The two other axes have the form of an X. They both have exactly the same value, 1147, so they are like equal limbs of a cross X. Their total value is 2294 = 1480 + 814. 1480 is the numerical value of Christ. And 814 is a cyclic permutation of 1480.

AXIS 1 = 888 = Jesus

AXIS 2 = 31 x 37

AXIS 3 = 31 x 37

Axes 2 and 3 really do spell out Christ. Here is the proof -

31 x 37 + 31 x 37 = 1480 + 814 cyclic permutations of Christ

13 x 37 + 13 x 37 = 481 + 481 cyclic permutations of Christ

13 x 37 + 13 x 37 = 148 + 814 cyclic permutations of Christ

31 x 37 + 13 x 37 = 1480 + 148 cyclic permutations of Christ

31 x 37 + 13 x 37 = 814 + 814 cyclic permutations of Christ

So the vertical axis forms an Iota I which stands for Jesus

So the other two axes form a Chi X which stands for Christ.



The vertical 888 axis has the only multiple of 37 in the star = 259 = 'see a son' – the firstborn son of Israel - Reuben. Interestingly, each of the other two axis is made up of 259 and 888 - meaning "see a son - Jesus" - and indicating that Jesus is the Firstborn

AXIS 1 = 888 ( + contains 259, the only name that is a multiple of 37)

AXIS 2 = 259 + 888

AXIS 3 = 259 + 888



So the names of the 12 sons embody the name if Jesus Christ in the form of the Iota Chi. The "I" crucified upon an "X".

In the original Greek text, "Jesus Christ" is written IHSOUS XRISTOS. The initials of Jesus Christ, IX, is one of the oldest and most popular christian symbols.

http://www.craigdemo.co.uk/ichthus-acrostic.jpg




This is all very bizarre. Such a strange discovery is hard to come to terms with. It doesn't PROVE anything, yet it does beckon us to go deeper. To look deeper.

To that end, I have begun a study of Bioinformatics. Bioinformatics is the science of mathematical patterns in the genetic code. Many text books have already been written on this subject, which is fast becoming the cornerstone of biology. In bioinformatics, computer programs are used to analyse the sequence of bases in the genetic code and discover patterns. Since the completion of the discovery of the human genome in 2003, this science has really taken off.

Actually, as a young science, bioinformatics has not yet become inaccessible. It's discoveries are plain and simple to grasp, and it's tools are basic computer programs for pattern detection. There is a flood of information that should become coherent as the inner patterns unfold. Because we know where to look and what to look out for, we should make some interesting discoveries.

I have added the above patterns to my website here -

http://www.craigdemo.co.uk/geneticsbreastplateintro.htm

Thank you Craig for keeping us up to date on these findings. :signthankspin: It's all quite incredible and is going to take awhile for it to sink in!

Rose

Craig.Paardekooper
06-09-2010, 02:14 PM
Vernon found that Genesis 1 embodies patterns that are palindromes eg

Genesis 1 = 37 x 73

John 1 = 39 x 93

2701 + 1072 = 3773

etc

It is therefore curious that current research in the amino acid sequencing of proteins is revealing the occurrence of palindromes with a frequency far greater than would be expected by chance.

The function of these palindromic sequences is as yet unknown.

Here is the entire amino acid sequence for the protein Histone. Histone consists of a sequence of 212 amino acids. The solid black lines are the palindromes. You can see that they are quite numerous, exceeding what we would expect by chance. Infact you can see that 115 amino acids are part of palindromes - thats 54% of the whole sequence !!

http://www.craigdemo.co.uk/palindrome.jpg

Here is an article about them -

Palindromes (http://www.cs.unh.edu/Linathesis.pdf)

Palindromes2 (http://www.science-connections.com/trends/human_leukemia/35.htm.htm)

Palindromes3 (http://www.springerlink.com/content/ul3113n473724402/)

Palindrome4 (http://www.man.poznan.pl/cmst/www.old/papers/5/vol5art2.pdf)

Craig.Paardekooper
06-13-2010, 06:37 AM
Particularly interesting is the fact that palindromes occur in the male genome: of the about 20,000,000 characters representing the male-specific region of the Y chromosome, 5,700,000 characters form together eight large palindromes (off by a couple of characters). The largest of these palindromes has 3 million characters in it;s sequence !!

Ref: http://johanjeuring.blogspot.com/2007/08/finding-palindromes.html

Craig.Paardekooper
06-20-2010, 05:48 PM
It should be recalled from Vernon's study of Genesis 1 v 1 that another central numeric feature of that verse is the cyclic permutation of numbers.

http://www.craigdemo.co.uk/cyclic.jpg

Above is a diagram showing the numerical values of the last 5 words in Genesis 1 v 1.

As shown above, the numbers for these 5 words are – 913, 203, 86, 401, and 395. Their sum is 1998 = 666 + 666 + 666, and their individual digits sum to
(6 + 6 + 6) + (6 + 6 + 6) + (6 + 6 + 6)

When written in reverse, the sum of these 5 numbers is still 1998 - as it is when the same cyclic permutation is applied to the digits of
the individual values (rows 2 and 3), or to the block of five (rows 4 and 5).

This phenomenon is called a cyclic permutation.

A curious genetic phenomenon

Here is a quote from a paper regarding the appearance not just of palindromes but also of cyclodromes within the sequential structure of chromosomes.


In the genomes of chromosomal organisms, cytological evidence from disparate sources suggests that each unit of information encoded as a DNA base sequence is serially repeated. Further cytological and genetical evidence suggests that among such serially repeated sequences a terminal unit serves as the ‘master’ sequence, within which recombinational events can occur, followed by ‘slave’ sequences which are not directly involved in recombination but which are made congruent to the master sequence once per life-cycle. The formation of lateral ‘lamp-brush’ loops in meiotic prophase, after synapsis, is claimed to represent the outcome of the master/slave matching process.



References :

http://jcs.biologists.org/cgi/content/abstract/2/1/1
http://www.ncbi.nlm.nih.gov/pubmed/4524763

Cyclodromes and Palindromes in Chromosomes
C. A. Thomas, Jr., R. E. Pyeritz, D. A. Wilson, B. M. Dancis, C. S. Lee, M. D. Bick, H. L. Huang, and B. H. Zimm
Cold Spring Harb Symp Quant Biol 1974 38: 353-370;

Craig.Paardekooper
06-26-2010, 02:50 PM
http://www.craigdemo.co.uk/AminoAcidMassHorizontal.jpg


Note:

2 x Central column = (2 x 37 x 37) - (2 x 703)

2 x Central row = (2 x 37 x 37) - (2 x 703) - (2 x 70.3)


Is it just random, or is this more than a coincidence?



These are the 5 amino acids whose values should be adjusted in your table to reflect the values found for each at Wikipedia:


1.Tryptophan (W): 204.23
2.Isoleucine (I): 131.17
3.Histidine (H): 155.15
4.Leucine (L): 131.17
5.Glutamine (Q): 146.14

By adjusting the values for these 5 amino acids in your table, the following data apply in respect of the columns:

Column 1:


1.Aspartic acid: 133.1
2.Arginine: 174.2
3.Lysine: 146.19
4.Histidine: 155.15
5.Glutamic acid: 147.13

The total for Column 1 is:


•133.1 + 174.2 + 146.19 + 155.15 + 147.13 = 755.77

Column 2:


1.Asparagine: 132.12
2.Phenylalanine: 165.19
3.Tyrosine: 181.19
4.Tryptophan: 204.23
5.Glutamine: 146.14

The total for column 2 is:


•132.12 + 165.19 + 181.19 + 204.23 + 146.14 = 828.87

Column 3:


1.Alanine: 89.09
2.Proline: 115.13
3.Threonine: 119.12
4.Serine: 105.09
5.Glycine: 75.07

The total for Column 3 is:


•89.09 + 115.13 + 119.12 + 105.09 + 75.07 = 503.5

Column 4:


1.Leucine: 131.17
2.Isoleucine: 131.17
3.Methionine: 149.21
4.Cysteine: 121.16
5.Valine: 117.15

The total for Column 4 is:


•131.17 + 131.17 + 149.21 + 121.16 + 117.15 = 649.86

From the Wikipedia data, the totals for all four columns are:


1.755.77
2.828.87
3.503.5
4.649.86

The following sums apply:


•Column 1 + Column 4 = 755.77 + 649.86 = 1405.63 = (2 x 703) - 0.37
•Column 2 + Column 3 = 828.87 + 503.5 = 1332.37 = (2 x 666) + 0.37
•Column 1 + Column 2 + Column 3 + Column 4 = 755.77 + 828.87 + 503.5 + 649.86 = 2738 = 2 x 37 x 37

The adjusted totals for the 5 rows are:


1.485.48
2.585.69
3.595.71
4.585.63
5.485.49

Incredibly, the combined molecular weight for all 20 amino acids comes out to an exact integer.
That integer is 2738.
There is no decimal remainder.


The above quote was sent to me by Stephen Coneglan. The exact molecular weights come to -
Column 1 + Column 4 = 755.77 + 649.86 = 1405.63 = (2 x 703) - 0.37
Column 2 + Column 3 = 828.87 + 503.5 = 1332.37 = (2 x 666) + 0.37

Here we have a pattern based completely around 666 and 37.

Look at this -
703 - 37 = 666, and (2 x 703) - 0.37 is the sum of the outer columns
666 + 37 = 703, and (2 x 666) + 0.37 is the sum of the two inner columns

and now we find that -
666 - 703 = -37, and 666 - 70.3 is the sum of the central row
666 + 703 = 37 x 37, and (2 x 703) + 666 + 70.3, is the sum of the 4 outer rows

Pure mathematics - it seems to me like a primordial arithmetic...

"Which immortal hand or eye could frame thy fearful symmetry"

Craig.Paardekooper
12-11-2010, 02:40 AM
The French scientist Jean Claude Perez this year published a very interesting discovery that shows some very remarkable symmetries within the genetic code.

These symmetries are perfect balances in the frequency of occurrence of the 64 codons within the human genome.

Allow me to describe what he found -

There are 64 codons in the universal genetic code table. What Perez found was that these 64 codons occur in different proportions in the human genome - some occur more frequently than others. In the entire human genome there are just over 2.8 billion codons. He used a computer to count the number of occurrences of each of the 64 different codons in the genome, and then he entered this number next to the codon in the genetic code table.

When he did this an absolutely incredible pattern emerged.

Allow me to describe what he found - It is best for me to do this in pictures -



http://www.craigdemo.co.uk/perezmatrix.jpg

In each of the tables above you will see dark areas and light areas. Perez compared the frequency of occurence of the codons in the dark areas to the frequency of occurence of the codons in the light areas. Amazingly, what he found was that the ratio of dark to light for each table above is as follows.


Table 1

When the Codon Table is divided into 2 groups each of 32 codons, the 32 codons in the dark group are found the same number of times in the human genome as the 32 codons in the light group. So the ratio is 1 : 1


Table 2

When the Codon Table is divided into 4 groups each of 16 codons, the ratio of the dark groups to the light groups is 1 : 1 - 1/(2 phi)


Table 3

When the Codon Table is divided into 8 groups each of 8 codons, the ratio of the dark groups to the light groups is 1 : 1


Table 4

When the Codon Table is divided into 16 groups each of 4 codons, the ratio of the dark groups to the light groups is 1 : 1 - 1/(2 phi)


Table 5

When the Codon Table is divided into 32 groups each of 2 codons, the ratio of the dark groups to the light groups is 1 : 1


Table 6

When the Codon Table is divided into 64 groups each of 1 codon, the ratio of the dark groups to the light groups is 1 : 1 - 1/(2 phi)


You can see a clear mathematical pattern such that the frequency of the occurence of each of the 64 codons in the human genome is not random at all. The ratios follow the sequence -


1 - 1/(2 phi) + 1/(2 phi) - 1/(2 phi) + 1/(2 phi) - 1/(2 phi)


Why should the total number of each of the 64 codons in a human being follow such a clear and definite pattern? Given the complexity of a human being, and the supposedly "random path of evolution" this is very unexpected - that the number of each of the 64 parts that make up our genome should be contrained to follow a perfect mathematical pattern. It is almost as if every "atom" has been counted.

In the DNA region coding for a particular organ the ratios of occurrence of the 64 codons do not fall into this pattern. It is ONLY when we consider the organism AS A WHOLE - that is the whole human genome - that the pattern emerges. The pattern emerges when the jigsaw is complete.



Articles and Papers

Here is an article on Perez that I found quite useful in helping me to understand what he has discovered. It is written by a friend of his, and I made a copy and saved it to my website.

http://www.craigdemo.co.uk/perez.htm


You can read Perez's paper here - http://www.resurgence.be/pdf/ADN-perez.pdf


Also here - http://www.matematicasmisticas.com/Descargas/IS-2010-0006jcPerezLastRevisedPaperInterdisciplinaryScienc e.pdf



I have carefully studied his paper, and his findings are truely accurate and remarkable. Not only are perfect symmetries revealed, but also these symmetries are based on the ratios 1 and phi (the Golden Ratio). I would highly recommend reading and making a copy of the paper linked to above.




Where did this pattern come from??

Such balances seem to indicate that arithmetic preceded life itself, and had a part in it's creation.

To quote Perez -


We offer here an amazing law which comes down to: « The respective POPULATIONS of each of 64 codons constituting the whole human genome are CONTROLLED by LOCATIONS of these same codons inside the ' Universal Genetic Code ' map ».

Effectively; by analysing the distribution of frequencies in an exhaustive way for each of 64 codons of the genetic code inside the single strand of DNA which results from the end to end concatenation of our 24 chromosomes, it appears, strangely enough, that the populations of these hundreds of million of codons are controlled by their respective and definite locations within the universal genetic code table. The universal genetic code table would constitute therefore a kind of 'structure', or 'frame' of the 'MATRIX' among which the respective LOCATIONS and POSITIONS of each one of 64 codons WOULD D_E_T_E_R_M_I_N_E the exact POPULATIONS of these same codons! The unforeseen means which allowed us to throw into relief this relationship is a scientific result resembling more the domain of « strangeness and mathematical games » rather than that of 'hard' renowned sciences such as Genetics: the 'DRAGON curve'. The 6 successive embedded foldings, according to successive dichotomies of the dragon’s curve applied to the respective populations – on the scale of whole human genome – of each of the 64 codons ordered according to the genetic code map go on then to reveal the omnipresence of 2 kinds of dual attractors with remarkable values. We conclude from this therefore that each of positions of the 64 codons within the universal genetic code table WOULD DETERMINE respective population values of these same codons within the whole human genome.



This is very strange. Everything unfolds as if the populations held concurrently by the 64
codons in the whole human genome scale are a self-similar fractal projection of the
original universal genetic code primitive matrix.


What Perez is saying here is that the frequencies of occurrence of each of the 64 codons in the ENTIRE HUMAN GENOME reflect the simple structure of the universal genetic code table in accordance with a very simple mathematical pattern centred on the ratios 1 and 0.691457. This is absolutely bizarre, since the universal genetic code table is common to all life from the most primitive to the most advanced. In effect, the supposedly ancient genetic code table appears to predict, precisely, the number of each codon in the entire human genome. Vica versa, one could say that the total number of each of the codons that make up the human genome are somehow contrained to follow a clear mathematical sequence pattern. This is extremely odd, and is an extraordinarily strong indication of "design". There seems to be nothing random about the genetic code at all - even down to the number of codons in the entire genome!


A fundamental conclusion that can be drawn from the relationships that Dr Perez has discovered is that the DNA sequences of all organisms must have emerged, or have been created, as a whole. They have in other words not emerged through random chemical reactions. I believe Dr Perez has here discovered something that simply cannot be accommodated by the previous scientific paradigm that looks upon biological evolution as a whim of nature. This discovery alone has so wide-ranging ramifications for all of biology, and especially molecular biology, that it should prompt researchers either to refute his claims or to widen the framework of their own analysis.

It is through this holism that it becomes clear that Dr Perez’ work is part of a new scientific revolution, one that brings us back to a meaningful view of the universe, which has a source that we may call « intelligent ». Seattle, August 22, 2009,
Carl Johan Calleman, Ph.D.


It is one thing for the genome to come about by chance and possess just the right functions to support life. It is quite another thing for the elements of the genome to also be in proportions that follow pure mathematical pattern through and through.



It may be important to note that Jean-claude Perez does not consider himself a creationist: his main question is:

"How is the mystery of Life emerging? By Self-organization or God? Yet certainly not by Random Chance or Hazard! Another pending second question is related to the central role played by INTEGER NUMBERS, the GOLDEN RATIO, and MATHEMATICS in hidden rules of LIFE..." "My main research is "SELF-ORGANIZATION" and then, could self-organization explain the genesis of LIFE? Presently, after nearly 30 years of research around this central question, I have no consistent response..."

Here is the Wiki on Perez -http://creationwiki.org/Jean-claude_Perez


Summary Conclusion

The 64 codons that make up our genome can be arranged just like a chess board 8 x 8. The frequency with which each of these codons occurs within the human genome is also determined by the "chess board". It is almost like we are "walking chess boards".

I am fairly sure that this 4 x 4 x 4 aspect of our design has some connection to the 288 x 288 x 288 pattern found in Genesis 1.

In his paper, Perez provides the individual frequencies of occurrence of each codon. A careful study of these frequencies will undoubtedly reveal other patterns and symmetries. I suspect that replacing actual values with nominal values will also reveal patterns. And it would be interesting to see how these patterns link in with the divisions of the Genetic Table found by Shcherbak and Rakocevic. If you have a calculator, you might want to take a closer look at this table and see what emerges........

In the table below is shown the frequency of occurrence of each of the 64 codons. For each codon, the large number is the actual number of times that codon occurs in the human genome. Who knows what you will find.


http://www.craigdemo.co.uk/codoncount.jpg



Craig

number
12-12-2010, 08:48 AM
hello for your consideration:

It is noticeable that the molecular mass, 2738, of the 20 amino acids in DNA, involves the number 37 (I refer to as ‘divine’). For:
2738 = 2701 (73rd triangular number) + 37 or
2738 = 2775 (74th triangular number) – 37.

2701 is the Hebrew gematria of the first 7 (rays of the visible spectrum) words in Genesis 1.1, and since

2701 = 73 x 37, we see 37 and its reflection 73 manifests here.

The components 666, 666, 666 and 703, of the 73rd triangular number 2701 shown as a triangle, reduce to 9, 9, 9, 10, the sum of which is also 37.
Also the difference between 703 and 666 is 37
But we have above seen the arrival of 74 also.

Significant numbers, such as 37, 137 and more are contained in the invisible spectrum of light.

http://www.numberscience.plus.com/BW1.jpg

The 7 spectral rays on the right can be obtained by passing white light through a prism, 3 of which are primary, 4 are subsidiary.
Since white light is some- thing (1) which also seems to be no-thing, we can depict light as 134 or 034.

This principle also allows for 137 or 37 or their mirrored 731 and 73 – because White Light (1 or 0) consists of 7 spectral rays of which 3 are primary.

Other numbers of significance derived by the same principle are 07, 17, 347.
347 is the divine distance separating the Earth and Moon.

74 and its reflection 47 can be obtained by consideration of the 4 subsidiary and 7 spectral rays.

Notice that number 331 is depicted on the left.
331 is another divine number, equivalent to the covalent diameter of hydrogen, whilst 1074 is its atomic diameter (more later).

I find there is definitely mathematical evidence of a Universal Designer ( God, Creator, Intelligence ) when the simple numerical equivalents of the components of the solar system and atoms are considered, instead of their perceived measurements in whatever units ( miles, kilometres, nanometres etc ).

In the beginning God created the Heavens and Earth
Atoms of Hydrogen were the first manifestation of matter after the BIG BANG

Remarkably, the Hebrew gematria of the first 7 words in Genesis and the vesica piscis in the hydrogen molecule have the SAME value – 2701.

http://www.numberscience.plus.com/BW2.jpg

Dimension of the Vesica Piscis in the Hydrogen molecule

Their diameters are twice the lengths of A and C.
As divine numbers they 1074 and 331 respectively.

1074 divided by the ‘solar factor 72(0)’, the result divided by 10,000,000,000,000 or 10^13
The answer 1.4916666 x 10^13 mile converts to 0.240006048nm.
Chemistry data book gives 0.24nm

Its covalent radius 165.5 ( half of 331 ) calculates to 0.0369925 nanometre, ( data book 0.037nm )

To show that the length of the vesica piscis arc ( blue ) = 2701

http://www.numberscience.plus.com/BW3.jpg

Angle XCD equals tan-1( 510.86/165.5 ) or tan-1( 3.0867674 ) = 72.0495680

One quarter length of vesica piscis = 675.01435
circumference of atom x 72.0495680 / 3600

Vesica piscis = 2701.0574 ( 4 x 675.01435 )

The first 7 words of Genesis and length of the vesica piscis of the hydrogen molecule have the SAME value, 2701.

Furthermore:
Diameter of a single hydrogen atom = 1074
Length of two separate hydrogen atoms = 2148
Combined atoms, length HG = 1045 ( 537 + 537 + 331 )
Contraction = 743 (2148 - 1045 )

Now, this contraction is the same length of BF in the vesica piscis.

743 also has correspondence with Light numerics.
( 7 spectral, 4 subsidiary – O, Y, I, V and 3 primary – R, G, B )

Not only that, but 743, the reflection 347 is the distance separating Earth and Moon.
( 347 x solar factor 720 miles = 249840 miles )

347 also prevails in the Pythagorean principle known as the tetraktis :
“ the monad, unity (1) or 10 created the duad followed by the trinity, from which the quaternary or arbaril originated. The quaternary was referred to as the mystic four, and combined with the trinity it composed the number seven, important and very ancient.”

Pythagoras' tetraktis is symbolised by the triangle and square.
The tetraktis represents the combination of the trinity and the quaternary, or three plus four makes seven.
( The sacred rod is also 3.47 feet ).

1072 is the reflection of the special number 2701.
And 1074 (hydrogen) = 1072 + 1 + 1.

Now 1072 = 16 x 67 is ALMOST a reflection.
HOWEVER ‘white light’ structure informs us about the equivalence of 1 & 7, since the ONE light consists of SEVEN spectral rays.
Thus 16 x 67 becomes the reflection 16 x 61 ( NOT in a mathematical sense )

Characteristic unique only to planet Earth, using 27 01 and 10 72
http://www.numberscience.plus.com/BW4.jpg

When 7920 is divided by 72(0), and 0297 by 27, the result is the SAME.
It is 11, the Earth number.

This property is UNIQUE to EARTH, in our solar system.

I believe "Two Earths" are implied, the material one of which we are all aware.
The 'spiritual' one, perceivable by the lucky few.

:signthankspin: Michael

Craig.Paardekooper
12-13-2010, 10:09 AM
"Order and chaos in DNA―the Denis Guichard Prizewinner : Jean-Claude Perez"
by P.J.Marcer (Chairman of the British Computer Society (BCS) Cybernetics Machine Group) . Found in Journal -

Kybernetes, Vol 21, Iss: 2 pp 60-61

You can see some of this article onine here -

http://golden-ratio-in-dna.blogspot.com/2008/01/1992-order-and-chaos-in-dnathe-denis.html

__________________________________________________ ______________

The first english paper relating Fibonacci/Lucas TCAG nucleotides proportions was the following:

J.C. Perez - "Chaos DNA and Neuro-computers : a golden link / The hidden language of genes, global language and ordre in the human genome", in Speculations in Science and Technology, vol 14 number 4 1991, ISSN 0155-7785.

Perez has placed the entire article online here -

http://golden-ratio-in-dna.blogspot.com/2008/01/1991-first-publication-related-to.html

__________________________________________________ _______________

Craig.Paardekooper
12-15-2010, 04:20 AM
Well, here are the codons ordered by the frequency with which the occur in the human genome. I have now given each codon a nominal value to represent it's order in this series, ie the least common is 1 and the most common is 64.

1. 6251611
CGA

2. 6265386
TCG

3. 6737724
CGC

4. 6744112
GCG

5. 7117535
ACG

6. 7137644
CGT

7. 7815619
CCG

8. 7815677
CGG


9. 26820898
GAC

10. 26866216
GTC

11. 32272009
TAC

12. 32292235
GTA

13. 33024323
ACC

14. 33071650
GGT

15. 33774033
GGC

16. 33788267
GCC

17. 36671812
CTA

18. 36718434
TAG

19. 37290873
CCC

20. 37333942
GGG

21. 37952376
ATC

22. 37990593
GAT

23. 39724813
AGC

24. 39746348
GCT

25. 40907730
GCA

26. 40949883
TGC

27. 41380831
AAC

28. 41557671
GTT

29. 42634617
CAC

30. 42755364
GTG

31. 43850042
TCC

32. 43853584
GGA

33. 45731927
ACT

34. 45794017
AGT

35. 47821818
GAG

36. 47838959
CTC

37. 50430220
AGG

38. 50494519
CCT

39. 52222957
ATG

40. 52236743
CAT

41. 52352507
CCA

42. 52453369
TGG

43. 53776608
CAA

44. 54004116
TTG

45. 55697529
TCA

46. 55709222
TGA

47. 56018645
GAA

48. 56120623
TTC

49. 56701727
AAG

50. 56828780
CTT

51. 57234565
ACA

52. 57468177
TGT

53. 57544367
CAG

54. 57598215
CTG

55. 58649060
ATA

56. 58718182
TAT

57. 59167883
TAA

58. 59263408
TTA

59. 62837294
AGA

60. 62964984
TCT

61. 70880610
AAT

62. 71001746
ATT

63. 109143641
AAA

64. 109591342
TTT

TOTAL = 2843411612 codons in entire genome.

This simple list of the codon frequencies yields some really strange observations -


FIRSTLY, ALL the codons DO pair up - they form 32 pairs. Each member of a pair occurs with a similar frequency, and ALSO each member of a pair is the mirror image of the other member. This is quite unexpected. Within a single strand of DNA the number of times any particular codon occurs is approximately equal to the number of times it's mirror image occurs.

SO, roughly speaking, the SUM OF ODD CODONS = SUM OF EVEN CODONS


SECONDLY, the sum of the 32 most frequent codons = 2 x the sum of the 32 least frequent codons.


THIRDLY, we can convert the codon frequencies to a ratio, where Ratio = (codon population x 64 / 2,843,411,612). When we do this we find that for the first 16 pairs of codons the Ratio < 1, and for the last 16 pairs of codons, the Ratio > 1


All this is a bit odd. We would have expected the codon populations to be completely random ( since they are a product of evolution). However, instead we find that within the human genome there is a perfect balance of codon and mirror codon - that the 32 most common codons occur exactly twice as often as the 32 les common ones - and that the Ratio splits the 32pairs of codon + mirror codon into exactly two groups of 16 pairs.




If we take the two most frequently occurring codons TTT and AAA, the occurrence of their frequency relative to the entire population is (109591342 + 109143641)/2843411612. = 12.99934548. Here we can see 13 emerging.

Also, the sum of the last 32 codons in this list is 2 x the sum of the first 32.

Rose
12-15-2010, 08:39 AM
Hi Craig,

Thanks for keeping us posted..:signthankspin: I find this extremely interesting. Just glancing at the numbers you posted there appears to be rough pairing of many of the codons. I'm exited to see the results!

Blessings,
Rose

Craig.Paardekooper
12-15-2010, 10:41 AM
Thanks Rose,

There does seem to be a pairing. All the codons seem to pair up - as you mentioned......... Infact ALL the codons DO pair up - they form 32 pairs. Each member of a pair occurs with a similar frequency, and ALSO each member of a pair is the mirror image of the other member.

By "mirror image" I mean that the G in one pair always maps on to the C in the other, and the A in one pair always maps onto the T in the other. You can check this yourself. G maps on to C, and A maps onto T. Take any member of a pair in the nominal codon list above, and convert G to C and A to T, and you get the other member of the pair every time.

So what you spotted, Rose, is a universal law!


It could be stated -

"In any complete DNA sequence, the population of any chosen codon is equal to the population of it's mirror codon"


We know that in double stranded DNA one strand is the mirror image of the other and contains the same number of codons eg

strand 1 = tcaggcttaacc
strand 2 = agtccgaattgg

This is normal. What Perez discovered was something quite different.

He found that WITHIN a single strand there is also a reflection. The total frequency of occurrence of any codon is equal to the frequency of occurrence of it's mirror WITHIN the same strand.

What is more, we are not talking about simple palindromes , where one part reflects the sequence of the other, as in strand 3 below

strand 3 = tcaggcttaaccggttaagcctga

Rather we are talking about a strand where the codons can be in any order, but still have an exact numerical balance

strand 4 = tcaggtggcttataaaccgcctga


All complete genomes obey this law, they have a perfect population balance of codons with their mirror codons, even though the sequence of mirror codons is completely different from the sequence of codons.


So what produced this balance - not a copying mechanism - since then the sequence would be copied, rather than just the number quantity. If the balance is not due to copying, then it must have existed in the original.

I would propose every DNA strand was created with a perfect balance of codons and mirror codons. When a strand is copied, if the resulting strand contains an unequal balance of codons and mirror codons, then the DNA strand is discarded.

This is an excellent way of making sure that errors are not passed on - since the original DNA effectively contains a "numerical" copy of itself, and any divergence from the balance indicates that an error has crept in - perhaps a wrong base or codon. But it requires that the original copy of the DNA (Adam's DNA as it were) contain a perfect balance.


A problem for Evolutionists
A naturalistic explanation of this balance would be that in some primitive organism, millions of years ago, a single strand of DNA made a mirror copy of itself, then the copy joined the original strand to form one long DNA strand. The new DNA strand now contained a balance between the codons and the mirror codons, and the added strand is a mirror sequence of the original the codon sequence. However, the problem for evolutionists is that we are talking about a numerical balance, not a simple copying of a sequence. In fact therre is no obvious sequence at all. To explain the absence of the mirror sequence in our single strands, the naturalistic explanation asserts that the codons must then have shuffled themselves up.

Another problem for the evolutionists is that this ancient organism is supposed to have turned into a human being - which means the adding of lots more codons, and replacing existing ones. Which means that the balance would soon be lost. The existence of balance suggests either that no substantial change of the DNA has happened since it first formed, or that changes have happened but they have been systematically removed (to preserve the balance).

Conservation
The balance looks like a conservation mechanism. If mutation introduced new mutant genes, these would break the numerical balance between codons and mirrorcodons. Consequently the mutant DNA would be discarded, and the original balance restored.

Perez identifies the following numerical checks that DNA DOES have built into it -

–Number of codons with first base position is T = number of codons with first base position A

–Number of codons with first base position is C = number of codons with first base position G

–Number of codons with second base position is T = number of codons with second base position A

–Number of codons with second base position is C = number of codons with second base position G

–Number of codons with third base position is T = number of codons with third base position A

–Number of codons with third base position is C = number of codons with third base position G


DNA is beginning to look quite calculating as to what it allows in or not.


Premise 1 : Perez found that these Checksums do exist

Premise 2 : These Checksums act as a highly efficient means for preventing errors (whether that was their original intention, it is certainly their result)


I suppose it should not surprise us that DNA has these checksums built in - after all, we already regard it as containing "information" and being made up of "letters" and "words" - now it has "numbers" too.

Number allows for systems that are more highly ordered. And DNA is the most highly ordered thing in our universe

All this is bad news for materialists, since DNA is looking more like a precision system created by a linguistic and mathematical mind.



So thanks for spotting the pairing Rose. I will have to do a bit more research on this, since it is quite interesting


Craig

alec cotton
12-15-2010, 01:11 PM
Quote

"Jesus Christ" is written IHSOUS XRISTOS. The initials of Jesus Christ, IX, is one of the oldest and most popular christian symbols.

I must be a bit thick . Reading the post I just realised that the word Ichthus
(fish) is composed of the initial letters of Jesus Christ God Son Saviour.
Iesous Xristous Theos Uios Soteer .
Alec

CWH
12-15-2010, 03:59 PM
Thanks Craig, great post! :thumb:

It certainly proves intelligent creation more than random evolution:


A fundamental conclusion that can be drawn from the relationships that Dr Perez has discovered is that the DNA sequences of all organisms must have emerged, or have been created, as a whole. They have in other words not emerged through random chemical reactions. I believe Dr Perez has here discovered something that simply cannot be accommodated by the previous scientific paradigm that looks upon biological evolution as a whim of nature. This discovery alone has so wide-ranging ramifications for all of biology, and especially molecular biology, that it should prompt researchers either to refute his claims or to widen the framework of their own analysis.

It is through this holism that it becomes clear that Dr Perez’ work is part of a new scientific revolution, one that brings us back to a meaningful view of the universe, which has a source that we may call « intelligent ». Seattle, August 22, 2009,
Carl Johan Calleman, Ph.D.
It is one thing for the genome to come about by chance and possess just the right functions to support life. It is quite another thing for the elements of the genome to also be in proportions that follow pure mathematical pattern through and through.


Quote:
It may be important to note that Jean-claude Perez does not consider himself a creationist: his main question is:

"How is the mystery of Life emerging? By Self-organization or God? Yet certainly not by Random Chance or Hazard! Another pending second question is related to the central role played by INTEGER NUMBERS, the GOLDEN RATIO, and MATHEMATICS in hidden rules of LIFE..." "My main research is "SELF-ORGANIZATION" and then, could self-organization explain the genesis of LIFE? Presently, after nearly 30 years of research around this central question, I have no consistent response..."
Here is the Wiki on Perez -http://creationwiki.org/Jean-claude_Perez

Many Blessings.

number
12-21-2010, 05:50 AM
hello Craig, I feel my earlier post may be irrelevant here. For many years I have been researching God's simple numerical signatures.
I just find it remarkable (though not surprised) that among the significant numbers I have found, including 37, 137 and '111' have been revealed in DNA as well.

Best wishes Michael

Craig.Paardekooper
12-21-2010, 10:58 AM
Hi Michael (Number),

Sorry for not getting back to you. It is remarkable that DNA should contain any mathematical patterns and symmetries, including the ones you mention. DNA is only just beginning to reveal it's secrets, and much more will soon emerge.

The current task is to find, collect and analyse these various symmetries, until we get a view of the bigger picture.

I am sure that something absolutely amazing will emerge from doing this.

Generally speaking the best discoveries are found through delving into the scientific papers on this subject. These papers do take a while to grasp and fully understand, but you'll discover alot by doing it.

I suppose that it is only in our generation that we have the priviledge for the first time of peering into the Code of Life - understanding the "words" and "information" that gave rise to life itself.

It is most probable that DNA will be the "philosophers stone" of our generation and the generations to come - somewhere deep within it are the answers to our deepest and most urgent questions

Craig.Paardekooper
12-30-2010, 02:15 AM
Hi Michael,

your post is not irrelevant, and your contribution is appreciated. Your thoughts may well inspire a chain of thought that leads to something new. Besides, often discoveries are made by thinking outside the box.

CWH
12-30-2010, 03:06 AM
Hi Michael,

your post is not irrelevant, and your contribution is appreciated. Your thoughts may well inspire a chain of thought that leads to something new. Besides, often discoveries are made by thinking outside the box.

That's a relevant point Craig, anyone's contribution is appreciated....a chain of thoughts can lead to new discoveries. Let's hope preterists can think out of the AD 70 box.

Many Blessings and a Happy New Year.

Clifford
12-30-2010, 04:14 PM
That's a relevant point Craig, anyone's contribution is appreciated....a chain of thoughts can lead to new discoveries. Let's hope preterists can think out of the AD 70 box.

Many Blessings and a Happy New Year.

And lets hope futurists will take word meanings seriously.

soon=soon
quickly=quickly
at the door=at the door.

Clifford

Craig.Paardekooper
01-20-2011, 05:25 PM
Over the last few months an image has often come into my mind - that of a cube (like a rubics cube) only with sides of 4 x 4 x 4.

The idea that the genetic code is some kind of magic cube.

Well, I suppose this idea was kind of suggested by the wierd appearance of a cube in both Genesis 1 and in Revelations. There is something about the cube, and the way it manifests in Genesis 1 as 288 x 288 x 288, and in Revelations as 12 x 12 x 12, and now in the genetic code as 4 x 4 x 4.

Anyway, out of curiosity I decided to look into this.

Firstly, can a magic square or magic cube be made out of 64 items numbered 1 to 64?

Below is the 8x8 Magic Square whose sum is 260.
It is constructed by writing the numbers 1...64 in sequence
and then reversing the order of the darker entries:



64 02 03 61 60 06 07 08

09 55 54 12 13 51 50 16

17 47 46 20 21 43 42 24

40 26 27 37 36 30 31 32

32 34 35 29 28 38 39 25

41 23 22 44 45 19 18 48

49 15 14 52 53 11 10 56

08 58 59 05 04 62 63 01


Rather interestingly, each column sums to 260, as do the diagonals

Since 8x8 = 64 = 4x4x4 is both a square and a cube
(the smallest such number greater than 1)
you can use the same numbers and a similar method
to construct a 4x4x4 Magic Cube with sum 130.

Here is such a cube as constructed by Meredith Houlton:


1 63 62 4
60 6 7 57
56 10 11 53
13 51 50 16

48 18 19 45
21 43 42 24
25 39 38 28
36 30 31 33

32 34 35 29
37 27 26 40
41 23 22 44
20 46 47 17

49 15 14 52
12 54 55 9
8 58 59 5
61 3 2 64


The sum of the 8x8 Magic Square, 260,
is twice the sum (130) of the 4x4x4 Magic Cube.

Rose
01-20-2011, 06:35 PM
Over the last few months an image has often come into my mind - that of a cube (like a rubics cube) only with sides of 4 x 4 x 4.

The idea that the genetic code is some kind of magic cube.

Well, I suppose this idea was kind of suggested by the wierd appearance of a cube in both Genesis 1 and in Revelations. There is something about the cube, and the way it manifests in Genesis 1 as 288 x 288 x 288, and in Revelations as 12 x 12 x 12, and now in the genetic code as 4 x 4 x 4.

Anyway, out of curiosity I decided to look into this.

Firstly, can a magic square or magic cube be made out of 64 items numbered 1 to 64?

Below is the 8x8 Magic Square whose sum is 260.
It is constructed by writing the numbers 1...64 in sequence
and then reversing the order of the darker entries:



64 2 3 61 60 6 7 8

9 55 54 12 13 51 50 16

17 47 46 20 21 43 42 24

40 26 27 37 36 30 31 32

32 34 35 29 28 38 39 25

41 23 22 44 45 19 18 48

49 15 14 52 53 11 10 56

8 58 59 5 4 62 63 1


Rather interestingly, each column sums to 260, as do the diagonals

Since 8x8 = 64 = 4x4x4 is both a square and a cube
(the smallest such number greater than 1)
you can use the same numbers and a similar method
to construct a 4x4x4 Magic Cube with sum 130.

Here is such a cube as constructed by Meredith Houlton:


1 63 62 4
60 6 7 57
56 10 11 53
13 51 50 16

48 18 19 45
21 43 42 24
25 39 38 28
36 30 31 33

32 34 35 29
37 27 26 40
41 23 22 44
20 46 47 17

49 15 14 52
12 54 55 9
8 58 59 5
61 3 2 64


The sum of the 8x8 Magic Square, 260,
is twice the sum (130) of the 4x4x4 Magic Cube.

Hi Craig,

I did a slight alteration to your Magic Cube...apparently a couple numbers got repeated and a couple got deleted.

64 2 3 61 60 6 7 57

9 55 54 12 13 51 50 16

17 47 46 20 21 43 42 24

40 26 27 37 36 30 31 33

32 34 35 29 28 38 39 25

41 23 22 44 45 19 18 48

49 15 14 52 53 11 10 56

8 58 59 5 4 62 63 1

Blessings,
Rose

Craig.Paardekooper
01-21-2011, 01:32 AM
Thanks for making the corrections.


64 02 03 61 60 06 07 57

09 55 54 12 13 51 50 16

17 47 46 20 21 43 42 24

40 26 27 37 36 30 31 33

32 34 35 29 28 38 39 25

41 23 22 44 45 19 18 48

49 15 14 52 53 11 10 56

08 58 59 05 04 62 63 01


Now all the rows and all the columns and the diagonals of the magic square all sum to the same = 260

The darker numbers form the outline of a number 8, surounded by two other 8's (888), which is interesting since it occurs in a square of 8 x 8, and when the dark numbers are summed we get 8 x 130. Also the figure of the central number "8" is contained within a block of digits that sum to 8 x 130 ! And the sum of the numbers in any quadrant of this pattern comes to 4 x 130. The four numbers forming the very heart of the pattern (37, 36, 29, 28) also sum to 130.



As for the magic cube, the rows and columns sum to 130. This works in 3 dimensions !

01 63 62 04
60 06 07 57
56 10 11 53
13 51 50 16

48 18 19 45
21 43 42 24
25 39 38 28
36 30 31 33

32 34 35 29
37 27 26 40
41 23 22 44
20 46 47 17

49 15 14 52
12 54 55 09
08 58 59 05
61 03 02 64


This is interesting, since, as you know, in gematria 13 and 26 mean "One Lord", or "Love the Lord" - the embodiment of the Shema, and the total 3 x 13 is the core of the creation verse in the gospel of John.

Anyway, having established the nominal order that gives rise to the magic square and magic cube, next I need to allocate a codon to each of the numbers from 1 to 64 and see what arises when these are slotted into place.

The most natural way of allocating a codon to a number (from 1 to 64) is to do so in the same order as the codons appear in the genetic code table.

Each codon is associated with an amino acid, and each amino acid has an atomic number. Anyway, we'll just see what happens. This is fun. It's a bit like playing with a rubics cube. It might be worth making a physical model of this cube to help with trying out different arrangements.

Rose
01-21-2011, 10:11 AM
Thanks for making the corrections.


64 02 03 61 60 06 07 57

09 55 54 12 13 51 50 16

17 47 46 20 21 43 42 24

40 26 27 37 36 30 31 33

32 34 35 29 28 38 39 25

41 23 22 44 45 19 18 48

49 15 14 52 53 11 10 56

08 58 59 05 04 62 63 01


Now all the rows and all the columns and the diagonals of the magic square all sum to the same = 260

The darker numbers form the outline of a number 8, surounded by two other 8's (888), which is interesting since it occurs in a square of 8 x 8, and when the dark numbers are summed we get 8 x 130. Also the figure of the central number "8" is contained within a block of digits that sum to 8 x 130 ! And the sum of the numbers in any quadrant of this pattern comes to 4 x 130. The four numbers forming the very heart of the pattern (37, 36, 29, 28) also sum to 130.



As for the magic cube, the rows and columns sum to 130. This works in 3 dimensions !

01 63 62 04
60 06 07 57
56 10 11 53
13 51 50 16

48 18 19 45
21 43 42 24
25 39 38 28
36 30 31 33

32 34 35 29
37 27 26 40
41 23 22 44
20 46 47 17

49 15 14 52
12 54 55 09
08 58 59 05
61 03 02 64


This is interesting, since, as you know, in gematria 13 and 26 mean "One Lord", or "Love the Lord" - the embodiment of the Shema, and the total 3 x 13 is the core of the creation verse in the gospel of John.

Anyway, having established the nominal order that gives rise to the magic square and magic cube, next I need to allocate a codon to each of the numbers from 1 to 64 and see what arises when these are slotted into place.

The most natural way of allocating a codon to a number (from 1 to 64) is to do so in the same order as the codons appear in the genetic code table.

Each codon is associated with an amino acid, and each amino acid has an atomic number. Anyway, we'll just see what happens. This is fun. It's a bit like playing with a rubics cube. It might be worth making a physical model of this cube to help with trying out different arrangements.

Thanks for keeping us posted on your research....I find it extremely interesting....:signthankspin:

Blessings,
Rose

Craig.Paardekooper
01-23-2011, 11:15 AM
Well, each of the 64 codons cods for an amino acid, and each of the amino acids may be represented by a number signifying the mass of the amino acid.

Here are the mass numbers in ascending order -

Mass of amino acid radical -

1. 0
2. 0
3. 0
4. 1
5. 1
6. 1
7. 1
8. 15
9. 15
10. 15
11. 15
12. 31
13. 31
14. 31
15. 31
16. 31
17. 31
18. 42
19. 42
20. 42
21. 42
22. 43
23. 43
24. 43
25. 43
26. 45
27. 45
28. 45
29. 45
30. 47
31. 47
32. 57
33. 57
34. 57
35. 57
36. 57
37. 57
38. 57
39. 57
40. 57
41. 58
42. 58
43. 59
44. 59
45. 72
46. 72
47. 72
48. 72
49. 73
50. 73
51. 75
52. 81
53. 81
54. 91
55. 91
56. 100
57. 100
58. 100
59. 100
60. 100
61. 100
62. 107
63. 107
64. 130

It would be interesting to see if anything appears when they are slotted into the magic square.


130 000 000 100 100 001 001 100

015 091 091 031 031 075 073 031

031 072 072 042 042 059 058 043

057 045 045 057 057 047 047 057

057 057 057 045 045 057 057 043

058 043 043 059 072 042 042 072

073 031 031 081 081 015 015 100

015 100 100 001 001 107 107 000

I cannot see any pattern here. Still it was worth trying.

Craig.Paardekooper
02-10-2011, 10:02 PM
It is strange how this latest discovery came about. Over the last week there were noticable occasions when amidst a conversation spoken by others, a word or phrase was suddenly highlighted and somehow amplified - as if it was spoken directly AT me - words to do with symmetry. On another occasion a child peering out of a window across a beautiful panorama, started speaking a rhyme "Tiger, tiger burning bright, in the darkness of the night, which immortal hand or eye could frame thy fearful symmetry." The phrase left me entranced - almost spellbound.

The impact of these indirect and embedded messages was to awake an unconscious desire to recommence my study of genetics. Then on 9th February I felt ready. It was as if a fire was coursing through me re-igniting a firm intention. The time had come. I retrieved all the papers on genetics that I had so carefully photocopied and lay them all around my bed, and made a commitment that tomorrow I would begin a thorough research again. That night I awoke suddenly at 4am - instantly I was completely wide awake. By 6am I had completed this posting.

If we label these 4 columns as A, B, C, and D we can say -

A + D = 2 x 666 + 2 x 37

B + C = 2 x 703 - 2 x 37

Also,

A + C = 2 x 703 - 2 x 73

B + D = 2 x 666 + 2 x 73

http://www.craigdemo.co.uk/amino7.jpg

Putting these equations into the previous diagram, we can see how they integrate with the developing pattern.

The Outer Columns = A + D = 2 x 666 + 2 x 37

The Inner Columns = B + C = 2 x 703 - 2 x 37

The Odd Columns = A + C = 2 x 703 - 2 x 73

The Even Columns = B + D = 2 x 666 + 2 x 73


Vernon found a pattern encoded in the Genesis 1 narrative. The initial hypothesis was that if the Biblical God was also the author of life, then we would find a similar pattern within the code of life (ie genetics). Well we now have this curious play on all 4 of the numbers found in Vernon's Genesis1 pattern - 666, 703, 37 and 73

This data seems to confirm the hypothesis - that the Biblical God is also the author of life. It would follow from this that the genetic code really is a language made of "words", proceeding from The Word, and these "words" are readable - consequently they may contain meaningful information, a message, that we are meant to read.

The mathematical pattern illustrated above, is just one example of such a message.



Vernon's web pages (http://www.otherbiblecode.com)

Rose
02-10-2011, 10:29 PM
Taking a look at the diagram of the 20 amino acids again

http://www.craigdemo.co.uk/AminoAcidMassHorizontal.jpg

Recapping, we have seen that the outer two columns sum to 2 x 703, and the inner two columns sum to 2 x 666.

If we label these 4 columns as A, B, C, and D we can say -

A + D = 2 x 703

B + C = 2 x 666

I noticed something else this morning -

A - B = -73

C - D = - 2 x 73

Consequently we obtain the following remarkable equations

A + C = 2 x 703 - 2 x 73

B + D = 2 x 666 + 2 x 73

http://www.craigdemo.co.uk/amino3.jpg

All this is quite remarkable

So now we have an integrated play including not all 4 numbers - 37, 73, 666 and 703.

I must say, this is getting more and more facinating.

Amazing! Keep up the good work...:thumb:

Rose

Craig.Paardekooper
02-13-2011, 08:18 AM
By Sunday my excitement about my latest discovery had been tempered by the fact that the data I was using (the same amino acid masses that were used by Rakocevic) only yielded approximate results. I was aware that Steve Coneglan had used rather more precise data to confirm the previous pattern I had posted, but I did not get around to inputting that data. So I felt relaxed and almost complacent about what would appear next. Sunday afternoon I received this email from Steve, who had completed inputing his more accurate data to see if it verified my pattern. The results are astonishing, more so than I could ever have imagined. The pattern has been shown to be PRECISELY correct.

PS. The figures that Steve Coneglan uses for the masses of each amino acid are more accurate than the figures that I used. I was happy just to decipher the general pattern using the figures used by Rakocevic. Steve went on to collect the exact figures from Wikipedia for the mass of each amino acid. As a result he was able to fine tune my observations and confirm the pattern in a really remarkable and astounding way. Thankyou Steve. You have no idea how happy I am to see the results confirmed in such a precise way.

What we have found here is of absolute importance. This pattern speaks loudly of design, and whatsmore it indicates who the designer is - the genetic pattern bears the same "signature" as the Genesis 1 pattern.


Email sent by Steve Coneglan to Craig Paardekooper


Hi Craig,

Doubling up a bit, I know, but here is a copy of an email I sent off to Vernon today.
It details your latest findings.
What still blows me away is the accuracy of the figures pertaining to the sums of the columns.
These are not just amazing near misses, they are in fact exactly precise!
There is no remainder for either of the sets pertaining to the fine-tuning instruments of 37 and 73.
This precision within the standard scientific parameters is simply astonishing.

Stephen



Hi there, Craig!

I just checked out your latest post at Richard's website and saw the stuff involving the number 73.
You have already demonstrated how the number 37 plays the leading role in the organisation of Rakocevic's table of the amino acids.
To see the number 73 also playing a fine-tuning role to the '37-dependent' phenomena is really quite astounding.
I had to double check your results for veracity.

Indeed, I have found your contentions concerning the columns to be exactly correct!
Using the table from Vernon's website, which is linked below, the following sums attain:


1.C1 + C3 = 755.77 + 503.50 = 1259.27 = (2 x 703) - (2 x 73) - 0.73
2.C2 + C4 = 828.87 + 649.86 = 1478.73 = (2 x 666) + (2 x 73) + 0.73

http://www.whatabeginning.com/Misc/Genetics/Rakbou.htm

Thus, you are perfectly correct when you assert that the number 73 plays the leading role in fine-tuning the data for these columns.
We saw previously that the number 37 played the fine-tuning role for the respective outer and inner column sums of 1405.63 and 1332.37.
To see these two numbers as the modifiers for the sums of the columns of Rakocevic's table of the amino acids speaks loudly of design to those of us who are conversant with Vernon's work.
As you remark, the pairs (37, 73) and (666, 703) are the backbone of the structure Vernon discovered for the Genesis 1.1 sum.

A word on Rakocevic's table as presented at Vernon's page, above.
The amino acid molar masses for this table were obtained from Wikipedia, and are standard as far as I can tell.
By this I mean that it is standard scientific practice to limit the molar mass to two decimal places when measuring the values for each of the amino acids.
Sometimes the molar masses are given to four decimals, but as far as I can tell these are not in fact any more accurate than those given to two decimal places.
In neither case is any of the amino acids actually physically weighed.
The following excerpts from the Wikipedia page on Molar mass confirm the facts just mentioned:

A useful convention for normal laboratory work is to quote molar masses to two decimal places for all calculations. This is more accurate than is usually required, but avoids rounding errors during calculations. When the molar mass is greater than 1000 g/mol, it is rarely appropriate to use more than one decimal place. These conventions are followed in most tabulated values of molar masses.

Molar masses are almost never measured directly. They may be calculated from standard atomic masses, and are often listed in chemical catalogues and on material safety data sheets (MSDS).

I checked your sums for the rows, and these were also accurate to within 0.08.
The sums, again using the figures from Vernon's table, are:


1.485.48 + 595.71 + 485.49 = 1566.68 = (2 x 703) + (2 x 73) + (2 x 7.3) + 0.08
2.585.69 + 585.63 = 1171.32 = (2 x 666) - (2 x 73) - (2 x 7.3) - 0.08

Interestingly, the sums for the rows at Vernon's table also involved a small margin of error, in this case 0.025.
These kinds of margins are exceptionally small.
But what is really amazing is that the sums for the columns are EXACT.
One set of paired columns is regulated by the number 37, and the other is regulated by the number 73.

Now, if you look at the pair (37, 73) you will note that their midpoint is the number 55.
Thus, (37 + 18 = 55), and (73 - 18 = 55).
This fact can also be demonstrated geometrically.
The hexagram of 73 has a hexagonal core of 37, and is constituted of two intersecting triangles, each with a value of 55.
In an impressive feat of numerical engineering, the fine-tuning for the alternating values of Rakocevic's table is regulated by none other than the number 55.
Making recourse to Vernon's webpage yet again, you will note this fact graphicked below:

http://www.whatabeginning.com/Misc/Genetics/Alternate.htm

That the number 55 should also feature is perhaps not merely a matter of chance.
There is the following palindromic numero-geometrical triple of triples, these following the form [hexagon - triangle - hexagram]:


1.[37 - 55 - 73]
2.[397 - 595 - 793]
3.[3997 - 5995 - 7993]

The pattern ends after that.
That each of the triples reproduces itself when read from either right to left or left to right is really rather impressive.
Perhaps there is some information in this phenomenon.
At all events, I would propose that the fine-tuning factor of 55 for the alternating values is another case of numerical design implicit in Rakocevic's table.
I would further propose that it is a supplement to your own discoveries concerning the manner in which the numbers 37 and 73 act as the fine-tuning for the different sums pertaining to the columns.
As a final remark on this point, it is interesting to note that the difference between the margins of error for the rows - 0.08 and 0.025 respectively - is regulated by the number 55.
Thus, 0.08 - 0.025 = 0.055.

As ever, it has been a pleasure looking in at your discoveries, Craig.
There is little that can be added to your own description of these discoveries except to say that it has been a privilege to bathe in their afterglow.
Thank you so much for sharing your discoveries, and I eagerly look forward to seeing what deeper treasures you are yet to unearth.

Blessings to you, Craig!

Stephen Coneglan


Email sent by Steve Coneglan to Vernon Jenkins :


I wish to bring to your attention Craig's latest finding concerning the values from Rakocevic's table.
As you may recall, you did an excellent webpage to present Craig's earlier discoveries.
Rakocevic's table from this webpage is set out, below:



Rehearsing the particular details from the columns of Rakocevic's table, we observe the manner in which the number 37 acts as the fine-tuning mechanism for the sums attained:


1.C2 + C3 = 828.87 + 503.50 = 1332.37 = (2 x 666) + 0.37
2.C1 + C4 = 755.77 + 649.86 = 1405.63 = (2 x 703) - 0.37

These sums Craig has rewritten as:


1.C2 + C3 = 828.87 + 503.50 = 1332.37 = (2 x 703) - (2 x 37) + 0.37
2.C1 + C4 = 755.77 + 649.86 = 1405.63 = (2 x 666) + (2 x 37) - 0.37

Craig made the following discovery a few days ago:


1.C1 + C3 = 755.77 + 503.50 = 1259.27 = (2 x 703) - (2 x 73) - 0.73
2.C2 + C4 = 828.87 + 649.86 = 1478.73 = (2 x 666) + (2 x 73) + 0.73

Immediately the role of the numbers 37 and 73 as the respective fine-tuning mechanisms for each set of sums comes to our attention.
Not only this, but the similarity of the equations in which the sets of sums are expressed is equally impressive.
As Craig remarks, it is impossible to miss the manner in which the pairs (37, 73) and (666, 703) dictate proceedings.
Craig remarks yet again that these pairs of numbers are the backbone of the geometrical representation of Genesis 1.1 which you discovered quite some time ago, Vernon.

I would like to propose some further numero-geometrical phenomena at play here in Rakocevic's table.
The required diagram can be found below:


Alternating the elements of Table 2:






As noted at your webpage, the fine-tuning for the alternating set of values represented in Rakocevic's table is mediated by the number 55.
Thus:


1.1331.45 = (2 x 666) - 0.55
2.1406.55 = (2 x 703) + 0.55

As you are no doubt aware, Vernon, the number 55 relates numero-geometrically to the pair (37, 73).
Recapping, 55 is the numerical midpoint of the pair (37, 73).
This numerical fact can be represented geometrically, where the geometrical sequence [hexagon - triangle - hexagram] is fulfilled by the numerical sequence [37 - 55 - 73].
As you have previously written, self-intersection of T10 (= 55) generates the [hexagon - hexagram] pair of [37 - 73].

Needless to say, Craig's latest discovery offers overwhelming proof that the numbers which underpin the geometry of Genesis 1.1 - viz. the pairs (37, 73) and (666, 703) - are also present in the fine-tuning of the molar masses of the amino acids.
These molar masses are not a matter of private interpretation.
They were taken from an open source website, Wikipedia, and are available for all to peer review and critique.
The fact that the sums, above, wherein the numbers 37 and 73 play the fine-tuning role, are EXACT is surely something to behold.
The breath-taking simplicity with which the sets of equations obey almost the same form watermarks them further as having emanated from the same Author as Genesis 1.1.

I will let you peruse this latest finding of Craig's at your own leisure, Vernon.
It is quite amazing that the number 73 should also appear as a fine-tuning mechanism for the columns.
I had wondered if there was any significance to the alternating values having an orb of allowance of 0.55.
I think Craig's latest finding helps to answer this question.
The values [37 - 55 - 73] have a profound numero-geometrical presence.
To find their decimal expressions as the fine-tuning mechanisms for three essential divisions of Rakocevic's table (RT) is simply astonishing.

Before concluding, it is perhaps worth mentioning Craig's final finding over the last few days.
You previously noted that the rows produced values accurate to within 0.025 of (37 x 37) in dividing RT, as below:

concerning the row totals: row 1 corresponds closely with row 5, and row 2 with row 4; we may therefore envisage the table's value, 2738, to be bisected by a horizontal line passing through the centre of the third row - yielding the square of 37 both above and below, thus:




Craig alternated the rows in sums:


1.R1 + R3 + R5 = 485.48 + 595.71 + 485.49 = 1566.68 = (2 x 703) + (2 x 73) + (2 x 7.3) + 0.08
2.R2 + R4 = 585.69 + 585.63 = 1171.32 = (2 x 666) - (2 x 73) - (2 x 7.3) - 0.08

Here, the orb of allowance is 0.08.
Interestingly, if we compare the orbs of allowance for the rows, the number 55 reappears.
Thus, 0.08 - 0.025 = 0.055.

Who knows what the next step will be.

Craig.Paardekooper
02-15-2011, 09:29 AM
The pattern in Genesis 1 is generated by relacing each letter with a specific numerical value.

Apparently, the Hebrews have not always used this system of representing numbers with letters. According to information on the internet, it was only in the first century BC that the letters were used in this way.

Consequently in Old Testament times the Genesis 1 pattern simply did not exist.

So can I argue that the author of Genesis is also the author of the genetic code?

Rose
02-15-2011, 10:11 AM
The pattern in Genesis 1 is generated by relacing each letter with a specific numerical value.

Apparently, the Hebrews have not always used this system of representing numbers with letters. According to information on the internet, it was only in the first century BC that the letters were used in this way.

Consequently in Old Testament times the Genesis 1 pattern simply did not exist.

So can I argue that the author of Genesis is also the author of the genetic code?

Hi Craig,

What we could say is that the Genesis 1 pattern existed, but it was unknown until a numerical value was given to the letters....the same holds true for the genetic code; it existed, but was unknown.

If indeed a connection is established between the Genesis code, and the genetic code....a strong case could be made for God being the author of both.


Rose

Richard Amiel McGough
02-15-2011, 08:27 PM
The pattern in Genesis 1 is generated by relacing each letter with a specific numerical value.

Apparently, the Hebrews have not always used this system of representing numbers with letters. According to information on the internet, it was only in the first century BC that the letters were used in this way.

Consequently in Old Testament times the Genesis 1 pattern simply did not exist.

So can I argue that the author of Genesis is also the author of the genetic code?
If you are arguing that God is the author, why would there be any problem?

God knew/guided the development of the alphanumeric correlation to achieve the patterns.

Craig.Paardekooper
02-16-2011, 02:37 PM
Hi Richard and Rose and Steve,

Thankyou for your replies. After much agonizing I have resolved the issue to my satisfaction.

Vernon's pattern is a geometric archetype - an ideal form to which the genetic code approaches. His pattern makes sense of the genetic code regardless of whether his pattern is found in an ancient text or not.

As Plato surmised, geometric archetypes are eternal - they give birth to the physical world. And the physical world is a shadowy reflection of them.

I must admit, this was a real challenge - to escape from the ambiguity of historical probability into a world of mathematical certainty. But I feel very happy for making this step.

Really I am not saying anything more than that a mathematical pattern such as Vernon found in Genesis1 is a concise and way of describing the genetic patterns, since it integrates many genetic features within one simple geometry. And the fact that the genetic patterns seem to integrate within this geometry, suggests that the Genesis1 pattern was the original Idea that gave birth to the genetic code - an Idea in the mind of God .... a pattern that resides in the eternal realm of thought and spirit.

Craig

Rose
02-16-2011, 05:10 PM
Hi Richard and Rose and Steve,

Thankyou for your replies. After much agonizing I have resolved the issue to my satisfaction.

Vernon's pattern is a geometric archetype - an ideal form to which the genetic code approaches. His pattern makes sense of the genetic code regardless of whether his pattern is found in an ancient text or not.

As Plato surmised, geometric archetypes are eternal - they give birth to the physical world. And the physical world is a shadowy reflection of them.

I must admit, this was a real challenge - to escape from the ambiguity of historical probability into a world of mathematical certainty. But I feel very happy for making this step.

Craig

Hi Craig,

Your conclusion about the eternal nature of "geometric archetypes" is confirmation to a similar problem Richard and I have been struggling with, and that is of the beautiful structures of the Bible Wheel and the Holographs.

Our question is how can a pattern that so geometrically elegant, and obviously designed by God come out of a book that contains so many myths and errors....it just doesn't fit, but if one looks at these patterns as geometric archetypes, then we can see these beautiful numbers are but reflections of the eternal nature of reality.

Blessings,
Rose

Richard Amiel McGough
02-16-2011, 09:34 PM
Hi Richard and Rose and Steve,

Thankyou for your replies. After much agonizing I have resolved the issue to my satisfaction.

Vernon's pattern is a geometric archetype - an ideal form to which the genetic code approaches. His pattern makes sense of the genetic code regardless of whether his pattern is found in an ancient text or not.

As Plato surmised, geometric archetypes are eternal - they give birth to the physical world. And the physical world is a shadowy reflection of them.

I must admit, this was a real challenge - to escape from the ambiguity of historical probability into a world of mathematical certainty. But I feel very happy for making this step.

Craig
EXCELLENT! :thumb:

That's the direction I've been moving in.

I've read a lot of Jung's work on Archetypes and I have strong intuitions about the reality of "Platonic ideas" in the sense of the mathematical structure underlying Reality.

That's the approach that I am pursuing to make sense out of the Bible Wheel. How did it get "designed" without a designer? I'm thinking "strange attractors" that draw phenomenon towards the archetypes in the way that iron filings reveal the lines of a magnetic field. Or something like that! It's hard to speak with any certainty, and I'm trying to avoid speculation. But I'm in the strangest state of mind, since I no longer have a concept of a Zeus-style god that intervenes in human affairs. I can't think of an infinite God as an "agent" that makes choices and does things because agency is a property of finite beings. Thus, another possibility I'm entertaining is the idea that "angelic" beings - finite but much closer to the cosmic consciousness that is "God" - could be the agents that designed the Bible Wheel and the holographs. But I'm still inclined towards a "non-intentional" explanation like the iron filings revealing the "hidden" underlying structure of the magnetic field.

Craig.Paardekooper
02-16-2011, 11:21 PM
Hi Richard, Rose,

With regard to archetypes, they can be understood at integrating principles. They make sense of alot of disparate facts in a concise way, integrating all these facts into one pattern.

An example of an archetype would be the golden ratio, that several biological systems approach.

An archetype is like a pure thought before it is translated into a thing. A geometric archetype would be the pure idea of that geometric pattern.

Of course, translating a pure idea into a physical reality is subject to all the limitations of the physical, so many imperfections creep in, and as a result physical systems only approximate to the idea.

My personal position on this at the moment is that IDEAS still come from or are synonymous with intelligence - so archetypes do not necessarily undermine traditional concepts of God. Rather they are just thoughts or ideas in the Mind of God.

However, I see your point that if God was the direct agency, then the pattern should be perfect. So, like you say, it is as if an Idea is slowly manifested by approximation. It is almost like the idea is put out there, and the pieces gravitate towards it. Perhaps that is how some of God's ideas work. They operate like a general tide to create a statistical approximation to a pattern rather than produce a precise outcome. Reflection of the idea is there but it is faint.

"Thy will be done on earth as in heaven" is a phrase that may signify that Heaven really is the archetype for things on earth. What is shaped and created there, may have it's pale reflection here.

It would be cool to talk more about Platos forms or Jungs Archetypes. This is interesting, and I'd like to learn more about both.

.................................................

ACTUALLY, there IS a really interesting historical origin for the cipher that unlocks the Genesis1 pattern.

Apparently, the Hebrews have not always used this system of representing numbers with letters. According to information on the internet, it was only in the first century BC that the letters were used in this way. Research suggests that the Jews inherited the alpha-numeric system from the Greeks. Consequently, the system may go back to Pythagoras who taught that numbers underlie everything.

Consequently the "Axial Age" revelations (the age of Pythagoras) may have been God's way of preparing the world for this alpha-numeric revelation.

In pre-exile times the Genesis 1 pattern did exist, but the cipher that unlocks it was yet to appear. So it is impossible that the Jewish people were the authors of the hidden patterns in Genesis. The pattern must have been put there by a non-human intelligence.

That the cipher is somehow connected with Pythagoras is also suggested by the finding of Shcherbak that the "Pythagorean Triangle" is embedded within the genetic patterns. Other "Pythagorean" patterns found within the genetic code include "triangular numbers", "perfect numbers" and primes. Research suggests that Pythagoras discovered the figurate numbers - including TRIANGULAR numbers.... interesting.


It is believed that Pythagoras (or at least the Pythagoreans since they had a habit of attributing all their discoveries to Pythagoras) also developed several of the figurate numbers: numbers derived from arranging dots is regular patterns. For example, the square numbers n2, are the numbers of dots that can be arrange in a square. The triangular numbers: 1, 1+2, 1+2+3, ... are the number that can be arrange in a triangle where each row of the triangle has one more dot than the previous row. The nth triangular number is n(n+1)/2.



In addition, the Pythagoreans are credited with the discovery of PRIME and PERFECT numbers.


Greek numerals are a system of representing numbers using letters of the Greek alphabet. They are also known by the names Ionian numerals, Milesian numerals (i.e., from Miletus in Ionia), Alexandrian numerals, or alphabetic numerals. In modern Greece, they are still in use for ordinal..


Presumably, the reason why the alpha-numeric system is referred to as Ionian or Pythagorean, is because it originated with the Pythagoreans !

So, as a working hypothesis, I would suggest that the alpha-numeric system is a part of that "world revelation" that appeared during the "Axial Age", and was meant for all the gentile world.

Here is an interesting article that talks about the origin of the Greek alpha-numeric system with the Pythagoreans -


1 In the high mountains of Greece in the northeastern part of the Mediterranean, a civilization was born that influenced the world for centuries. Ancient Greece made great strides in the areas of art, philosophy, and politics, and its civilization lasted from approximately 2000 BC to 300 BC. Greece also produced some of the finest mathematical minds that ever pondered numbers. The Greeks were the first people of the ancient world who systematically studied geometry, which is the study of the size and shape of an object. While the first surveyors of Egypt understood practical elements of geometry, the Greeks asked why these applications worked. The Greeks wrote down rules for geometry that verified the observations of other ancient mathematicians.

2 The Greek language formed the basis of some of the mathematical words we use today. The word geometry comes from a Greek word for "earth measuring." Another modern word that comes from Greek is arithmetic, which comes from arithmos. The Greeks had fun with numbers, and arithmos, which means number, denoted discovering secrets and figuring out puzzles about numbers. The Greek sense of curiosity about numbers probably helped them unravel many problems that earlier mathematicians could not figure out. The Greeks loved to argue, debate, and figure out how to prove everything they observed.

3 The Greeks had a simple number system, but it was different from the Egyptian system. While the Egyptians used pictures to represent numbers, the Greeks used the letters of their alphabet. The Greeks got the idea for an alphabet from the Phoenicians, a seafaring people who lived around 1500 BC along the coast of Syria. The Greek number system used units of 5 and 10. The Greek alphabet had twenty-seven letters, so the first nine letters represented the digits 1 through 9; the second nine letters represented the tens, and the last nine letters represented the hundreds. The highest Greek number was 900. The Greeks did not have a zero, and since they rarely needed numbers higher than hundreds, the system worked fairly well. Even though the Greeks were logical about numbers, they were surprisingly superstitious too. Some numbers were evil, while other numbers were friendly or even sacred. Number 10 was the number of harmony. Number 8 was the symbol of death. Odd numbers were female, and even numbers were male.

4 The Greeks had great respect for their mathematicians. Two famous and brilliant mathematicians were Thales, the "father of geometry," and his inquisitive student, Pythagoras. The laws of nature fascinated Thales, and he studied everything from magnets to weather patterns. He also loved geometry. According to legend, Thales visited the Great Pyramid at Giza around 600 BC, and asked, "How high is the pyramid?" By that time, the pyramid was about 2,000 years old, and the Egyptian guide did not know how high it was! The question apparently caused a great deal of discussion between the guides. Meanwhile, Thales quietly figured it out based on his observations of the shadows on the sand and using his understanding of geometry. The Egyptians were so impressed with Thales that they threw themselves on the ground, convinced that he was a magician!

5 Thales taught Pythagoras, who became a brilliant pioneer in geometry. Pythagoras is most famous for the Pythagorean Theorem, which explained what the surveyors of ancient Egypt had figured out by observation. His theorem stated that, "in any right triangle, the sum of the squares of two sides is equal to the square of the hypotenuse."This theorem means that if the lengths of two sides of a right triangle are known, the length of the third side can be calculated. The Pythagorean Theorem became the cornerstone of the science of geometry. Pythagoras shared his discoveries in his school at Croton, and his students formed a secret brotherhood to study mathematica. The word mathematica meant "studies" at that time, but it eventually meant mathematics in the modern sense because of what Pythagoras taught. They defined circles, straight lines, and three-dimensional shapes, called regular solids. They also studied the relationships between degrees and angles in different kinds of triangles.



It seems that Pythagoras was taught by Thales. As I was reading the above account, the story of how Thales measured the height of the Pyramid seemed to stand out. I think that Thales was guided to measure the pyramid for a special reason. It was part of the big revelation about Number.

Best Wishes

Craig

Richard Amiel McGough
02-17-2011, 12:00 AM
My personal position on this at the moment is that IDEAS still come from or are synonymous with intelligence - so archetypes do not necessarily undermine traditional concepts of God. Rather they are just thoughts or ideas in the Mind of God.

That's exactly how I have defined archetypes: Thoughts in the Mind of God.

It's a great way to think.

As you know, my current concept of God is in flux, but the idea of an "Idea in the Mind of God" works pretty well no matter how I conceive of "God" or "Cosmic Consciousness" or "Universal Mind" or "Brahman" for that matter. It does not depend on my ultimate conception of Deity. It depends only on the concept of Mind as underlying Reality. And even then, it could be adjusted if I conclude that Mind is not fundamental (though that seems pretty unlikely).

Great topic! I'm glad it caught your interest.

Craig.Paardekooper
02-17-2011, 10:43 AM
With regard to the table of 20 amino acids published by Rakocevic, we are, now, in a position to say with great confidence that the entire table is framed around the numbers 37, 55, 73, 703 and 666

There is another phenomenon most likely hidden within the table, but yet to be detected. I refer to the phenomena of cyclic permutations

Remember that in Genesis 1 Vernon found that the last 5 words always sum to 666 + 666 + 666 no matter whether the word values are read forwards or backwards, or cycled.

Well, we should expect exactly the same phenomenin in the Amino Acid table. I will turn my attention to locating this phenomena over the coming week. Others might like to try and locate it also.



By the way, as an aside, it happens that -

666 + 666 + 666 = 288 + 828 + 882

and as we have seen previously Gen1 v 1 letters multiply to 288 x 288 x 288

....just a curious observation.





Regards

Craig

Craig.Paardekooper
02-23-2011, 08:32 AM
Background

As you know, there are 4 bases or "letters" that make up the genetic code - these are T, G, A, C

These 4 letters combine to form 64 codons, or "words", each codon consisting of 3 letters.

These 64 codons code for the 20 amino acids.

Each amino acid is made of two parts - a part that is common to all amino acids, called a "standard block", and a part that differs from one amino acid to the next - called a "radical part"


3 Groups of Codons

These 64 codons divide naturally into 3 groups -

1. Codons made of identical letters, eg TTT, GGG, AAA, CCC

2. Codons made of unique letters, eg TGA, CAG, AGT etc

3. Codons made of 2 identical letters and one unique letter, eg TTA, AAC etc


So the 64 codons divide as follows -

4 codons have identical bases

24 codons have unique bases

36 codons have 2 identical bases and one unique base


Numerical pattern in these groups

The codons with identical bases + the codons with unique bases create amino acids with where the sum of the nucleons in the radical part = 2 x 703, and the total number of nucleons in both radical + standard block = 5 x 666


The codons with two identical bases and one unique base create amino acids with 3 x 666 nucleons in the radical part and 2590 nucleons in the standard block.

These relationships can be seen more clearly in the diagram below -

http://www.craigdemo.co.uk/shcherbak64.jpg

The whole pattern is based around multiples of 37, in particular 703, 666 and 259

Actually, this pattern is only the surface pattern. Within each group there are symmetrical subdivisions that also sum to multiples of 37.


Shcherbak is quite clear in his conclusion that the entire genetic code is based on arithmetic. It is a pure construction of mathematical precision.

Regards

Craig

Craig.Paardekooper
02-23-2011, 08:59 AM
I have just come across a new paper on Shcherbak's patterns.

The self-similar numbers as a special case of cyclic numbers and their relation to the cyclic (genetic) codes (29th Nov 2010)

Abstract
The genetic code is analyzed as one of the major natural codes, which as such can reveal the deeper principles of optimal coding. The analysis is based on a discovery that the symmetrical architecture of genetic code and the nucleon number of its constituents - the free canonical amino acids and bases, are strictly determined by the prime number with a cycling digit property -037. A detailed derivation for all types of analogues of 037 is given and shown that they represent a special case of cyclic numbers whose digits and multipliers are equidistant. The derived generic formula for analogues of 037 is correlated with cyclotomic and generalized Golden Mean polynomials, by which is shown their relation with discrete self-similarity, why author named them the Self-similar Numbers. Also it is given their relationship with the cyclic codes, which is with fact that the genetic code is arranged in multiple ways at different levels as a cyclic code, generally indicate that the hierarchically nested cyclicality is one of the principles of fractal organization of the genetic code, as well as the other organic codes in the living organisms.

This paper appears in: Neural Network Applications in Electrical Engineering (NEUREL), 2010 10th Symposium on
Issue Date: 23-25 Sept. 2010
On page(s): 97 - 102
Location: Belgrade
Print ISBN: 978-1-4244-8821-6
INSPEC Accession Number: 11676971
Digital Object Identifier: 10.1109/NEUREL.2010.5644099
Date of Current Version: 29 November 2010

I found a website were you can access this paper - Paper (http://geneticcode.webs.com)


A good way to locate the latest papers on this subject is to google -

"Shcherbak arithmetic in the genetic code pdf"


Regards

Craig

Rose
02-23-2011, 10:51 AM
Background

As you know, there are 4 bases or "letters" that make up the genetic code - these are T, G, A, C

These 4 letters combine to form 64 codons, or "words", each codon consisting of 3 letters.

These 64 codons code for the 20 amino acids.

Each amino acid is made of two parts - a part that is common to all amino acids, called a "standard block", and a part that differs from one amino acid to the next - called a "radical part"


3 Groups of Codons

These 64 codons divide naturally into 3 groups -

1. Codons made of identical letters, eg TTT, GGG, AAA, CCC

2. Codons made of unique letters, eg TGA, CAG, AGT etc

3. Codons made of 2 identical letters and one unique letter, eg TTA, AAC etc


So the 64 codons divide as follows -

4 codons have identical bases

24 codons have unique bases

36 codons have 2 identical bases and one unique base


Numerical pattern in these groups

The codons with identical bases + the codons with unique bases create amino acids with where the sum of the nucleons in the radical part = 2 x 703, and the total number of nucleons in both radical + standard block = 5 x 666


The codons with two identical bases and one unique base create amino acids with 3 x 666 nucleons in the radical part and 2590 nucleons in the standard block.

These relationships can be seen more clearly in the diagram below -

http://www.craigdemo.co.uk/shcherbak64.jpg

The whole pattern is based around multiples of 37, in particular 703, 666 and 259

Actually, this pattern is only the surface pattern. Within each group there are symmetrical subdivisions that also sum to multiples of 37.


Shcherbak is quite clear in his conclusion that the entire genetic code is based on arithmetic. It is a pure construction of mathematical precision.

Regards

Craig
Hi Craig,

Fascinating stuff...:thumb: Thanks for keeping us posted...:signthankspin:
Blessings,
Rose

Craig.Paardekooper
02-24-2011, 03:41 AM
Here is the link to the paper by Rakocevic

Rakocevic Paper (http://infolib.hua.edu.vn/Fulltext/ChuyenDe2009/CD43/43.38.pdf)

Chavez paper (http://www.iscid.org/papers/Chavez_Palindromati_101505.pdf)

Craig.Paardekooper
02-26-2011, 12:52 AM
Here is a link to a paper I have written about Rakocevic. It is not quite complete yet.

http://www.craigdemo.co.uk/geneticscode1.pdf

Craig.Paardekooper
03-06-2011, 03:38 PM
Stephen Coneglan just emailed to me his latest research on the Rakocevic patterns.

Stephen has rearranged Rakocevics 4 x 5 matrix of the 20 amino acids, so that the amino acids are arranged symmetrically according to their properties.

When he did this, Stephen discovered that the new arrangement shows precise symmetry not just in the columns but also in the rows.

Further more, Stephen discovered that a "doublet" pattern has emerged centred on the number 55.

Stephen's paper (http://www.craigdemo.co.uk/rakocevicpaper2.doc)

Craig.Paardekooper
03-06-2011, 03:44 PM
Craig

Enjoy reading your work on DNA & threads on Biblewheel. Have been reading Richard’s site since long before he brought his biblewheel book out. Though I haven’t contributed to it. My other love is molecular biology and looking for the imprint of the creator in our own cellular make-up. cr

Your interest has largely been in the translation of RNA codons into Amino-Acids.

Just wanted to add for your interest a few things that have suggested to me that the creator may have left His imprint.


[1] - DNA distribution.
DNA in cells could be divided into 3 arenas :
--- 1 pair of sex chromosomes ....................... does this hint of the Hebrew ALEPH and father
--- 22 autosome pairs ........................................ does this hint to the Hebrew TAV, a mark, cross & written word - maybe Jesus, the Word
- from Aleph to Tav represented in the nucleus
--- together with circular DNA in the powerhouse of cells - the mitochondria -- wheels of DNA a little like the Hebrew word for wheel Galgal from 3rd Hebrew letter. Each mitochondrion in humans and many animals having one circular DNA with 37 genes.

Guess I see metaphorical hints of Father, Son & Holy Spirit in the overall layout. The 3 hebrew letters associated with the above being A,T,& G. Is it a coincidence that the beginning codon of every protein to be made in the protein factory is methionine = ATG ............... even though they stand for english named nucleosides. (If cytosine C was replaced by the Hebrew letter kaph K=11 as there is no letter C in Hebrew, then the sum of the Hebrew Letters A,T,G,K = 37 ........ 1+22+3+11 with ATG summing to 26 - elohim )

[2]
Each DNA rung is made up of :
- a 5 ringed ribose
- a 6 ringed pyramidine ---- T or C
- a purine ------- a combination of a 6 ring and 5 ring to make a double ringed structure that has 10 struts with a middle bond like a waist belt ------ A or G
- a 5 ring ribose


As the 2 strands of DNA open up and swing out then it is possible for the ring structure count of each DNA rung to become 10,5,6,5 similar to the tetragrammaton. Metaphorically the maker can be said to have hidden his name in each and every strand of DNA in every living thing.


5 elements are used to make up DNA - P,O,N,C,H -- their atomic numbers sum to 37 [ 15+8+7+6+1] and their nucleons sum to 74


[3]
Strange to me that we humans should run at 37* centigrade - ie 37 / 100ths of the temperature difference between water freezing and steaming. Funny the places that the old 37 crops up.


[4]
HISTONES
To coil and store the 2 metres of DNA in each human cell the molecule is wrapped around little spools called NUCLEOSOMES which allows the DNA to be further compacted and twisted, eventually the compression process becoming a visible chromosome. 147 base pairs of DNA [ 7x3x7] are wrapped around a nucleosome consisting of histone protein spool of 8 histone protein spokes in a 1.65 Left handed super-helical turn. Though some studies suggest 146 base pairs [73 x 2] are coiled.


{A study of the geometry of the organelles within a cell is also an interesting study. I have put a diagram below of the DNA clamp that goes along each double strand as it is replicated - an interesting symbol !


If you are interested to look at protein geometry in cells - http://beautifulproteins.blogspot.com/


Anyway this email was really just to suggest our Maker has left imprints in other parts of biology as well as the codon-amino acid code ........... which IS amazing in its own right as you suggest.


Regards - Paul Millican

Rose
03-06-2011, 05:46 PM
Craig

Enjoy reading your work on DNA & threads on Biblewheel. Have been reading Richard’s site since long before he brought his biblewheel book out. Though I haven’t contributed to it. My other love is molecular biology and looking for the imprint of the creator in our own cellular make-up. cr

Your interest has largely been in the translation of RNA codons into Amino-Acids.

Just wanted to add for your interest a few things that have suggested to me that the creator may have left His imprint.


[1] - DNA distribution.
DNA in cells could be divided into 3 arenas :
--- 1 pair of sex chromosomes ....................... does this hint of the Hebrew ALEPH and father
--- 22 autosome pairs ........................................ does this hint to the Hebrew TAV, a mark, cross & written word - maybe Jesus, the Word
- from Aleph to Tav represented in the nucleus
--- together with circular DNA in the powerhouse of cells - the mitochondria -- wheels of DNA a little like the Hebrew word for wheel Galgal from 3rd Hebrew letter. Each mitochondrion in humans and many animals having one circular DNA with 37 genes.

Guess I see metaphorical hints of Father, Son & Holy Spirit in the overall layout. The 3 hebrew letters associated with the above being A,T,& G. Is it a coincidence that the beginning codon of every protein to be made in the protein factory is methionine = ATG ............... even though they stand for english named nucleosides. (If cytosine C was replaced by the Hebrew letter kaph K=11 as there is no letter C in Hebrew, then the sum of the Hebrew Letters A,T,G,K = 37 ........ 1+22+3+11 with ATG summing to 26 - elohim )

[2]
Each DNA rung is made up of :
- a 5 ringed ribose
- a 6 ringed pyramidine ---- T or C
- a purine ------- a combination of a 6 ring and 5 ring to make a double ringed structure that has 10 struts with a middle bond like a waist belt ------ A or G
- a 5 ring ribose


As the 2 strands of DNA open up and swing out then it is possible for the ring structure count of each DNA rung to become 10,5,6,5 similar to the tetragrammaton. Metaphorically the maker can be said to have hidden his name in each and every strand of DNA in every living thing.


5 elements are used to make up DNA - P,O,N,C,H -- their atomic numbers sum to 37 [ 15+8+7+6+1] and their nucleons sum to 74


[3]
Strange to me that we humans should run at 37* centigrade - ie 37 / 100ths of the temperature difference between water freezing and steaming. Funny the places that the old 37 crops up.


[4]
HISTONES
To coil and store the 2 metres of DNA in each human cell the molecule is wrapped around little spools called NUCLEOSOMES which allows the DNA to be further compacted and twisted, eventually the compression process becoming a visible chromosome. 147 base pairs of DNA [ 7x3x7] are wrapped around a nucleosome consisting of histone protein spool of 8 histone protein spokes in a 1.65 Left handed super-helical turn. Though some studies suggest 146 base pairs [73 x 2] are coiled.


{A study of the geometry of the organelles within a cell is also an interesting study. I have put a diagram below of the DNA clamp that goes along each double strand as it is replicated - an interesting symbol !


If you are interested to look at protein geometry in cells - http://beautifulproteins.blogspot.com/


Anyway this email was really just to suggest our Maker has left imprints in other parts of biology as well as the codon-amino acid code ........... which IS amazing in its own right as you suggest.


Regards - Paul Millican

Hi Craig,

Thanks for posting Paul Millican's e-mail....:signthankspin: Also, I went to the Beautiful Proteins Blogspot and was amazed at the stunning symmetries of many proteins....

Thanks again,
Rose

Craig.Paardekooper
03-12-2011, 02:44 PM
On 12th March 2011, Stephen Coneglan emailed me his latest research on mathematical patterns in the amino acids.

What he has discovered is that the arrangement of the amino acids that gives rise to the numerical symmetries is not a random arrangement - rather the numerical patterns appear when the amino acids are arranged symmetrically according to their various chemical properties.

Here is his latest updated paper, which includes much new info in the appendices.

http://www.craigdemo.co.uk/stephenbook.doc

In order to review Stephens findings I will email his findings to Rakocevic, Shcherbak and Perez tomorrow. Their feedback will be invaluable.

Craig

Craig.Paardekooper
03-19-2011, 04:37 AM
Vladimir Shcherbak has replied to the papers that we submitted to him for review.

Here is his response -


Dear Craig,

thank for your longstanding interest to my research. You have attached two articles. Article by Stephen Coneglan updates 5x4 table of 20 canonical amino acids published by Miloje Rakocevic in JTB while your article gives geometrical interpretation to these results. I think that Miloje Rakocevic finding became even more brilliant due to your scrupulous research.

However, pure mathematical approach to the genetic code and its numerical parameters threatens to be the scholastic one. To avoid scholasticism I try, for example, to interpret my results as instruction on possible universal arithmetic grammar of genomes. By the way, I recommend you to pay attention to the second Chargaff's rule (see attached articles). This phenomenon and its total power may be a continuation of the genetic code arithmetical order, this time in genomes. Therefore we – I and my young colleague Maxim Makukov – are searching now for analogous numerical grammar in genomes.

There are two squared numbers of total sum 2x37^2=2738 in your articles. On the other hand there is equation 12^2+35^2=37^2 among Pythagorean numbers. I would like to ask you and Stephen: is it possible to bisect regularly 5x4 table and its total sum producing the same equations 12^2+35^2=37^2 and 12^2+35^2=37^2? I ask this question because the genetic code has shown already the first Pythagorean number.

Yours sincerely

Vladimir

Mr Shcherbak also attached two documents that he thought would be of interest. Shcherbak and his colleague Maxim Makukov, are now searching for similar patterns in genomes.

Document1 (http://www.craigdemo.co.uk/geneticpatternsgenomes1.pdf)

Document1 (http://www.craigdemo.co.uk/geneticpatternsgenomes2.pdf)


It has always been my hope that through work such as this we leave behind something beautiful - a pure pattern of meaning and purpose - a foundation stone.

Craig.Paardekooper
07-02-2011, 12:20 PM
I came across this website -

http://www.u5d.net/ama/subama/Subpages/list_contents.html

The author can be contacted here -

a.wohlin@u5d.net

The patterns he has found are interesting.

alec cotton
07-08-2011, 10:06 AM
Hello Craig
I am so pleased that you chose to write so profoundly on this subject. I have been away from the forum for a few months because I was discouraged by some of the feeble remarks , writings and drivel which I read. I was also saddened ,angered and stung by the fact that some writers who take the name of Christ ( in vain) sometimes quote 'evolution ' as a proven fact. Implicit in the idea of evolution is Darwen's theory of evolution by the (accidental ) selection of the species.. That theory is nothing more than the rambling ravings of a deranged mind.No sane person with a modicum of judgement would countenance such a notion for five minutes.The only reliable record that we have is written in stone. The fossil record shows that there were periods of about 50 million years when nothing changed. Then there was a dramatic change . These changes were so profound that the geological periods are instantly recognisable by the fossils which they contain .At the beginning of each period , vast numbers of new species appear and each one is ideally suited to the new environment That is observable fact. The Darwenist will tell you that the ocean was a primordial soup. In this soup ,certain chemicals emerged which accidently coalesced and formed life. POPPYCOCK. D.N.A is basic . Now D.N.A is a particular chemical and needs fine tuning . Although it resembles a translucent , slimy substance : It has properties which are truly astounding.
In order to function at all ,the atoms and molecules must be arranged in a particular way.First an atom of phosphorous must be attached to a molecule of deoxiribose which is stuck to an atom of phosphorous to form a chain. Now , sticking out from each of these links is a 'base' chemical ; one of four. It needs another chain to coalesce to form a molecule . D.N.A cannot function in isolation. It needs it's counterpart R.N.A for support. The D.N.A must then wrap itself round a molecule of protein in order to initiate the miracle of life. To suggest that this all happened by accident is utterly ludicrous. Now you point out the fantastic numerical structure That in itself leaves no room for doubt . GOD IS.
Badly served by Alec

Craig.Paardekooper
07-09-2011, 09:25 AM
July 9th 2011

Here is the latest work as researched by Steve Coneglan.

A New Table of the Amino Acids (http://www.craigdemo.co.uk/aminoacids.doc)


I found this passage that I really like for it's clarity. It is a definition of Life.


Life is Cells
People like to say, as if it were obvious, that life is hard to define. This is misleading. Life has properties that clearly distinguish it from everything else. First, every living thing is cellular. In other words, it is either a single-celled creature or a creature composed of many cells. Every cell is bounded by its own outer membrane and contains a full set of instructions necessary for its operation and reproduction. Furthermore, every cell uses the same operating system: "DNA makes RNA makes protein." DNA is a long complex molecule that contains the cell's instructions. It is transcribed into RNA, another long complex molecule similar to DNA; and then the RNA transcript is translated into protein. There are hundreds of billions of different proteins used by living things (3), but all of them are made from the same twenty amino acids, the "building blocks of life. Reference : http://www.panspermia.org/whatis2.htm

So these twenty amino acids, are the building blocks from which ALL cellular creatures are made ,from bacteria to humans. And we have found that these twenty amino acids form an incredible mathematical pattern centred around two numbers - 666 and 703. What is so odd is that these are the very same numbers around which the Genesis 1 narrative is built.

Anyway, regardless of the similarity of these numbers with Genesis 1, what is sure to follow is the openning up of a greater understanding of the genetic code not just as a collection of incredible instructions, but also as something having symmetry and beauty in it's mathematical form, and containing meaningful symbolic patterns. It seems that it is more than a "machine" language (designed only to be read by biological machines) - it also embodies levels of symbolic meaning for US to read. Why else were these mathematical patterns built into the genetic code ?

Craig.Paardekooper
07-10-2011, 04:53 AM
Here are a collection of videos showing the process by which DNA creates life.

DNA to Life (http://www.craigdemo.co.uk/dnaprotein.htm)

Richard Amiel McGough
07-10-2011, 07:52 AM
Here are a collection of videos showing the process by which DNA creates life.

DNA to Life (http://www.craigdemo.co.uk/dnaprotein.htm)
Thanks for the links.

But I don't see how they are relevant to Christianity. Muslims think they prove Allah create life.

They don't help prove the God of the Bible because the Bible does not say that God designed DNA that then resulted in humans after millions of years of evolution.

Rose
07-10-2011, 08:12 AM
Here are a collection of videos showing the process by which DNA creates life.

DNA to Life (http://www.craigdemo.co.uk/dnaprotein.htm)

Hi Craig,

Thanks for the link...:signthankspin:
It does indeed seem highly likely that life on the DNA level had a designer, but that in no way points to the Bible as being God's instruction book, or the God portrayed within its pages being the designer. There are far too many flaws manifest in the character of Yahweh, for any god like him to have created life.

I don't see how a God who is more concerned with solving every human problem by killing something, whether it be animals or humans could possibly be the same being that designed the universe!

All the Best,
Rose

Craig.Paardekooper
07-10-2011, 12:06 PM
Hi Rose

All the evidence for intelligent design only points to the role of intelligence or consciousness in the formation of life. It is simply a realisation that there is more than just matter in our universe - that consciousness is distinct and irreducible, and has always been present, alongside matter, from the beginning.

However, the mathematical patterns in the genetic code in themselves indicate intelligence. These same patterns are encoded in Genesis 1 which indicates that the author of those patterns in Genesis 1 was the author of DNA. (the human author was not necessarily the author of the hidden patterns, if his primitive hand was guided unconsciously)

Creation is very red in tooth and claw. Creatures do prey upon each other. There is disease and death. All this is by the DESIGN of what ever intelligence created our world. So I don't find it hard to square such a creator with the Biblical God.

The problem might lie in our view of God as a "nice, kindly, benevolent old man". It should always be remembered that suffering exists in our world BY DESIGN - and must therefore serve some special purpose. This is not meant to be a paradise where all our needs are instantly met, where no one dies or ever gets ill, or ever has an accident.

God is red in tooth and claw - but there is a reason and purpose for this

Rose
07-10-2011, 01:32 PM
Hi Rose

All the evidence for intelligent design only points to the role of intelligence or consciousness in the formation of life. It is simply a realisation that there is more than just matter in our universe - that consciousness is distinct and irreducible, and has always been present, alongside matter, from the beginning.

However, the mathematical patterns in the genetic code in themselves indicate intelligence. These same patterns are encoded in Genesis 1 which indicates that the author of Genesis 1 was the author of DNA.

Creation is very red in tooth and claw. Creatures do prey upon each other. There is disease and death. All this is by the DESIGN of what ever intelligence created our world. So I don't find it hard to square such a creator with the Biblical God.

The problem might lie in our view of God as a "nice, kindly, benevolent old man". It should always be remembered that suffering exists in our world BY DESIGN - and must therefore serve some special purpose. This is not meant to be a paradise where all our needs are instantly met, where no one dies or ever gets ill, or ever has an accident.

God is red in tooth and claw - but there is a reason and purpose for this
Hi Craig,

I must wholeheartedly disagree with the idea that the biased, unbalanced, and immoral god of the Bible called Yahweh, could possibly be the intelligent mind behind the elegant design of DNA. Just because one finds parallels in mathematical patterns in DNA with Genesis, or the beautiful patterns found in the Bible Wheel, does not necessarily point to the fact that the intelligent mind of the universe is the biblical Yahweh.

I'm not looking for "God" to manifest any human qualities such as being a "nice", "kindly", or a "benevolent" old man, in fact that is one of the main objections I have to the "God" portrayed in the Bible...he is far too human in his attributes of masculinity, gender bias and aggressive dominating behavior, which leads me to the inevitable conclusion that Yahweh is fashion in the image of man by the minds of men.

Man is the one who is red in tooth and claw!

Nature is always in the process of balancing itself, which in turn causes growth of the whole system. Things are pulled back towards the negative and swing forward toward the positive continually self-regulating and progressing forward to a higher level. That is far different than saying a god purposely designed the male/female parts of creation to be imbalanced and inferior and then set up rules to promote that inequality.

All the Best,
Rose

Craig.Paardekooper
07-10-2011, 02:25 PM
OK Richard and Rose.

All that evidence for design shows is that life is a product of intelligence or consciousness. And Intelligence or consciousness is not hard for us to find. Most living things display consciousness.

Now consciousness cannot be reduced to matter. Our universe cannot be explained in terms of matter alone. We need matter + consciousness. Which means consciousness was there from beginning, along with matter.

Consciousness is found in most forms of life to varying degrees - even the most primitive - which is another reason why it was most likely there from the beginning.

Even the smallest consciousnesses acting over time can produce significant results. So do we need to postulate a god-like consciousness at all?

Well maybe.
A consciousness that could create a single cell would need to be quite intelligent and powerful - certainly more intelligent than any human being. So we can think of it's intelligence as being super-human or "god-like"

It is a fair statement that such a consciousness is of unknown identity. It could be the god of any religion. It could, hypothetically, be a general field of consciousness without any specific identity, or even a Gaian consciousness - a kind of sum of all the consciousnesses of all the creatures.

It is nameless.

All this would be fine, except for -

a curious mathematical pattern built into DNA which has the same signature pattern as Genesis 1

Richard Amiel McGough
07-10-2011, 02:33 PM
Hi Rose

All the evidence for intelligent design only points to the role of intelligence or consciousness in the formation of life. It is simply a realisation that there is more than just matter in our universe - that consciousness is distinct and irreducible, and has always been present, alongside matter, from the beginning.

However, the mathematical patterns in the genetic code in themselves indicate intelligence. These same patterns are encoded in Genesis 1 which indicates that the author of Genesis 1 was the author of DNA.

I have no problem at all with the idea that there is an intelligence underlying reality. Indeed, I have always tended towards an idealist view of mind as the primary "stuff" of reality, and material objects are just objects in the mind (not fundamentally distinct from ideas).

I am still trying to understand how the design of the holographs like Genesis 1:1, John 1:1, Deut 6:4 and others relate to the "truth" of the Bible. The fact that they show signs of being designed by extreme intelligence only proves that the traditional Christian interpretations of the Bible can't be right because they are intellectually inferior and certainly not worthy of a Mind that could have designed the Holographs. Remember, the HIGHEST VIEW of Scripture assumes it was designed by a powerful intelligence and so accepts it as given. And when I accept it as given, it clearly declares that it is full of errors and must not be believed in any "literal" sense. I just love the irony .... :p

Rose
07-10-2011, 02:42 PM
OK Richard and Rose.

All that creation shows is that life is a product of intelligence or consciousness.

Intelligence or consciousness is not hard for us to find. Most living things display consciousness.

Now consciousness cannot be reduced to matter. Our universe cannot be explained in terms of matter alone. We need matter + consciousness.

So consciousness was there from beginning, along with matter.

Consciousness is found in most forms of life to varying degrees - even the most primitive - which is another empirical reason why it was most likely there from the beginning.

Even the smallest consciousnesses acting over time can produce significant results.

So do we need to postulate a god-like consciousness at all.

Well maybe.

A consciousness that could create a single cell would need to be quite intelligent and powerful - certainly more intelligent than any human being. So we can think of it's intelligence as being super-human or "god-like"

It is a fair statement that such a consciousness is of unknown identity. It could be the god of any religion. It could, hypothetically, be a general field of consciousness without any specific identity, or even a Gaian consciousness - a kind of sum of all the consciousnesses of all the creatures.

It is nameless.

All this would be fine, except for -

a curious mathematical pattern built into DNA which has the same signature pattern as Genesis 1

That is the mystery, which I do not have an answer for, but what I do know is that an intelligent mind capable of designing the universe cannot be the god Yahweh that the Bible portrays! My search continues...:pop2:

All the Best,
Rose

Craig.Paardekooper
07-10-2011, 02:50 PM
The holographs and patterns encoded in the Bible are products of intelligence.

They are like unconscious manifestations of that intelligence. On the overt level we have a crude God. However, on an unconscious level, we have all this amazing stuff.

It is a bit like a child painting a picture, but unconsciously his hand is being guided. The result is a picture that looks crude on the surface, but may contain profound symbols.

It is as if on a conscious level the Jews were guided by primitive and human intelligence, but on an unconscious level there was something else guiding them.



The nearer the people come to God, the more does the unconscious Intelligence become conscious. So we have the prophets whose conscious conception of God is more advanced than Moses'. And we have Jesus whose conscious conception of God is even more advanced.

What does this mean in terms of the written word. It means that you have to look harder to find God's hand in the conscious writings when the vessel (the person) is more primitive and more alienated from Him. In such people, God's influence is buried deeper. But the unconscious appearance of amazing codes and symbols indicates that a higher intelligence is at work in the background nevertheless.

As a person or people becomes more advanced and less alienated from God, then they become more conscious of God's hand, and a truer picture of God manifests in their conscious writings.

Finally, God is able to step right out of their writings, and the word becomes flesh.



The Mosaic Laws and practices of 1500 B.C.- were quite retributive, ritualistic and warlike. God was alienated from the people and only accessible via a priesthood, and even then only once a year on the day of atonement. There was a very great distance between them and God.

770 years later, with the prophets Isaiah, Jeremiah, Ezekiel, Daniel, we have a religion that is very different. This was the Axial Age. Compassion has replaced retribution, personal devotion has supplanted external ritual, animal sacrifice has been replaced by personal surrender, and the priesthood and temple system thrown down. These seeds of change were sown in each of the 7 world religious movements that emerged at this time. The direction of change was towards direct access to God without the mediation of a priesthood - in other words, people moved closer to God.

Then over the following 770 years we have the Times of the Gentiles, culminating in Christ and the Kingdom of God. Christ claimed unity with God, so here we find a fuller awareness and manifestation of God's true nature.

All the way through this whole process from Moses to Christ, we had God operating in the background. That's why the axial age religions all appeared at the same time across the globe, and why they all speak a similar language.

Note that the Kingdom of God only appeared at the end. Jesus does not say that the Kingdom of God was around in the times of Moses and Joshua - that was the Kingdom of men - primitive men.



So the Bible has two layers.

1. The constant layer of God's presence witnessed by hidden patterns and codes that were not put there by men (their hands were being unconsciously guided)
2. The conscious writings of the various authors of the books in the Bible which shows a definite ethical progression from warlike retribution to compassion over the period 1500 B.c. to 70 A.D.

The ethical progression co-oincides with a definite change from outward to inward religion - in other words - with a greater closeness to God.

This whole progression was orchestrated by God acting upon men often in an unconscious way, as is witnessed by the key events of the Axial Age, and their timing. Isaiah is at the midpoint. It was God who brought the First Temple to an end and orchestrated the rising and falling of the gentile empires. Everything was timed.

Rose
07-10-2011, 07:07 PM
The design of the Bible Wheel gives strong evidence for some type of supernatural connection and influence from another realm of reality. Whether one believes that a creator god such as the one portrayed in the Bible is responsible for the Bible Wheel’s design, or a Collective Cosmic Consciousness composed of the sum of the whole body of thought (minds) that has ever existed is somehow responsible for influencing individuals throughout the course of human history…it matters not. What does matter though is the fact that this design does exist and human hands were instrumental in its formation…thus, creating a tool which can be used as a Mandala, through which meditation upon can help guild each individual on their own unique spiritual journey in this life.

A central idea that seems to have set the biblical writers apart from all others of that time period was the concept of a single 'creator-god' who had always existed and was responsible for the creation of all that exists. This is by far the closet that anyone had come up to that point on having one united whole 'Being' instead of many gods. If we then think of the 'one god' as being the universal Collective Consciousness that began from the individual human consciousness when it reached its point of self awareness, and then continued to grow out of and was dependant on each individual. In much the same way as evolution builds upon itself, giving rise to greater development of intelligence and endurance; the same theory can be applied to the rise and development of the universal Collective Consciousness. As Self Consciousness emerged from human life and began to build upon itself creating and adding to a universal Collective Consciousness, this in turn created a feedback loop which added to the knowledge of the human, thus progressing forward which caused the universal Collective Consciousness to rise to a higher level completing a cycle of growth. This exemplifies the idea of the Triangular Principle which states that struggle which pulls backwards, causes a push forward, creating progress which results in growth, thus creating a triangular movement.

The stories and ideas contained in the Bible rose out of the archetypal unconscious 'Self' as it emerged into the conscious mind, thus creating myths and fantasies to color and clothe those archetypal images of the collective unconscious. These primal images from the unconscious self can only be given form when they have become conscious, and thus become filled with the material from the conscious self. The way these archetypes are transformed depends on the state of consciousness of the individual in which the archetype has arisen, which is highly dependant on the cultural background of the individual. This explains why in the biblical narrative many of the qualities attributed to 'God' are similar to the gods of the cultures of that time period.

The god of the Bible was formed out of the images contained in the collective unconscious and given shapes and attributes from the world around those ancient peoples. The patterns and designs of the Bible form what is like a Creation Template manifesting meta-level archetypes that seem to have formed from the influence of the Collective Consciousness that in a sense guided the hands of the biblical writers. This is not to say the primitive clothing hung upon these archetypes is an actual portrayal of 'God', but rather the intelligent structure that forms the foundation is evidence of a higher level of consciousness.

Rose

Craig.Paardekooper
07-10-2011, 09:58 PM
The design of the Bible Wheel gives strong evidence for some type of supernatural connection and influence from another realm of reality. Whether one believes that a creator god such as the one portrayed in the Bible is responsible for the Bible Wheel’s design, or a Collective Cosmic Consciousness composed of the sum of the whole body of thought (minds) that has ever existed is somehow responsible for influencing individuals throughout the course of human history…it matters not. What does matter though is the fact that this design does exist and human hands were instrumental in its formation…thus, creating a tool which can be used as a Mandala, through which meditation upon can help guild each individual on their own unique spiritual journey in this life.


Basically you are saying that there is evidence of supernatural design in the Bible eg the Bible Wheel.

For me, the other evidence of supernatural involvement would be
- fulfilled prophecy of the Major prophets of the Axial Age
- the Sign of the Son of Man
- the gematrical patterns relating to Genesis, Israel
- the fulfillment of the story of Enoch


The Bible was written by people with limited understanding, but at the same time contains things that they could not have been consciously aware of. A hand was guiding them unconsciously.


The stories and ideas contained in the Bible rose out of the archetypal unconscious “Self” as it emerged into the conscious mind, thus creating myths and fantasies to color and clothe those archetypal images of the collective unconscious. These primal images from the unconscious self can only be given form when they have become conscious, and thus become filled with the material from the conscious self. The way these archetypes are transformed depends on the state of consciousness of the individual in which the archetype has arisen, which is highly dependant on the cultural background of the individual. This explains why in the biblical narrative many of the qualities attributed to “God” are similar to the gods of the cultures of that time period.


The Bible demonstrates instances where supernatural influence is below the threshold of conscious awareness - eg the Bible Wheel. And some people seem to be more aware of such influence than others eg prophets and Christ.

:yo:

Rose
07-11-2011, 08:15 AM
Basically you are saying that there is evidence of supernatural design in the Bible eg the Bible Wheel.

For me, the other evidence of supernatural involvement would be
- fulfilled prophecy of the Major prophets of the Axial Age
- the Sign of the Son of Man
- the gematrical patterns relating to Genesis, Israel
- the fulfillment of the story of Enoch


The Bible was written by people with limited understanding, but at the same time contains things that they could not have been consciously aware of. A hand was guiding them unconsciously.



The Bible demonstrates instances where supernatural influence is below the threshold of conscious awareness - eg the Bible Wheel. And some people seem to be more aware of such influence than others eg prophets and Christ.

:yo:

Hi Craig,

I am really enjoying this conversation...:yo:

The supernatural design of the Bible Wheel cannot be denied - that is a fact - so, from that premise I began my search for answers. When one reads Scripture from an educated position, most of it is unbelievable - and rightly so. My challenge became "How do I reconcile its supernatural design with its blatant, biased human content?"

The closer I get to the truth, the more it seems that the authors of the Bible were influenced and guided by connections to a higher intelligence, through the archetypes of their collective unconscious. These connections appeared through dreams, visions, intuitions, and meditations which in turn were clothed with the customs, ideas, and traditions of the authors time period...hence, we find in the Bible an underlying structure of supernatural design that is clothed with a mixture of sometimes clashing stories and myths, which readers take as a description of the god who created the universe. I believe the nature and beauty of the underlying design is what is descriptive of a higher intelligence, NOT the clothing hung upon it by ancient man.

A comparison of sorts can be made to the underlying design of DNA in life, which can be expressed in many random, mutated and disjointed ways belying the precise design of the foundational DNA at its core.

All the Best,
Rose

Richard Amiel McGough
07-11-2011, 08:53 AM
The holographs and patterns encoded in the Bible are products of intelligence.

They are like unconscious manifestations of that intelligence. On the overt level we have a crude God. However, on an unconscious level, we have all this amazing stuff.

It is a bit like a child painting a picture, but unconsciously his hand is being guided. The result is a picture that looks crude on the surface, but may contain profound symbols.

It is as if on a conscious level the Jews were guided by primitive and human intelligence, but on an unconscious level there was something else guiding them.



The nearer the people come to God, the more does the unconscious Intelligence become conscious. So we have the prophets whose conscious conception of God is more advanced than Moses'. And we have Jesus whose conscious conception of God is even more advanced.

What does this mean in terms of the written word. It means that you have to look harder to find God's hand in the conscious writings when the vessel (the person) is more primitive and more alienated from Him. In such people, God's influence is buried deeper. But the unconscious appearance of amazing codes and symbols indicates that a higher intelligence is at work in the background nevertheless.

As a person or people becomes more advanced and less alienated from God, then they become more conscious of God's hand, and a truer picture of God manifests in their conscious writings.

Finally, God is able to step right out of their writings, and the word becomes flesh.

Hey there Craig,

I'm really glad you are working with us to articulate the meaning of the patterns in the Bible and how they relate to the more crude "surface text." I've been struggling with this question for over a year now.

I tend to agree that there is a very strong "unconscious" element - indeed, that's how I have understood Bible Wheel for many years. I thought of the "hidden hand of God" directing the folks who put together the Bible. But my conception of God has changed. God is "too big" to be an agent like you or me. God is everyone and so cannot "move about" like a finite being. God is the all-inclusive Ground of Being and so cannot have a will biased towards finite fragments of Reality as if God were a bit player in the Cosmic Play. But on the other hand, God is intimately involved in every event, a sparrow does not fall without God's knowledge. I believe God is conscious and intelligent and highly dynamic though "unmoving" since there is nowhere for God to go. Like an ever-shifting kaleidoscopic image with an unmoving center.

A good visual metaphor is a galaxy. God is like the galactic core and limited spiritual beings (angels) are like stars orbiting that core. The ultimate "pattern of Unity" revealed in the Bible Wheel comes from the Mind of God but is implemented by the "angels" or "realized beings" or whatever we should call them. They inject the specific information into the Bible through subtle influences, inspirations, dreams, and visions.

But still there is a huge problem - how are we to understand the "plain message" of the Bible that is so obviously false and unworthy of the true God? I don't know yet ... I'm still working on this.



The Mosaic Laws and practices of 1500 B.C.- were quite retributive, ritualistic and warlike. God was alienated from the people and only accessible via a priesthood, and even then only once a year on the day of atonement. There was a very great distance between them and God.

770 years later, with the prophets Isaiah, Jeremiah, Ezekiel, Daniel, we have a religion that is very different. This was the Axial Age. Compassion has replaced retribution, personal devotion has supplanted external ritual, animal sacrifice has been replaced by personal surrender, and the priesthood and temple system thrown down. These seeds of change were sown in each of the 7 world religious movements that emerged at this time. The direction of change was towards direct access to God without the mediation of a priesthood - in other words, people moved closer to God.

Then over the following 770 years we have the Times of the Gentiles, culminating in Christ and the Kingdom of God. Christ claimed unity with God, so here we find a fuller awareness and manifestation of God's true nature.

All the way through this whole process from Moses to Christ, we had God operating in the background. That's why the axial age religions all appeared at the same time across the globe, and why they all speak a similar language.

Note that the Kingdom of God only appeared at the end. Jesus does not say that the Kingdom of God was around in the times of Moses and Joshua - that was the Kingdom of men - primitive men.



So the Bible has two layers.

1. The constant layer of God's presence witnessed by hidden patterns and codes that were not put there by men (their hands were being unconsciously guided)
2. The conscious writings of the various authors of the books in the Bible which shows a definite ethical progression from warlike retribution to compassion over the period 1500 B.c. to 70 A.D.

The ethical progression co-oincides with a definite change from outward to inward religion - in other words - with a greater closeness to God.

This whole progression was orchestrated by God acting upon men often in an unconscious way, as is witnessed by the key events of the Axial Age, and their timing. Isaiah is at the midpoint. It was God who brought the First Temple to an end and orchestrated the rising and falling of the gentile empires. Everything was timed.
I think that is an excellent approach. We are compelled by truth and logic to reject the aspects of the Bible that are not "worthy of God" and that should not be accepted as "literal truth." Only then will we be able to receive the pure and truly divine message that is being transmitted through this amazing and compelling book.

This is getting pretty clear. The "literalist" approach to the Bible is obviously fallacious and does great violence against the true message of God contained in the Bible.

Great chatting!

Craig.Paardekooper
07-11-2011, 11:32 AM
The spiritual principles taught by Jesus are also found in other religions. Essentially they are about OUR spiritual nature is, and how to fulfill it.

Perhaps the best thing we can draw from any religion is to understand the general principles that they all hold in common.

Rose
07-11-2011, 12:55 PM
The spiritual principles taught by Jesus are also found in other religions. Essentially they are about OUR spiritual nature is, and how to fulfill it.

Perhaps the best thing we can draw from any religion is to understand the general principles that they all hold in common.

You are so right...:thumb: The best path to follow draws understanding from all peoples perception of the Divine. The garments that "God" is clothed with may change through time and culture, but I believe the underlying desire of all people has been to try and connect with what they perceive to be the "divine consciousness" which we are an intimate part of.

We must learn to look past the outward trappings that has clothed the god of the Bible, and see the divine consciousness that lies underneath...expressed by its beautiful design and structure.

All the Best,
Rose

Richard Amiel McGough
07-11-2011, 12:59 PM
The spiritual principles taught by Jesus are also found in other religions. Essentially they are about OUR spiritual nature is, and how to fulfill it.

Perhaps the best thing we can draw from any religion is to understand the general principles that they all hold in common.
You are so right...:thumb: The best path to follow draws understanding from all peoples perception of the Divine. The garments that "God" is clothed with may change through time and culture, but I believe the underlying desire of all people has been to try and connect with what they perceive to be the "divine consciousness" which we are an intimate part of.

We must learn to look past the outward trappings that has clothed the god of the Bible, and see the divine consciousness that lies underneath...expressed by its beautiful design and structure.

All the Best,
Rose
I agree with both of you! I think this is an extremely important way to view religion.

Rose
07-12-2011, 06:49 AM
Throughout history biblical readers have strove to understand who this god of the Bible 'Yahweh' is and why his image changes so much throughout the course of Scripture. That problem is solved when one views the imagery of god displayed in the Bible as the clothing hung upon people’s concept of the divine. The garments of myth and fables merely manifest how ancient man viewed 'God' in their primitive mindset, which continued to changes with knowledge. The same is not true for the design manifest by the Bible Wheel, which underlies the cover of biblical garments…unveiling beauty and symmetries that endure unchanging through all ages.


Rose

CWH
07-13-2011, 09:08 AM
Hi Craig,

Thanks for the link...:signthankspin:
It does indeed seem highly likely that life on the DNA level had a designer, but that in no way points to the Bible as being God's instruction book, or the God portrayed within its pages being the designer. There are far too many flaws manifest in the character of Yahweh, for any god like him to have created life.

I don't see how a God who is more concerned with solving every human problem by killing something, whether it be animals or humans could possibly be the same being that designed the universe!

All the Best,
Rose

What's wrong with killing? If you believe in the survival of the fittest, you must believe in the killing of weak animals so that the species will survive due to natural selection. The predatory animals need to kill those animals in order to survive and to maintain a balanced ecology and population so that all animals survive in harmony. This is the wisdom of God.

Does the survival of the fittest applies to humans? Yes or No? If Yes why yes, if No why not?

The Bible is all about the survival of the fittest and they are the righteous people.


May God's wisdom be with everyone of you, Amen :pray:

Richard Amiel McGough
07-13-2011, 10:53 AM
What's wrong with killing?
So now the Christians are the ones advocating murder, and the non-Christians are the ones advocating morality and goodness.

The world has truly been turned upside down.

Rose
07-13-2011, 11:10 AM
What's wrong with killing? If you believe in the survival of the fittest, you must believe in the killing of weak animals so that the species will survive due to natural selection. The predatory animals need to kill those animals in order to survive and to maintain a balanced ecology and population so that all animals survive in harmony. This is the wisdom of God.

Does the survival of the fittest applies to humans? Yes or No? If Yes why yes, if No why not?

The Bible is all about the survival of the fittest and they are the righteous people.


May God's wisdom be with everyone of you, Amen :pray:

Survival of the fittest applies to nature, it is just the way things evolved... animals have no choice in the matter, but with humans its a whole different story. When our brains became big enough to be able to make choices because of knowledge, then we were able to help those who are weaker or less fortunate, thus overcoming nature.

All the Best,
Rose

Richard Amiel McGough
07-13-2011, 11:13 AM
What's wrong with killing? If you believe in the survival of the fittest, you must believe in the killing of weak animals so that the species will survive due to natural selection. The predatory animals need to kill those animals in order to survive and to maintain a balanced ecology and population so that all animals survive in harmony. This is the wisdom of God.

Hanky Panky (aka Hank Hanegraaff, the Bible Answer Man) stronlgly disagrees. He says that evolution through natural selection is the worst possible way God could have created life [source (http://www.equip.org/bible_answers/what-about-theistic-evolution-)]:



Under the banner of 'theistic evolution,' a growing number of Christians maintain that God used evolution as his method for creation. This, in my estimation, is the worst of all possibilities. It is one thing to believe in evolution; it is quite another to blame God for it. Not only is theistic evolution a contradiction in terms—like the phrase flaming snowflakes—but in the words of the Nobel prize-winning evolutionist Jacques Monod:

'[Natural] selection is the blindest, and most cruel way of evolving new species. . . . The struggle for life and elimination of the weakest is a horrible process, against which our whole modern ethic revolts. . . . I am surprised that a Christian would defend the idea that this is the process which God more or less set up in order to have evolution.'
First, the biblical account of creation specifically states that God created living creatures according to their own 'kinds' (Genesis 1:24–25 (http://biblia.com/bible/nkjv/Genesis%201.24%E2%80%9325)) As confirmed by science, the DNA for a fetus is not the DNA for a frog, and the DNA for a frog is not the DNA for a fish. Rather the DNA of a fetus, frog, or fish is uniquely programmed for reproduction after its own kind. Thus while the Bible allows for microevolution (transitions within 'the kinds') it does not allow for macroevolution (amoebas evolving into apes or apes evolving into astronauts).



Furthermore, your assertion that "this is the wisdom of God" is meaningless, because natural selection doesn't involve God at all. It's what things do in the ABSENCE of God!



Does the survival of the fittest applies to humans? Yes or No? If Yes why yes, if No why not?

The Bible is all about the survival of the fittest and they are the righteous people.


May God's wisdom be with everyone of you, Amen :pray:
Where in the world did you get the idea that the "righteous" survive better than others? Have you never read the Bible? Have you never looked around you? The "righteous" are led to the slaughter like sheep (Psa 44:22) while the unriighteous get rich (Psa 73).

Craig.Paardekooper
07-14-2011, 02:04 PM
When our brains became big enough to be able to make choices because of knowledge, then we were able to help those who are weaker or less fortunate, thus overcoming nature.


Consciousness in general has the ability to "overcome nature". For example -
1. Freewill : freedom from chains of causation
2. Purpose : A future "cause" determines the present
3. Truth : the ability to hold a belief based on it's truth rather than the chemical composition of ones brain

etc etc

Consequently the irreducible nature of consciousness means that we are chiefly aware of it in others because they constantly show instances of "overcoming nature".

The pervasiveness of consciousness in nature means that design isn't so much the product of chance or God, but rather the product of chance or consciousness.

This makes sense because when we think of God we normally think of a spiritual being, ie a consciousness. And of course there are many consciousnesses in nature - you being one of them.

Rose
07-14-2011, 08:50 PM
Consciousness in general has the ability to "overcome nature". For example -
1. Freewill : freedom from chains of causation
2. Purpose : A future "cause" determines the present
3. Truth : the ability to hold a belief based on it's truth rather than the chemical composition of ones brain

etc etc

Consequently the irreducible nature of consciousness means that we are chiefly aware of it in others because they constantly show instances of "overcoming nature".

The pervasiveness of consciousness in nature means that design isn't so much the product of chance or God, but rather the product of chance or consciousness.

This makes sense because when we think of God we normally think of a spiritual being, ie a consciousness. And of course there are many consciousnesses in nature - you being one of them.

Once consciousness arose in animals the next step was self-consciousness, the state of being aware of oneself...from that point on humans became aware of their own selves, naturally connecting the idea of right and wrong using themselves as the model for morality.

When one is aware of disliking something done to their own selves, one then projects that dislike onto others, hence the birth of the "Golden Rule" or "Morality". Self-consciousness is the state from which morality was born, that is what sets us apart from all the other animals...the ability to project our own feelings and desires onto another being and know that it is either right or wrong because of our own awareness.

Self-awareness also gave birth to the idea of purpose and beginnings. Naturally when one is aware of their own existence the question emerges...where did I come from, and what is my purpose? Thus the idea of a creator who created us for a purpose naturally arose, since our origins are hidden from our understanding.

All the Best,
Rose

CWH
07-16-2011, 08:23 PM
Hanky Panky (aka Hank Hanegraaff, the Bible Answer Man) stronlgly disagrees. He says that evolution through natural selection is the worst possible way God could have created life [source (http://www.equip.org/bible_answers/what-about-theistic-evolution-)]:



Furthermore, your assertion that "this is the wisdom of God" is meaningless, because natural selection doesn't involve God at all. It's what things do in the ABSENCE of God!


Where in the world did you get the idea that the "righteous" survive better than others? Have you never read the Bible? Have you never looked around you? The "righteous" are led to the slaughter like sheep (Psa 44:22) while the unriighteous get rich (Psa 73).

Natural selection is false. I have never seen any animals evolved. A cat is still a cat and a dg is still a dog no matter how one breeds them. A robot is still a robot no matter how humans made them. Show me any evidence that animals, germs are made by the random accumulations of atoms and molecules.

Haven't you read the Bible also whether the righteous were killed or not, they eventually got rewarded. And heavenly rewards were what the apostles were after:

Matthew19:28 Jesus said to them, 'Truly I tell you, at the renewal of all things, when the Son of Man sits on his glorious throne, you who have followed me will also sit on twelve thrones, judging the twelve tribes of Israel. 29 And everyone who has left houses or brothers or sisters or father or mother or wife[e] or children or fields for my sake will receive a hundred times as much and will inherit eternal life.

"Seek ye first the kingdom of God and His RIGHTEOUSNESS and all these things (Luxuries) shall be added unto you"


Have you never looked around you? The "righteous" are led to the slaughter like sheep (Psa 44:22) while the unriighteous get rich (Psa 73).[/QUOTE]

Are you saying that to be unrighteous is good?..oh my...oh my....oh my.... you really need our prayers.:pray::pray: Better to store up treasures in heaven where moths and rusts do not damage and thieves do not steal. You are too earthly bound, think heavenly.


Lets us always seek God's kingdom first and His Righteousness.:pray:

Richard Amiel McGough
07-16-2011, 08:33 PM
Natural selection is false. I have never seen any animals evolved. A cat is still a cat and a dg is still a dog no matter how one breeds them. A robot is still a robot no matter how humans made them. Show me any evidence that animals, germs are made by the random accumulations of atoms and molecules.

You don't understand the basic elements of science. Very sad.



Are you saying that to be unrighteous is good?..oh my...oh my....oh my.... you really need our prayers.:pray::pray: Better to store up treasures in heaven where moths and rusts do not damage and thieves do not steal. You are too earthly bound, think heavenly.

I didn't say a word about the unrighteous being "good." Why would you make us something so stupid like that?

Craig.Paardekooper
07-17-2011, 09:48 AM
Natural selection is a waste removal process, where by weaker creatures are less likely to breed, hence they are removed from the gene pool. However, natural selection does not actually generate new genetic information.

It subtracts the weak, it does not add the strong.

Also, what makes something fit? It is fit because it is more able to survive and breed.

In a hypothetical world where no creatures had any desire to survive or breed - in such a world, natural selection would be inoperative.

So the law of natural selection presupposes a purpose or drive towards survival and reproduction. It is interesting that natural selection can only operate where there is a pre-existing purpose or drive.

Richard Amiel McGough
07-17-2011, 01:21 PM
Natural selection is a waste removal process, where by weaker creatures are less likely to breed, hence they are removed from the gene pool. However, natural selection does not actually generate new genetic information.

It subtracts the weak, it does not add the strong.

Also, what makes something fit? It is fit because it is more able to survive and breed.

In a hypothetical world where no creatures had any desire to survive or breed - in such a world, natural selection would be inoperative.

So the law of natural selection presupposes a purpose or drive towards survival and reproduction. It is interesting that natural selection can only operate where there is a pre-existing purpose or drive.
Hey Craig,

I'm glad you want to discuss this. I think natural selection is a very important concept. If it operates as you suggest, then evolution would clearly be an impossibility. So let's take a look at the interpretation you suggest.

1) Natural selection only "subtracts the weak" and does not "add the strong."

I don't understand how there could be the asymmetry that you suggest. In as much as the "weak" are weak because their DNA differs from the "strong" it is evident that natural selection will change the relative frequency of the DNA in the gene pool so there will be more specimens with the DNA of the "strong." This is the definition of "evolution." Now let's suppose there is a random mutation that makes one of the animals slightly stronger yet. That new information will be passed on to it's offspring and after a while it will dominate the gene pool. This means that there is "new information" in the DNA that has evolved through natural selection. What part of this explanation do you challenge?

2) In a hypothetical world where no creatures had any desire to survive or breed - in such a world, natural selection would be inoperative.

I think your premise is invalid. Your statement depends on the assumption that the first organisms required a "desire to breed" which is false because they reproduced asexually. The "desire to breed" then evolved along with the evolution of sexual reproduction. If not, then sexual reproduction would never have evolved. To support this argument, you will have to show why "desire to breed" could not evolve, and that seems like an impossible task, especially since we have evidence that the "desire to breed" is determined by DNA [link (http://www.livescience.com/10488-study-sexual-desire-genes.html)], and anything dependent upon DNA is subject to natural selection. Indeed, this is exactly what you stated: natural selection will select organisms with DNA that programs for a "stronger" sexual desire.

3) So the law of natural selection presupposes a purpose or drive towards survival and reproduction. It is interesting that natural selection can only operate where there is a pre-existing purpose or drive.

This would be correct if we understood the "drive" as the free energy available in the non-equilibrium state of the earthly environment. Sunlight provides free energy. Plants do not "seek" anything - they don't even have a nervous system. This is the error in your premise - it looks like you were thinking only of animal evolution.

Personally, I see only one unsolved problem that presents any real challenge to the theory of evolution: The origin of DNA. That's a huge problem, and I have no idea how it will be solved. But that's not even a problem with the theory of evolution per se, which technically is the study of how organisms evolved given DNA. The problem of the origin of life is a separate question, and its solution (or lack thereof) will not alter the facts relating to the common descent of all living organisms.

So what do you do with the DNA evidence that indicates common descent? Even Christian Francis Collins, former head of the Humane Genome Project and Evangelical Christian, believes the evidence for common descent is conclusive.

Craig.Paardekooper
07-27-2011, 08:35 PM
Hi Ram,

With regards to point 1
the mechanism that you propose for introducing new variety is random mutation. My argument is that random mutation acting upon a highly complex genetic code will tend to damage it. Random mutation is a destructive process - comparable to exposure to radiation. It will produce lots of mutants. Natural selection will then operate to conserve the quality of the original stock by removing those mutants. So natural selection is a conservation process.

It is a shame that Darwinism has resorted to something as horrific as mutation as their only source of creation, and have neglected to consider consciousness of having any input.

Anyway, why would anything confer a selective ADVANTAGE? Why would any state be preferable to another? The whole idea of "advantage" and "preference" implies that an animal is driven towards a goal, and that their current state is an advantage for achieving that goal. That is why I do not think that natural selection can operate in animals in the absence of goal-driven behaviour. I admit that I was only thinking of animals when I thought of this argument.

With plants it is different. Plants dont behave. They are just living physical structures. Anything is an advantage if it is conducive to their growth and reproduction. So natural selection can only begin to operate once mechanisms for growth and reproduction are in place. Natural selection cannot itself produce those mechanisms.

Richard Amiel McGough
07-27-2011, 08:52 PM
Hi Ram,

With regards to point 1
the mechanism that you propose for introducing new variety is random mutation. My argument is that random mutation acting upon a highly complex genetic code will tend to damage it. Random mutation is a destructive process - comparable to exposure to radiation. It will produce lots of mutants. Natural selection will then operate to conserve the quality of the original stock by removing those mutants. So natural selection is a conservation process.

Anyway, why would anything confer a selective ADVANTAGE? Why would any state be preferable to another? The whole idea of "advantage" and "preference" implies that the living thing is driven towards a goal, and that their current state is an advantage for achieving that goal. That is why I do not think that natural selection can operate in the absence of goal-driven behaviour.
Hey there Craig,

I don't think you understand how random mutations and natural selection works. Maybe if you respond to the actual words I wrote it will help you understand. And if not, maybe I will get a better idea of how to help you understand.

As for your idea that evolution must be "goal driven." That is an error. Plants don't have nervous systems, consciousness, or goals, so your arguments don't apply to the evolution of plants. I explained this in my last post, but it seems like you didn't notice.

All the best,

Richard

Craig.Paardekooper
08-22-2011, 05:18 AM
"Dear Mr. Coneglan,

First of all, I wish to apologize for writing you with a long delay. The reason is that I am more than a month spent away from home (Belgrade, Serbia); I was in the province, in a village where there is no Internet, no newspapers or TV. I had a need for a short while to be out of civilization. .... When I returned to home some days ago, between the other posts I found your letter. ... Thank you very much for your interest in my scientific work and a nice decision to write me a letter. Thank you from the heart!

To You and Mr. Craig I am very grateful for what you do to my tables, and that you have found a relationship that I have not seen (more people more see!), especially in pointing out the horizontal symmetry, not only the vertical.

Otherwise, this of your works (A NEW TABLE OF AMINO ACIDS) I had already read on the Internet. (See discussion about a-b-c-b-a model in legend of Table E5 in my newest paper: arXiv: 1107.1998v2 [q-bio.OT]). It is really amazing how much effort you have given into analyzing the properties of amino acids (polarity, hydrophobicity, etc.), even though you say you are not an expert in the field of natural sciences. ...

Of course, it would be necessarily to take a long time to look at how relevant are parameters that you used (how many chemists, so many parameters for the polarity of molecules?!). You have probably noticed that for me, when it comes to polarity, only valid are the parameters: Doolittle & Kyte, 1982; Swanson, 1984; and Woese, 1966 (please, see References in my article "A harmonic structure ...", J. Theoret. biol., 229, pp. 221-234, 2004). However, because the genetic code is of more-meanings, I think that your work is worthy of a full attention.

At the same manner, I agree with your standpoint on categories (“I do not pretend to understand the chemical properties of these categories, but I do know pretty much how to distinguish between the categories themselves. After all, a category is a category, whether that's in chemistry, maths, or sports. This division into categories is important, because this is the root to answering the question that I had posed earlier.”), and this is why I am talking about the universal code of Nature. And I found it not only in the genetic code and the Mendeleyev periodic system but also in the works of classic literature, for example. Some parts of it I send you attached; article about Negoss unfortunately in Serbian but you can find a good book about Njegosh (the greatest philosophically oriented poet in Yugoslav spaces) in English (Dr. Žika Rad. Prvulovich: “Prince-Bishop Njegosh’s RELIGIOUS PHILOSOPHY”, Birmingham, 1984).


With best wishes and regards,

Miloje M. Rakocevic


P.S. Best wishes to Mr Craig also and my apologies for a bad English.


Rakocevic also sent to us a research document written in Serbian, which I am going to try and translate. He also sent us his new paper here (http://arxiv.org/ftp/arxiv/papers/1107/1107.1998.pdf)

Craig.Paardekooper
08-27-2011, 10:24 AM
"The total number of nucleotides of the finished sequence is 2858018193 while the total estimated length that includes the current gaps is ~3080419480"

This is a quotation from Vogel and Motulsky's Human Genetics: Problems and Approaches (2010)



It seems that the total estimated sequence length for all the 23 chromosomes is 3080419480. Here are the lengths of each chromosome as found on several websites.

chromosome 1 247249719
chromosome 2 242951149
chromosome 3 199501827
chromosome 4 191273063
chromosome 5 180857866
chromosome 6 170899992
chromosome 7 158821424
chromosome 8 146274826
chromosome 9 140273252
chromosome 10 135374737
chromosome 11 134452384
chromosome 12 132349534
chromosome 13 114142980
chromosome 14 106368585
chromosome 15 100338915
chromosome 16 88827254
chromosome 17 78774742
chromosome 18 76117153
chromosome 19 63811651
chromosome 20 62435964
chromosome 21 46944323
chromosome 22 49691432
chromosome X 154913754
chromosome Y 57772954

Above you can see each of the 22 chromosomes + sex chromosomes in the human genome. After each chromosome is a figure representing the number of nucleotides in the chromosome.

Is there a pattern in these numbers?

Adding all the nucleotide counts fot all the chromosomes we get -

247249719 + 242951149 + 199501827 + 191273063 + 180857866 + 170899992 + 158821424 + 146274826 + 140273252 + 135374737 + 134452384 + 132349534 + 114142980 + 106368585 + 100338915 + 88827254 + 78774742 + 76117153 + 63811651 + 62435964 + 46944323 + 49691432 + 154913754 + 57772954

= 3080419480

3080419480 = 55500 x 55503, a close approximation to a perfect square, and that square divisible by 37.

http://www.craigdemo.co.uk/chromosomes.png

This is a bit of a coincidence. I am not sure what to make of it. A triple digit perfect square. These patterns may be worth investigating.



We saw that there are 3080419480 nucleotides in the entire human genome. We know that these nucleotides combine to form 64 different codons.

So the average number of nucleotides for each codon is 3080419480/64 = 13 x 37 x 10 ^ 5.

So we could draw the entire human genome as a checker board of 64 squares, where each square has 13 x 37 x 10 ^ 5 nucleotides.

This is a curious observation. In terms of gematria 64 squares of 37 = 2368. And 13 is the Star number within 37.

Richard Amiel McGough
08-27-2011, 01:50 PM
chromosome 1 247249719
chromosome 2 242951149
chromosome 3 199501827
chromosome 4 191273063
chromosome 5 180857866
chromosome 6 170899992
chromosome 7 158821424
chromosome 8 146274826
chromosome 9 140273252
chromosome 10 135374737
chromosome 11 134452384
chromosome 12 132349534
chromosome 13 114142980
chromosome 14 106368585
chromosome 15 100338915
chromosome 16 88827254
chromosome 17 78774742
chromosome 18 76117153
chromosome 19 63811651
chromosome 20 62435964
chromosome 21 46944323
chromosome 22 49691432
chromosome X 154913754
chromosome Y 57772954

Above you can see each of the 22 chromosomes + sex chromosomes in the human genome. After each chromosome is a figure representing the number of nucleotides in the chromosome.

My question is - is there a pattern to be found here similar to what we found with the codon count for the entire human genome?

Well, we could add all the nucleotide counts together -

247249719 + 242951149 + 199501827 + 191273063 + 180857866 + 170899992 + 158821424 + 146274826 + 140273252 + 135374737 + 134452384 + 132349534 + 114142980 + 106368585 + 100338915 + 88827254 + 78774742 + 76117153 + 63811651 + 62435964 + 46944323 + 49691432 + 154913754 + 57772954

= 3080419480

I found that 3080419480 = 55500 x 55503

So it is also a close approximation to a perfect square, and that square is also divisible by 37.

This is also a bit of a coincidence. I am not sure what to make of it. Another triple digit perfect square. These patterns are signposts inviting further research.
Let's suppose there are patterns. What do you think they could mean? If the purpose of the DNA is to code for the development of the body, then I don't seen why would would expect any patterns. So are you think that God might have added in some "extra" DNA just to make these numerical patterns work out?

Craig.Paardekooper
08-27-2011, 01:59 PM
It seems that there may well be patterns, based on the work of Shcherbak and Rakocevic. The current observation may be just a coincidence, or it may be something more.

If life is the product of Intelligence, then I would expect it to have both form and function. Minds seem to prefer pattern and order. Many things that we make are arranged symmetrically or have a beautiful form. What is perfect has both form and function.

The preoccupation with function over form has quite a materialistic bias - suggesting that as long as a physical need or requirement is met, it does not matter how it is met.

Richard Amiel McGough
08-27-2011, 02:01 PM
Hi Ram,

What is perfect has both form and function
That's an interesting concept.

But the genome seems far from perfect.

People die. There are thousands of genetic diseases.

Craig.Paardekooper
08-27-2011, 10:17 PM
Perhaps genetic diseases and death itself are caused by mutations of an original code.

Richard Amiel McGough
08-27-2011, 10:35 PM
Perhaps genetic diseases and death itself are caused by mutations of an original code.
Original code? How do you conceive the history of life? Do you think that the human genome was created directly by God? What about all the other organisms? Do you think each was specially created? What about evolution? Do you reject that? How then should we understand the record of organisms advancing from simple to complex?

Craig.Paardekooper
08-30-2011, 12:08 AM
Do you think that the human genome was created directly by God?

I would not be surprised. Created by God or something similar. I think the answer will become clearer as science progresses. The genetic code may turn out to be another "Bible Wheel". If only you could turn your mind to it RAM. As a computer guy, you are in an excellent position to decifer some of it's secrets, in the same way you did with the Bible Wheel. In the short time I have studied genetics, I have been continually surprised by the hidden patterns.

For the first time in history we have in front of us the software code that built life itself - the Book of Life. If ever there was a document written by God, then this is it - in it's purest form.

alec cotton
08-30-2011, 12:58 AM
Perhaps genetic diseases and death itself are caused by mutations of an original code.

Sorry Craig, but I must offer a word of caution . It is unwise to use a broader brush on this forum Richard will so often demand the most meticulous detail and ask for Proof and precise source of information , whilst He himself makes sweeping ,unfounded statements and expects them to go unchallenged. Just now he wrote "lets suppose there are patterns". That word "suppose" is used to obscure the fact that there are patterns. The evidence is as obvious as it is conclusive. Now to circumvent the question which is on the tip of his tongue ( what is a pattern) A pattern is an arragement or sequence regularly found in comparable objects or events. He says that he would rather have questions that he can't answer than answers he can't question He cannot question that answer and so his solution is to turn away with his bottom lip stuck out like a garden spade. Then he says" If the purpoe of the D.N.A. is to code for the development of the body" ( Notice tht little word "if"?)
( The purpose of D.N.A is to code for the construction of the body.)then I don't see why we would expect to see any patterns. " What difference does it make whether we expect them or not?. They are there . They are plain for all to see. Then he finishes on a sour note. "So you think that God might have added in some extra D.N.A just to make these patterns work out. That is a childish ,foolish, petty question : Only worthy of a defeated , sulky .spoilt brat.. I suggest that the telescope be used , looking through the other end and get things in focus. To prevent genetic damage God gave specific instructions as to who should be married to whom. It is an absolute observable certainty that kin breeding brings about genetic disorders. Living by the divine law offers protection . There are many sexual diseases (some fatal) which cannot possibly exist without sexual immorality. The effects of some are felt to the third and fourth generation. Whilst examining the details , let us not lose sight of the big picture.
Alec

Richard Amiel McGough
08-30-2011, 09:43 AM
Sorry Craig, but I must offer a word of caution . It is unwise to use a broader brush on this forum Richard will so often demand the most meticulous detail and ask for Proof and precise source of information , whilst He himself makes sweeping ,unfounded statements and expects them to go unchallenged. Just now he wrote "lets suppose there are patterns". That word "suppose" is used to obscure the fact that there are patterns. The evidence is as obvious as it is conclusive.

That's not true Alec. You are the one making "sweeping, unfounded statements" which you refuse to support with any evidence.

But more to the point, you fail to understand the most basic elements of the English language. The evidence that Craig has presented is not "as obvious as it is conclusive." It is a project in progress and I have not taken the time to study it in sufficient depth to come to any conclusion. But I don't need to do that because it would add nothing fundamentally knew to my knowledge since I already have more than enough evidence that something "supernatural" is going on in the Bible. This proves your assertion is absurd - I have openly and repeatedly stated that there are plenty of supernatural patterns in the Bible, so it would be absurd to think that I am trying to "obscure" the patterns that Craig found. The reason I said "suppose" is obvious - I was conceding, for the sake of argument, that the patterns were real so we could talk about what they might mean. The fact that you failed to understand something as simple and obvious as this shows that your mind has been blinded by your irrational opposition to me as a person. You don't care about the truth of my arguments. You don't reply rationally to what I write. How pathetic.



Now to circumvent the question which is on the tip of his tongue ( what is a pattern) A pattern is an arragement or sequence regularly found in comparable objects or events. He says that he would rather have questions that he can't answer than answers he can't question He cannot question that answer and so his solution is to turn away with his bottom lip stuck out like a garden spade. Then he says" If the purpoe of the D.N.A. is to code for the development of the body" ( Notice tht little word "if"?)
( The purpose of D.N.A is to code for the construction of the body.)then I don't see why we would expect to see any patterns. " What difference does it make whether we expect them or not?. They are there . They are plain for all to see. Then he finishes on a sour note. "So you think that God might have added in some extra D.N.A just to make these patterns work out. That is a childish ,foolish, petty question : Only worthy of a defeated , sulky .spoilt brat..

Wrong. I had no intent of focusing on the definition of a pattern, but even if I did go that route, it is absurd to suggest it was wrong or a diversionary tactic. Again, you are revealing your gross ignorance. I have repeatedly stated that there are supernatural patterns in the Bible and that's why I don't need additional proof of more patterns! My problem is that I don't know what they mean and so that's what I wanted to discuss. But you can't see this because you are blinded by utterly irrational opposition to everything I say, even when I say that there are supernatural patterns in the Bible! What is wrong with your brain Alec? You oppose me even when I agree with you! Man ... you really need to get a grip on yourself.

All the best,

Richard

Craig.Paardekooper
09-08-2011, 06:38 PM
It concerns a pattern discovered by Shcherbak -

This pattern is found on the last page of his paper - "The Arithmetical Origin of the Genetic Code" in the sub section called - "A Virtual Global Balance".

The genetic code table has 64 codons, each made of 3 bases, meaning that the 64 codons are made of a total of 192 bases (64 x 3) in total. There are 4 different types of bases - A, C, G, and T, so in the whole genetic code table each of these bases occurs 192/4 times = 48 times.

For each amino acid, Shcherbak made the following calculations -

Amino Acid Mass x Number of T bases in it's codons (let us call this number Alpha)
Amino Acid Mass x Number of C bases in it's codons (let us call this number Beta)
Amino Acid Mass x Number of A bases in it's codons (let us call this number Gamma)
Amino Acid Mass x Number of G bases in it's codons (let us call this number Delta)

When he had completed these calculations for all the amino acids, he added all the Alphas together in one group, and did the same for all the Betas, Gammas and Deltas.

What Shcherbak found was that the total Alpha for all the amino acids comes to a multiple of 37, expressed as a triple digit multiple.

Alpha side chains = 666 + 999 + 999
Alpha standard block = 45 x 74 = 3330

So the Total for Alpha is 3330 + 3 x 888

Shcherbak found these results for the Beta + Gamma + Delta groups. These too form multiples of 37 expressed as triple digits.

Beta + Gamma + Delta side chains = 222 + (10 x 999) - (3 x 888)
Beta + Gamma + Delta standard block = 222 + (10 x 999)

222 + (10 x 999) - (3 x 888) + 222 + (10 x 999) = 20 x 888



Here is the pattern -

http://www.craigdemo.co.uk/shcherbakglobalbalance2.jpg


So, in summary,

Shcherbak found a balance, His pattern just happens to be centred on -

1. multiples of 37
2. which are also triple digit multiples
3. and a significant triple digit multiple, namely 888

Richard Amiel McGough
09-08-2011, 08:10 PM
Looks very interesting Craig. I look forward to your write-up.

In the meantime, I'll review this thread to get up to speed with what you have already presented.

Craig.Paardekooper
09-12-2011, 10:08 AM
The Global balance is curious. I shall create a table where by the results for C, A and G are calculated individually. Perhaps there are interesting patterns to emerge in these sub groups. The table would be


Column 1 = Amino acid nucleon number

Column 2 = T count in codons for this amino acid

Column 3 = C count in codons for this amino acid

Column 4 = A count in codons for this amino acid

Column 5 = G count in codons for this amino acid



The total figures for C, A or G might also display interesting results.



I shall also start to look at the 23 chromosomes. These might also form a type of "Bible Wheel". We saw that their sum comes to 55500 x 55500. So it will be interesting to see what else emerges.

Richard Amiel McGough
09-12-2011, 11:03 AM
It concerns a pattern discovered by Shcherbak -

This pattern is found on the last page of his paper - "The Arithmetical Origin of the Genetic Code" in the sub section called - "A Virtual Global Balance".

The genetic code table has 64 codons, each made of 3 bases, meaning that the 64 codons are made of a total of 192 bases (64 x 3) in total. There are 4 different types of bases - A, C, G, and T, so in the whole genetic code table each of these bases occurs 192/4 times = 48 times.

For each amino acid, Shcherbak made the following calculations -

Amino Acid Mass x Number of T bases in it's codons (let us call this number Alpha)
Amino Acid Mass x Number of C bases in it's codons (let us call this number Beta)
Amino Acid Mass x Number of A bases in it's codons (let us call this number Gamma)
Amino Acid Mass x Number of G bases in it's codons (let us call this number Delta)

When he had completed these calculations for all the amino acids, he added all the Alphas together in one group, and did the same for all the Betas, Gammas and Deltas.

What Shcherbak found was that the total Alpha for all the amino acids comes to a multiple of 37, expressed as a triple digit multiple.

Alpha side chains = 666 + 999 + 999
Alpha standard block = 45 x 74 = 3330

So the Total for Alpha is 3330 + 3 x 888

Shcherbak found these results for the Beta + Gamma + Delta groups. These too form multiples of 37 expressed as triple digits.

Beta + Gamma + Delta side chains = 222 + (10 x 999) - (3 x 888)
Beta + Gamma + Delta standard block = 222 + (10 x 999)

222 + (10 x 999) - (3 x 888) + 222 + (10 x 999) = 20 x 888



Here is the pattern -

http://www.craigdemo.co.uk/shcherbakglobalbalance2.jpg


So, in summary,

Shcherbak found a balance, His pattern just happens to be centred on -

1. multiples of 37
2. which are also triple digit multiples
3. and a significant triple digit multiple, namely 888
Fascinating. You knew you could get my interest with that nice circular picture, didn't you? :p

My problem is that I don't know enough about genetics to have any confidence in these patterns. I would have to go back and confirm everything independently. I get the impression that all the "mainstream" geneticists have completely ignored his work. Is that correct?

Craig.Paardekooper
09-12-2011, 12:02 PM
It is a truism that people only find things when they look, and "main stream" geneticists for the most part may not believe in the possibility of these mathematical patterns, so they simply haven't looked for them. The patterns are not hard to find.

Also "main stream" genetics tends to be less philosophical and more concerned with practical issues such as obtaining the complete sequence and determining the cause of diseases etc. Little funding is allotted for more philosophical pursuits. "Main stream" is usually synonymous with "career-focused" - and career is about making money, rather than pursuing philosophical ideals that challenge the current paradign.

Sometimes it takes someone on the fringes, who is free enough to be able to explore these things. It is noteworthy that Shcherbak has never been refuted, but rather has been cited in numerous academic papers..... including Vernon's

I wish you all the best in your endeavour to get to speed with this subject.



http://www.craigdemo.co.uk/ADN_animation.gif

Richard Amiel McGough
09-12-2011, 07:42 PM
It is a truism that people only find things when they look, and "main stream" geneticists for the most part may not believe in the possibility of these mathematical patterns, so they simply haven't looked for them.

It's interesting that you mention that "people only find things when they look." I just read the same thing in Jill Taylor's fascinating book "My Stroke of Insight." She had a major stroke that disabled a lot of the functionality of her left hemisphere. On page 139 she wrote:
[O]ur minds are highly sophisticated "seek and ye shall find" instruments. We are designed to focus in on whatever we are looking for. Is I seek red in teh world then I will find it everywhere. Perhaps just a little in the beginning, but the longer I stay focused on looking for red, then before you know it, I will see red everywhere.
This is one of the primary arguments skeptics use against the patterns we have found in the Bible. Unfortunately, there is a lot of validity in it, so we have to be extra vigilant to be sure that we are not merely seeing things because of selective observation (aka "cherry picking").



In addition main stream geneticists have to tow the party line through fear of loss of funding or even loss of jobs. Much funding may be alotted by bodies when results seem likely to support the current paradigm. Sometimes it takes someone on the fringes, who is free enough to be able to explore these things. It is noteworthy that Shcherbak has never been refuted, but rather has been cited in numerous academic papers..... including Vernon's

I agree completely about the "party line" restrictions in science. This is because science is a human endeavor and humans fall in to "fads" and things like that. But on the other hand, scientific skepticism is required to keep it free from wacky ideas. Skepticism is the "antiseptic" of the mind. But too much antiseptic kills the good flora too ... so it should be used judicially.

Do you know of any "mainstream" genetic publications that deal with the discoveries of Shchebak et al?

Craig.Paardekooper
09-13-2011, 12:03 PM
Richard,

The truth of Shcherbak's patterns are simple and self-evident. The vote of the majority is not required

Anyone can add up, and that's all that Shcherbak did.

Craig

Richard Amiel McGough
09-13-2011, 12:38 PM
Richard,

The truth of Shcherbak's patterns are simple and self-evident. You simply don't need the vote of the majority.

Did you require the vote of the majority when you discovered the Bible Wheel?

Craig
It's not the "vote of the majority" I am looking for. I was just hoping for a confirmation that his tables and numbers were correct. There could be some subtle errors that I know nothing about. I didn't want to take the time to do the requisite background research to validate the facts he presents. I don't know if he left things out (cherry picking) or did funny little tricks to get the results he wanted. I've seen this so many times in things like this I was hoping for a confirmation from someone "in the know." It's not like the Bible Wheel which truly is simple and self-evident. I have to research the the tables and the numbers with sufficient understanding to know if there were any omissions or additions that would invalidate his conclusions.

Craig.Paardekooper
09-13-2011, 01:49 PM
Sorry Richard,

I will do a little research and compile a list of citations for you. It would be interesting for me to do that anyway.

Here is the List -

1. http://www.whatabeginning.com/Misc/Genetics/Genetics_VS.htm by Vernon Jenkins

2. http://jean-yves.boulay.pagesperso-orange.fr/rap/eng/pagelin.html by Boulay

3. Origins of Life and Evolution of Biospheres Volume 26, Numbers 3-5, 442-443, DOI: 10.1007/BF02459858

4. The “START” and “STOP” of the genetic code: Why exactly ATG and TAG, TAA? Journal of Theoretical Biology, Volume 139, Issue 2, 21 July 1989, Pages 283-286
V.I. Shcherbak

5. Ways of wobble pairing are formalized with the co-operative symmetry of the genetic code Journal of Theoretical Biology, Volume 139, Issue 2, 21 July 1989, Pages 277-281
V.I. Shcherbak

6. The co-operative symmetry of the genetic code Journal of Theoretical Biology, Volume 132, Issue 1, 7 May 1988, Pages 121-124 V.I. Shcherbak

7. Rumer's rule and transformation in the context of the co-operative symmetry of the genetic code Journal of Theoretical Biology, Volume 139, Issue 2, 21 July 1989, Pages 271-276
V.I. Shcherbak

8. Twenty Canonical Amino Acids of the Genetic Code: The Arithmetical Regularities. Part I Journal of Theoretical Biology, Volume 162, Issue 3, 7 June 1993, Pages 399-401
V.I. Shcherbak

9. Sixty-four Triplets and 20 Canonical Amino Acids of the Genetic Code: The Arithmetical Regularities. Part II Journal of Theoretical Biology, Volume 166, Issue 4, 21 February 1994, Pages 475-477 V.I. Shcherbak

10. The Symmetrical Architecture of the Genetic Code Systematization Principle Journal of Theoretical Biology, Volume 162, Issue 3, 7 June 1993, Pages 395-398 V.I. Shcherbak

11. Arithmetic inside the universal genetic code Original Research Article Biosystems, Volume 70, Issue 3, August 2003, Pages 187-209 Vladimir I. shCherbak

12. The Symmetrical Architecture of the Genetic Code Systematization Principle Journal of Theoretical Biology, Volume 162, Issue 3, 7 June 1993, Pages 395-398 V.I. Shcherbak

13. Shcherbak, Vladimir. "The Arithmetical Origin of the Genetic Code." In Marcello Barbieri, ed., The Codes of Life: The Rules of Macroevolution. New York: Springer, 2008, pp. 153-186


When I am in the British Library, tomorrow, I will use their citation system to find a complete list of all the places that Shcherbak has been cited concerning his genetics work.

Talking about the British Library, I noticed something interesting today. Outside is a huge statue of the Creator with dividing compass in hand. In front of the statue is a large circular paved area surrounded by 8 large stones. The paved area consists of 23 circles of bricks, with two breaks in the circle.

http://www.flickr.com/photos/bolckow/2599684193/




Craig

Craig.Paardekooper
09-20-2011, 11:15 AM
I used the Scopus Database to get all the places where Shcherbak is cited. Here is the list -

1. Mišić, N.Z.
The self-similar numbers as a special case of cyclic numbers and their relation to the cyclic (genetic) codes
(2010) 10th Symposium on Neural Network Applications in Electrical Engineering, NEUREL-2010 - Proceedings, art. no. 5644099, pp. 97-102.
http://geneticcode.webs.com/Paper1.pdf


Document Type: Conference Paper
Source: Scopus


2. Stojković, M.D.
Study of the structure and polarity of amino acids in high-school teaching with the help of computer programs
(2010) Chemistry, 19 (5), pp. 129-141.
http://khimiya.org/pdfs/EKHIMIYA_19_5_STOIKOVIC.pdf


Document Type: Article
Source: Scopus


3. Jestin, J.-L.
A rationale for the symmetries by base substitutions of degeneracy in the genetic code
(2010) BioSystems, 99 (1), pp. 1-5.
http://arxiv.org/ftp/arxiv/papers/0704/0704.0331.pdf


Document Type: Article
Source: Scopus


4. Négadi, T.
The genetic code degeneracy and the amino acids chemical composition are connected
(2009) NeuroQuantology, 7 (1), pp. 181-187.
http://arxiv.org/ftp/arxiv/papers/0903/0903.4131.pdf

Document Type: Article
Source: Scopus


5. Schmitt, A.O., Schuchhardt, J., Ludwig, A., Brockmann, G.A.
Protein evolution within and between species
(2007) Journal of Theoretical Biology, 249 (2), pp. 376-383. Cited 5 times.


Document Type: Article
Source: Scopus


6. Jestin, J.-L., Soulé, C.
Symmetries by base substitutions in the genetic code predict 2′ or 3′ aminoacylation of tRNAs
(2007) Journal of Theoretical Biology, 247 (2), pp. 391-394. Cited 6 times.
http://hal.archives-ouvertes.fr/docs/00/13/96/47/PDF/MS737.pdf


Document Type: Letter
Source: Scopus


7. Frappat, L., Sciarrino, A.
Conspiracy in bacterial genomes
(2006) Physica A: Statistical Mechanics and its Applications, 369 (2), pp. 699-713. Cited 3 times.


Document Type: Article
Source: Scopus


8. Stortchevoi, A.A.
Misacylation of tRNA in prokaryotes: A re-evaluation
(2006) Cellular and Molecular Life Sciences, 63 (7-8), pp. 820-831. Cited 1 time.


Document Type: Review
Source: Scopus


9. Jestin, J.-L.
Degeneracy in the genetic code and its symmetries by base substitutions
(2006) Comptes Rendus - Biologies, 329 (3), pp. 168-171. Cited 6 times.


Document Type: Article
Source: Scopus


10. Gonzalez, D.L., Giannerini, S., Rosa, R.
Detecting structure in parity binary sequences
(2005) IEEE Engineering in Medicine and Biology Magazine, 25 (1), art. no. 1578666, pp. 69-81. Cited 1 time.


Document Type: Article
Source: Scopus


11. Yang, C.M.
On the structural regularity in nucleobases and amino acids and relationship to the origin and evolution of the genetic code
(2005) Origins of Life and Evolution of the Biosphere, 35 (3), pp. 275-295. Cited 1 time.


Document Type: Review
Source: Scopus


12. Gusev, V.A., Schulze-Makuch, D.
Genetic code: Lucky chance or fundamental law of nature?
(2004) Physics of Life Reviews, 1 (3), pp. 202-229. Cited 3 times.


Document Type: Review
Source: Scopus


13. Igamberdiev, A.U.
Quantum computation, non-demolition measurements, and reflective control in living systems
(2004) BioSystems, 77 (1-3), pp. 47-56. Cited 2 times.


Document Type: Review
Source: Scopus


14. Trevors, J.T., Abel, D.L.
Chance and necessity do not explain the origin of life
(2004) Cell Biology International, 28 (11), pp. 729-739. Cited 18 times.
http://www.creationism.org.pl/groups/ptkrmember/inne/2004/Trevors,%20Abel,%20Chance%20and%20necessity%20do%2 0not%20explain%20the%20origin%20of%20life.pdf



Document Type: Review
Source: Scopus


15. Yang, C.M.
On the 28-gon symmetry inherent in the genetic code intertwined with aminoacyl-tRNA synthetases - The Lucas series
(2004) Bulletin of Mathematical Biology, 66 (5), pp. 1241-1257. Cited 2 times.


Document Type: Article
Source: Scopus


16. Rakočević, M.M.
A harmonic structure of the genetic code
(2004) Journal of Theoretical Biology, 229 (2), pp. 221-234. Cited 3 times.
http://arxiv.org/ftp/q-bio/papers/0610/0610044.pdf


Document Type: Article
Source: Scopus


17. Gonzalez, D.L.
Can the genetic code be mathematically described?
(2004) Medical Science Monitor, 10 (4), pp. HY11-HY17. Cited 5 times.


Document Type: Article
Source: Scopus


18. Négadi, T.
Rumer's transformation, in biology, as the negation, in classical logic
(2003) International Journal of Quantum Chemistry, 94 (2), pp. 65-74. Cited 2 times.


Document Type: Article
Source: Scopus


19. ShCherbak, V.I.
Arithmetic inside the universal genetic code
(2003) BioSystems, 70 (3), pp. 187-209. Cited 9 times.


Document Type: Review
Source: Scopus


20. Négadi, T.
Cracking the genetic code(s) with a modular determinative degree: An algebraic approach
(2003) International Journal of Quantum Chemistry, 91 (6), pp. 651-662. Cited 1 time.


Document Type: Article
Source: Scopus


21. Downes, A.M., Richardson, B.J.
Relationships between genomic base content and distribution of mass in coded proteins
(2002) Journal of Molecular Evolution, 55 (4), pp. 476-490. Cited 1 time.


Document Type: Article
Source: Scopus


22. Qiu, Y., Zhu, L.
The rearranged genetic code and its implications in evolution and biochemistry
(2000) BioSystems, 56 (2-3), pp. 139-144. Cited 3 times.


Document Type: Article
Source: Scopus


23. Jestin, J.-L., Kempf, A.
Chain termination codons and polymerase-induced frameshift mutations
(1997) FEBS Letters, 419 (2-3), pp. 153-156. Cited 11 times.


Document Type: Review
Source: Scopus


24. Nieselt-Struwe, K., Wills, P.R.
The emergence of genetic coding in physical systems
(1997) Journal of Theoretical Biology, 187 (1), pp. 1-14. Cited 13 times.


Document Type: Article
Source: Scopus


25. Rakočević, M.M.
Two classes of the aminoacyl-tRNA synthetases in correspondence with the codon path cube
(1997) Bulletin of Mathematical Biology, 59 (4), pp. 645-648. Cited 2 times.


Document Type: Article
Source: Scopus

Craig.Paardekooper
09-20-2011, 11:26 AM
http://demonstrations.wolfram.com/TheAncestralGeneticCodeCube/

http://www.thomehfang.com/suncrates4/2DOW.html

Craig.Paardekooper
09-27-2011, 09:12 AM
Title : "A Unifying Concept for the Amino Acids"
By Rosemarie Swanson, Department of Chemistry, Texas A & M University, College Station, TX, 77834, U.S.A.
Ref : Bulletin of Mathematical Biology, Vol 46, No 2, pp. 187-203, 1984

In this paper, Swanson shows that the detailed relationships of the amino acids may be summarised in the following "similarity alphabets" :

ala, thr, gly, pro, ser

asp, asn, glu, gln, lys

his, arg, trp, tyr, phe

leu, met, ile, val, cys

She argues that there are 4 groups of amino acids : small, external, large and internal.

What is interesting is that these groups approximate to Rakocevics groupings, though of course, Rakocevic's findings were many years later, and based on more data.

Still, it is interesting that Swanson detected fundamental groupings within the amino acids that eventually led to Rakocevics classifications and their numerical expression in the 703/666 matrix.

Craig.Paardekooper
09-30-2011, 11:01 AM
Dear Craig,

Thank you so much you contacted me.

I looked your and Vernon’s site and it is great what both of you have done. I also saw your text Structural Numbers of the Bible on the wonderful McGough’s site - The Bible Wheel. I deeply support yours efforts.

I sent you a part of my M.S. thesis which is related to citation in paper from NEUREL conference. You will see from that part that prof. Rakočević and me were in collaboration, but then we separated because he was mainly interesting in different alphanumerical regularities, while I was mainly in mathematical properties of number 037. Whole my story is coming from the simple question: “Why just 037?”

I had seen your site about one-two years ago, but from the similar reasons that I am not so much interested in various arithmetical regularities, I didn’t pay full attention. This time I have seen result about total AAs molar masses (2738) which I have revealed before about two months, but I didn’t make such detailed research as you – terrific results.

Because of my aggravating circumstances, I didn’t publish the most of my research, but in next year I will reveal most of things. Right now, I am preparing a paper which is related to water, and as soon as it is accepted, I will send it. So, please, be a patient about my papers.

Best wishes for all and yours sincerely,

Nataša Mišić
University of Belgrade
Serbia



Paper by Natasa Misic - Mišić, N.Z. The self-similar numbers as a special case of cyclic numbers and their relation to the cyclic (genetic) codes
(2010) 10th Symposium on Neural Network Applications in Electrical Engineering, NEUREL-2010 - Proceedings, art. no. 5644099, pp. 97-102.

http://geneticcode.webs.com/Paper1.pdf

Richard Amiel McGough
09-30-2011, 11:18 AM
Dear Craig,

Thank you so much you contacted me.

I looked your and Vernon’s site and it is great what both of you have done. I also saw your text Structural Numbers of the Bible on the wonderful McGough’s site - The Bible Wheel. I deeply support yours efforts.

I sent you a part of my M.S. thesis which is related to citation in paper from NEUREL conference. You will see from that part that prof. Rakočević and me were in collaboration, but then we separated because he was mainly interesting in different alphanumerical regularities, while I was mainly in mathematical properties of number 037. Whole my story is coming from the simple question: 'Why just 037?'

I had seen your site about one-two years ago, but from the similar reasons that I am not so much interested in various arithmetical regularities, I didn’t pay full attention. This time I have seen result about total AAs molar masses (2738) which I have revealed before about two months, but I didn’t make such detailed research as you – terrific results.

Because of my aggravating circumstances, I didn’t publish the most of my research, but in next year I will reveal most of things. Right now, I am preparing a paper which is related to water, and as soon as it is accepted, I will send it. So, please, be a patient about my papers.



Best wishes for all and yours sincerely,

Nataša Mišić

Paper by Natasa Misic - Mišić, N.Z.
The self-similar numbers as a special case of cyclic numbers and their relation to the cyclic (genetic) codes
(2010) 10th Symposium on Neural Network Applications in Electrical Engineering, NEUREL-2010 - Proceedings, art. no. 5644099, pp. 97-102.
http://geneticcode.webs.com/Paper1.pdf
Fascinating stuff. Thanks for sharing this info, and the link to her paper.

Craig.Paardekooper
10-10-2011, 07:14 PM
Pattern of alternating cells built around 0.55
Vernon Jenkins compared the sums of alternating cells within the amino acid table.
He found that –
Sum of odd cells (coloured white) = 1331.45 = 2 x 666 – 0.55
Sum of even cells (coloured blue) = 1406.55 = 2 x 703 + 0.55
Stephen Coneglan observed that 55 is the exact midpoint between 0.37 and 0.73
0.55 = 0.73 – 0.18
0.55 = 0.37 + 0.18

This quote is taken from my paper "The Creation of the Genetic Code"
http://www.craigdemo.co.uk/geneticscode1.pdf

What is curious is the play on numbers. As Vernon and Steve Coneglan pointed out - 55 is the midpoint between 37 and 73.

What is also noticed is that 55 = 73 - (6 + 6 + 6)

which is an extraordinary play on the pattern 703 - 666

It will be recalled that the whole of Rakocevic's pattern is built around 703 and 666, as is also Vernons Genesis 1 pattern.

Richard Amiel McGough
10-10-2011, 08:40 PM
This quote is taken from my paper "The Creation of the Genetic Code"
http://www.craigdemo.co.uk/geneticscode1.pdf

What is curious is the play on numbers. As Vernon and Steve Coneglan pointed out - 55 is the midpoint between 37 and 73.

What is also noticed is that 55 = 73 - (6 + 6 + 6)

which is an extraordinary play on the pattern 703 - 666

It will be recalled that the whole of Rakocevic's pattern is built around 703 and 666, as is also Vernons Genesis 1 pattern.
I was going to mention that I wrote a lot about the connection between 37, 73 and 55 in my article called The Work of Creation (http://biblewheel.com/GR/GR_Creation_Work.asp) but I read your pdf and noticed that you used the graphic from that article:

http://biblewheel.com/images/hexstar3773_55.gif

I think you did a good job with the article. It was nice that you acknowledged Stephen Coneglan and Vernon Jenkins. Is there a reason you didn't you acknowledge my contribution? You even clipped the reference to my site from the image that you used. What's up with that?

Richard Amiel McGough
10-10-2011, 10:02 PM
Hey Craig,

When reading your pdf, I noticed that you linked to a different page of wikipedia for the molecular weight of each of the 20 amino acids. Why didn't you use this page?

http://www.webqc.org/aminoacids.php

It gives all the weights in a single table on a single page, and to four decimal places! That's two orders of magnitude more accurate than the numbers you used in your paper. It would really help if you used the more accurate values.

All the best,

Richard

Richard Amiel McGough
10-10-2011, 10:47 PM
Well, you finally got me sufficiently curious to check the numbers using the values to four decimal places given on this page:

http://www.webqc.org/aminoacids.php

Here are the results:

http://biblewheel.com/images/amino-acids.png

The results are very close. The total comes to 2738.016. The sums are not quite as perfect as your "two decimal place" improvement over Rakocevic's "one decimal place" approximation. The alternating sums are very close but slightly different. I find the whole thing mystifying and intriguing. The numbers are tightly integrated with the alphanumeric structure of Genesis 1. This "coincidence" - that the same numbers govern the opening verse of Genesis and the elements of DNA is exceedingly striking.

Craig.Paardekooper
11-13-2011, 07:13 AM
So, we have found patterns in the table of 20 amino acids, and these patterns are similar to those discovered by Vernon Jenkins in Genesis 1.

The amino acids combine to form proteins. There are thousands of different proteins, but they all share a chemical formula of the type -

CaHbNcOdSe

eg, the chemical formula for Insulin is C256 H381 N65 O79 S6

It is therefore interesting to ask if there is any pattern in the total mass of proteins as calculated from their formulae.

Carbon = 6
H = 1
N = 7
O = 8
S = 16

The first step is to make a list of all the main proteins.

FIBROUS PROTEINS

Cytoskeletal proteins
Actin
Arp2/3
Coronin
Dystrophin
FtsZ %
Keratin
Myosin
Spectrin
Tau (protein)
Tubulin
Collagen

Extracellular matrix proteins
Collagen
Elastin
F-spondin
Pikachurin

GLOBULAR PROTEINS

Plasma proteins
Serum Amyloid P Component
Serum albumin

Coagulation factors
Complement proteins C1-inhibitor
C3-convertase

Factor VIII
Factor XIII
Fibrin
Protein C
Protein S
Protein Z
Protein Z-related protease inhibitor
Thrombin
Von Willebrand Factor

Acute phase proteins
C-reactive protein

Hemoproteins

Cell adhesion
Cadherin
Ependymin
Integrin
NCAM
Selectin

TRANSMEMBRANE PROTEINS

CFTR
Glycophorin D
Scramblase

Ion channels
Acetylcholine receptor Muscarinic acetylcholine receptor -- these are NOT ion channels, but rather G-protein coupled receptors; see below
Nicotinic acetylcholine receptor

Potassium channel

Synport / Antiport proteins
Glucose transporter

Hormones and growth factors
Epidermal growth factor
Insulin
Insulin-like growth factor
Oxytocin

Receptors

Transmembrane receptors
G-protein-coupled receptor Rhodopsin

Intracellular receptors
Estrogen receptor

DNA-binding protein
Histones

Transcription Regulation
CI protein %

Transcription regulatory proteins that are receptors are in the receptors section.
C-myc
FOXP2
FOXP3
MyoD
P53

Immune system proteins
Immunoglobins
Major histocompatibility antigens
T cell receptor

Nutrient storage/transport
Ferritin

Chaperone proteins
GroEL


Now that we have identified some of the main proteins, we can look at the formula for each protein to see it is a significant number - just as we previously found patterns in the molecular weights of the amino acids that make up the proteins.

Craig.Paardekooper
11-27-2011, 09:30 PM
The results are very close. The total comes to 2738.016. The sums are not quite as perfect as your "two decimal place" improvement over Rakocevic's "one decimal place" approximation. The alternating sums are very close but slightly different. I find the whole thing mystifying and intriguing. The numbers are tightly integrated with the alphanumeric structure of Genesis 1. This "coincidence" - that the same numbers govern the opening verse of Genesis and the elements of DNA is exceedingly striking.


When rounded to the nearest whole numbers, the sums of the columns are 2 x 666 and 2 x 703, whilst the sums of the upper rows are 666 + 703 as are the sums of the lower rows.

In nature, the atomic mass is a whole number, and the decimal fractions result from the proportion of isotopes.

Craig.Paardekooper
01-23-2012, 06:38 PM
Dear All,

Steven shows that the numerical values of the names of the 12 Tribes, when arranged in the form of a Star of David, reveals patterns of coincidence with the genetic code patterns discovered by Shcherbak.

So, the Creator's signature is found in both. Perhaps this reveals God's hand in the birth of Israel, just as He gave birth to all life.

I find it extraordinary that the "genesis" of Israel should reveal these same patterns.

Anyway, here is Steven's book. I hope you enjoy the read.

Steven's Book (6Mb) (http://craigdemo.co.uk/stevenbook.pdf)

Richard Amiel McGough
01-23-2012, 06:53 PM
Dear All,

Steven shows that the numerical values of the names of the 12 Tribes, when arranged in the form of a Star of David, reveals patterns of coincidence with the genetic code patterns discovered by Shcherbak.

So, the Creator's signature is found in both. Perhaps this reveals God's hand in the birth of Israel, just as He gave birth to all life.

I find it extraordinary that the "genesis" of Israel should reveal these same patterns.

Anyway, here is Steven's book. I hope you enjoy the read.

Steven's Book (6Mb) (http://craigdemo.co.uk/stevenbook.pdf)
Hey there Craig,

Thanks for the link. It looks very interesting. Does the author desire to remain anonymous? I didn't see any name attached to the book.

All the best,

Richard

Craig.Paardekooper
03-17-2012, 11:12 PM
LETTERS

At first glance, the genetic code looks like one enormous string of letters, consisting of 4 symbols A, T, G, C. Infact, in the entire human genome there are approximately 55500 x 55500 letters.

chromosome 1 247249719
chromosome 2 242951149
chromosome 3 199501827
chromosome 4 191273063
chromosome 5 180857866
chromosome 6 170899992
chromosome 7 158821424
chromosome 8 146274826
chromosome 9 140273252
chromosome 10 135374737
chromosome 11 134452384
chromosome 12 132349534
chromosome 13 114142980
chromosome 14 106368585
chromosome 15 100338915
chromosome 16 88827254
chromosome 17 78774742
chromosome 18 76117153
chromosome 19 63811651
chromosome 20 62435964
chromosome 21 46944323
chromosome 22 49691432
chromosome X 154913754
chromosome Y 57772954

Adding all the nucleotide counts for all the chromosomes we get -

247249719 + 242951149 + 199501827 + 191273063 + 180857866 + 170899992 + 158821424 + 146274826 + 140273252 + 135374737 + 134452384 + 132349534 + 114142980 + 106368585 + 100338915 + 88827254 + 78774742 + 76117153 + 63811651 + 62435964 + 46944323 + 49691432 + 154913754 + 57772954

= 3080419480

3080419480 = 55500 x 55503, a close approximation to a perfect square

It is notable that 55500 + 55500 = 73700 + 37300 because 555 is the midpoint between 737 and 373


TRIPLETS

We know that these letters group together into triplets called codons. In the entire human genome there are 5 x 555 x 370000 Triplets.

So the average number of triplets per amino acid = 5 x 555 x 370000 / 20 = 5 x 555 x 5 x 3700

(This seems coincidental since the AVERAGE number of triplets per amino acid is 5 x 555 x 5 x 3700, and 55 is precisely midway, or THE AVERAGE between 37 and it's digital reflection 73)


CODONS

The triplets form 64 unique codons. So the average number of nucleotides for each codon is 3080419480/64 = 13 x 37 x 10 ^ 5.

So we could draw the entire human genome as a checker board of 64 squares, where each square has 13 x 37 x 10 ^ 5 nucleotides.

Just as the midpoint between 37 and 73 is 55, the midpoint between 13 and 37 is 5 x 5. Geometrically, 13, 37 and 73 form a triple star (Hexagram) with one star fitting perfectly inside the other.




Does the Genetic Code contain clearly defined letters and "words"?

"Imagine finding a copy of Shakespeares book written as a continuous string of letters with no spaces between words. Also imagine that it was written in a foreign language."

Perhaps the "letter" unit is actually the amino acid. (The number of amino acids approximates to the number of letters in our alphabet. ) If so, then we should first replace the A, T, G, C symbols with the 20 symbols for the amino acids.

I guess, at this point we would have the equivalent of "joined up words". It still looks like a continuous string of letters, because we haven't yet worked out where "words" begin and end.

If we define a word as a string of letters that occurs together in a fixed sequence above what would be expected by chance, then it should be possible to create a computer program that can distill the "words" in DNA. Knowing the words would be useful, since it would identify every minimum meaningful unit.

At this point we would have divided up the DNA into words. We would still not know what the words meant, but we would have made a big step forward in producing our "dictionary" of genetic words.

Aggregations of these functional units within larger units would comprise "sentences", defined by syntax structures.


LOGIC

Another way of looking at DNA would be to compare it to computer programming.
There will be input parameters which can be of various types cf string, integer, boolean, array, datetime, etc.
There will be operators such as =, <, >, <> etc.
There will be loops
There will be conditional logic structures such as "If Then" perhaps in the form of "Gates" ie logic gates
There will be class structures containing methods, functions and properties


Identifying "words" and "logic" within the genetic code will enable us to read it in a form that is more readily understandable. It seems that the genetic code is quite mathematical, so the pursuit of words and logic should bring results.

alec cotton
03-24-2012, 11:41 AM
THE FOLLOWING INFORMATION IS UPDATED CONTINUALLY TO REFLECT THE MOST RECENT CONTENT
LATEST UPDATE - August 21st 2011 (other articles by Craig) (http://www.craigdemo.co.uk)


Abstract

This section of the blog is a summary of some very interesting mathematical patterns recently discovered by scientists in the Genetic Code. In serves as a summary for the postings which follow, and is updated each time something new is discovered. The patterns are quite beautiful, and they are a fairly strong indicator of Intelligent Design. However, in addition, these patterns bear a surprising resemblance to similar patterns found encoded in the Genesis narrative.


Background

Previously, Vernon Jenkins, discovered a mathematical pattern encoded within the Hebrew text of the Old Testament creation narratives. His work is displayed here - -http://www.otherbiblecode.com.

Here is the central pattern found encoded in Genesis 1 v 1

http://www.craigdemo.co.uk/triangle.gif

I was deeply impressed by the mathematical consistency of the patterns that Vernon discovered and I studied his work from the year 2000 onwards, ie for about 6 years, contributing insights now and then. One of the things I discovered early on was the occurence of the ratio 1: 1.2732, the ratio for a squared circle. This led Vernon to the discovery of pi in Genesis 1. See http://homepage.virgin.net/vernon.jenkins/Pi_File.htm. This, inturn, led Peter Bluer to the discovery of e in Genesis 1 also.



Putting the Pieces Together

The patterns that Vernon discovered in Genesis were very clear and strong. Intuitively I felt that these patterns were unlikely to be the product of chance; rather, they seemed the product of intelligent thought. I surmised that if God had encoded the patterns in the creation narrative, then perhaps the same patterns would be found in the things that God created - ie in the living things He made.

It didn't take me long before I began looking at genetics. In our generation we have become familiar with the genetic code as THE repository of all the information and instructions necessary for life, so my attention turned to the genetic code to see if Vernon's patterns were found there.

Initially I sent out an email to Vernon, Iain Strachnan and Richard McGough asking them if they were aware of any occurrence of Vernon's patterns in the newly published human genome. Nothing came to light, and for a few months I allowed my thoughts about the subject to gather dust.

Then, as 2006 drew to an end, I decided to look at the current research of scientists from around the world. I soon discovered that over the last decade many scientists have begun* exploring the mathematical patterns found within DNA.

Vernon's pattern was intriguing. It served as a guide telling me where to look, and what to keep my eyes open for. As I studied the research, Vernon's patterns served as a kind of "treasure map" suggesting what I might find, and where to probe deeper....



Results


January 2007 : In January 2007,* I came across the work of Shcherbak, a mathematician and geneticist. Shcherbak had written several papers on a curious mathematical pattern that he had found in the genetic code. I obtained his papers at the British Library, and made a careful study of them - and produced a simplified booklet that I published online. What was quite surprising was the resemblance between Shcherbak's genetic patterns and those found by Vernon in the creation narratives. I remember the moment I saw the similarity - I was so struck that I forgot to breath. Time seemed to freeze. For several days I was completely stunned - in a state resembling shock and euphoria. I knew that this was going to have an impact. Our world views would be changed forever.

I have summarised Shcherbak’s work in a booklet found here.

http://www.freewebs.com/genetics37/shcherbakPages.htm See "Genetic Patterns"


February 2007 : In February 2007 I created a website where I gathered a bibliography of current research on mathematical patterns within the genetic code - found here -

http://www.freewebs.com/genetics37

I sent this information to Vernon Jenkins, Richard McGough and Iain Strachnan. Vernon has since independently investigated and peer reviewed Shcherbak's findings. He has confirmed these resemblances and has created his own web page where the findings are clearly depicted -

http://www.whatabeginning.com/Misc/Genetics/Genetics_VS.htm

Then Peter Bluer, a friend of Vernon's, wrote about these findings in his online pdf here, adding some discoveries of his own -

http://www.biblemaths.com/dna.pdf


February 2010 : Three years passed by, then in February 2010, prompted by Steve Coneglan to carry on the genetics research, I made a careful study of the work of another geneticist - M. M. Rakocevic. The resemblances between Rakocevic's genetic patterns and those in the creation narratives are astounding. Here is an example -

http://www.craigdemo.co.uk/AminoAcidMassHorizontal.jpg

The diagram above shows the 20 amino acids that are the building blocks for ALL living creatures on our planet. The figure next to each amino acid is it's accepted molecular mass (relative to Carbon 12) as can be found on Wikipedia or in any accurate biochemistry manual.

These findings have been submitted to Vernon Jenkins, Steve Coneglan, Richard McGough and Peter Bluer. Steve Coneglan has peer reviewed Rakocevic's work and confirmed the accuracy of these startling patterns.

http://www.craigdemo.co.uk/aminoacidmass.htm

Peter Bluer has also reviewed these findings and independently confirmed the accuracy of the numbers. He has confirmed both the vertical and horizontal symmetry found in the amino acid table, and has proceeded to find some new patterns where by the amino acid table divides symmetrically into 3 x 666 and 703 + 37. He found these new patterns by moving one column whilst still preserving all the original patterns.

You can view his patterns here -

http://www.craigdemo.co.uk/aminoexcel.xls

Vernon Jenkins is intending to publish these new findings on his website at www.otherbiblecode.com. Here is Vernon's web page -

Vernon's new web page on Rakocevic's pattern (http://www.whatabeginning.com/Misc/Genetics/Addendum/Rakbou.htm)


Apart from the horizontal AND vertical symmetry, incredible in itself, the occurrence of both of the key numbers from Vernon's pattern, 666 and 703, is immediately obvious. The result is quite stunning.


December 2010 : Most recently, in early December 2010, I became aware of the extraordinary research of Jean Claude Perez, a french geneticist and mathematician. This very year he published a very interesting discovery that shows some very remarkable symmetries within the genetic code. These symmetries are perfect balances in the frequency of occurrence of the 64 codons within the human genome. I found this article quite helpful -

http://www.craigdemo.co.uk/perez.htm

You can read Perez's paper here - http://www.resurgence.be/pdf/ADN-perez.pdf

I have carefully studied his paper, and his findings are truely accurate and remarkable. Not only are perfect symmetries revealed, but also these symmetries are based on the ratios 1 and phi (the Golden Ratio). I would highly recommend reading and making a copy of his paper.


February 2011 : In February 2011 I took a closer look at the pattern discovered by Rakocevic. Closer analysis revealed a new set of patterns shown in the diagram below.

http://www.craigdemo.co.uk/amino7.jpg

We can see the developing pattern.

The outer columns = 2 x 666 + 2 x 37

The inner columns = 2 x 703 - 2 x 37

The odd columns = 2 x 703 - 2 x 73

The even columns = 2 x 666 + 2 x 73


February 13th 2011 : On February 13th Steve Coneglan, using more accurate figures for the mass of each amino acid, was able to confirm that my observations were correct PRECISELY. Here are his equations (C1 + column 1, C2 = Column 2, C3 = Column 3, C4 = Column 4)

C2 + C3 = 828.87 + 503.50 = 1332.37 = (2 x 703) - (2 x 37) + 0.37
C1 + C4 = 755.77 + 649.86 = 1405.63 = (2 x 666) + (2 x 37) - 0.37

C1 + C3 = 755.77 + 503.50 = 1259.27 = (2 x 703) - (2 x 73) - 0.73
C2 + C4 = 828.87 + 649.86 = 1478.73 = (2 x 666) + (2 x 73) + 0.73


February 25th 2011 : I published my paper on Rakocevic's patterns here - The Creation of the Genetic Code (http://www.craigdemo.co.uk/geneticscode1.pdf)


March 4th 2011 : I received a copy of a paper written by Stephen Coneglan. Stephen had taken a deeper look at Rakocevic's table and had rearranged the amino acids by their chemical properties so that they are symmetrically placed. When Stephen did this he found that the numerical pattern that emerged possessed precise symmetry both vertically and horizontally.

Here is a link to his paper - Stephens Paper (http://www.craigdemo.co.uk/rakocevicpaper2.doc)


March 12th 2011 : Stephen sent to me an updated version of his paper that includes much new material in the appendices. Here is the updated version -
Updated Version (http://www.craigdemo.co.uk/stephenbook.doc)

In this paper Stephen demonstrates that when the amino acids are arranged symmetrically according to several of their chemical properties, then a very precise numerical symmetry emerges. On 13th March I shall email these results to Shcherbak, Perez and Rakocevic, since their feedback would be invaluable.


March 19th 2011 : I submitted two papers to Shcherbak for review - The Creation of the Genetic Code (http://www.craigdemo.co.uk/geneticscode1.pdf) and Updated Version (http://www.craigdemo.co.uk/stephenbook.doc).

Here is the response we received from Shcherbak -




July 9th 2011 : Steve Coneglan forwarded to me his latest revision of his work on the amino acids. It is now a 63 page booklet.

A New Table of the Amino Acids (http://www.craigdemo.co.uk/aminoacids.doc)





Thoughts

The genetic code is highly ordered, and embodies many features that indicate intelligent design from a functional perspective. The symmetry of the mathematical patterns found in the genetic code are just another indication, albeit a very precise and powerful one. There is no proof stronger than mathematical proof.

According to Shcherbak, arithmetic found in the genetic code seems to have preceded life itself. To quote Shcherbak -





And where could arithmetic come from other than an intelligence.

But where does an intelligence come from with the capacity to create something as complex as life? The similarity with the "signature" pattern found in Genesis 1 may provide an answer.

(Note: It seems that in our universe there is more than just matter - there is consciousness too, which cannot be reduced to matter. So consciousness must always have been present, together with matter - from the very beginning. Consciousness has the capacity to create.)

(other articles by Craig) (http://www.craigdemo.co.uk/craig.htm)

alec cotton
03-24-2012, 11:49 AM
Sorry about that . I made such a mess of trying to respond to craig. this is what I meant to do.

Hello Craig
It is obvious that you are well informed . I would like to ask you a question but before I do , I would like to clear the deck so that you can see where I am. Some time ago on this forum I expressed the notion that The consideration of D.N.A. Will force any thinking person to the conclusion that GOD IS. And that the Darwin theory of evolution by the ( accidental) selection of the species is poppycock. The response was abysmal. It went something like this; ' The jury is still out on the subject of D.N.A. ' Implicit in that statement is the fact that any knowledge extrapolated from observation of D.N.A. Or any conclusion reached will be dismissed out of hand because it does not support the dozy Darwin theory..I know that you are fully aware of what I am abou to say but I will say it for the sake of clarity. At first glance D.N.A. Looks like a bit of slime with nothing to disinguish it from any other slime. On closer examination it is seen to be extraordinary. It has unexpected proprties. It is not a living organism and yet it is capable of self replication. When it is examined minutely it is seen to have a structure which is nothing short of miraculous. One atom of phosphorous is attached to a molecule of sugar : Stuck to that is another sugar like molecule ( for the sake of clarity called a base) Oposite that is a mirror image ; Phosphorous sugar , Base======Ah , but wait a minute . The base is different. The base 'thymine'pairs up with adanine. Cytocine with guanine. These pairings might be thought of as letters and the groupings as words and the words as an instruction code. Bear in mind that this is all happening on an infinitesimally small chemical scale. Idiots and morons will aver that all this happened by accident.. They have a problem. Left to its own devices, this slime would be going nowhere. As long as there were nutrrients to support its production and there would be a sea of slime. Now at the same time another miracle happened . Same pattern exept that the base uracil is present instead of thymine and ribose is the sugar.. D.N.A. And R.N.A remind me of Jehovah and the Holy spirit. They are the same and yet different, seperate and yet inseperable. Independent and yet dependant on each other for existence. RNA enables D.N.A to function. They are both very clearly seen to be determinate,directional, purposeful and planned. That is an inecapable conclusion.
Now Craig , I would like to know if anybody has found any sort of code in R.N.A. And if so ,how does it differ from D.N.A. ? Does it have a similar geometric structure.?
Sincerely
Alec

Craig.Paardekooper
03-28-2012, 09:41 AM
Hi Alec,

RNA is a copy of DNA , and the codons in RNA code for the same amino acids as do the codons in DNA, so the same mathematical patterns apply to RNA also.

The process of translation from DNA to RNA to protein seems to be a case of irreducible complexity, because the whole process would be useless without all the stages in place from the start.

1. DNA is read and a string of RNA is produced
2. RNA travels outside the nucleus
3. Outside the nucleus there is a pool of amino acid molecules, each with a codon triplet attached
4. Outside the nucleus there is a factory (ribosome) where the codon triplet on the amino acid molecules is matched to the codon triplet on the RNA

If any of these steps is absent then a cell cannot copy itself even once.

Also, the translation from DNA to RNA to protein is universal - all living things use this process - from the simplest to the most complex. So this process must have existed from the very beginning. If we were looking at Cambrian life, they would all be copying their cells using this process.

I hope this helps.

Raphael
03-29-2012, 05:33 AM
I was deeply impressed by the mathematical consistency of the patterns that Vernon discovered and I studied his work from the year 2000 onwards, ie for about 6 years, contributing insights now and then.


Sadly Vernon stopped communicating with me once he realized I took his work merged it with mine and then used the results to show Christianity is not so unique...that it can and should be compared to other beLIEfs.

Actually I feel this is the only way to see the bigger picture that embraces all beLIEfs.
There is nothing wrong with comparing beLIEfs if your intent is to go looking for the common denominators that unify.

Comparing and defending one stream of thought or narrative that serves primarily one CULTure is the fool's game we have been playing for the past 2000+ years.
IMHO




Putting the Pieces Together

The patterns that Vernon discovered in Genesis were very clear and strong. Intuitively I felt that these patterns were unlikely to be the product of chance; rather, they seemed the product of intelligent thought. I surmised that if God had encoded the patterns in the creation narrative, then perhaps the same patterns would be found in the things that God created - ie in the living things He made.

December 2010 : Most recently, in early December 2010, I became aware of the extraordinary research of Jean Claude Perez, a french geneticist and mathematician. This very year he published a very interesting discovery that shows some very remarkable symmetries within the genetic code. These symmetries are perfect balances in the frequency of occurrence of the 64 codons within the human genome. I found this article quite helpful -



Pattern recognition and making predictions is important whether you are an astrologer, astronomer, physicist or a truth seeker.

Craig I have not been able to read all the pages in this thread yet, but have you made this statement anywhere in its content based on recognizing the patterns?

I contend that DNA = the Philosopher's Stone, what Carl Jung called the quinta essentia, the Holy Grail, a.k.a. secrets you would put into the Holy of HoLIEs/the Ark for safe keeping because those 64 codes or codons affect ALL LIfE on earth, not just "we the sheeple...."

Here are profound connections helping to connect some experts to other experts in other fields of interest that lie outside their expertise.
Maybe it is time the left hand knew what the right hand was doing?

:yo: DNA – Mayan’s AINTIRAM – NaSSim Haramein – Tesseract – Hypercube
http://at37.wordpress.com/2012/02/11/imagining-the-tenth-dimension/

:yo: DNA CODE – the KEYHOLE + the KEYS
http://at37.wordpress.com/2012/02/28/keyhole-dna-ankh-circle-truncated-pyramid/

namaste

RaphaEL

326

Craig.Paardekooper
04-27-2012, 01:47 PM
DNA as a word

We know that the sequence of DNA bases (A, T, C or G) produces an amino acid sequence. There is nothing intrinsic to the chemical or physical characteristics of the base sequence that necessarily produces an amino acid sequence. Rather the base sequence requires a code to translate into the amino acid sequence.

The genetic code is the process by which DNA is "read" - the process of "translation" that converts what would otherwise be a meaningless symbol into a meaningful action - the addition of an amino acid.

So

DNA ----------------> Genetic Code -----------------> Amino Acid

just as a mark on a piece of paper is interpreted as a letter in our spoken languages

(mark) -------------> Translation -------------------->Letter


So the Genetic Code can be thought of as a mechanism for "reading" DNA - in other words for converting meaningless marks into "words"


Intriguing Symmetry Within the Code

In my past posts, we have seen how the Genetic Code has an intriguing symmetry based around 666 and 703. I refer to the work of Rakocevic in particular. When the 20 amino acids are arranged in a 5 rows each of 4 amino acids, then we saw how the molecular masses of amino acids in two central columns sum to 2 x 666, and the two outer columns sum to 2 x 703. We also saw how the top 2 rows + half the central row sum to 666 + 703, and how the bottom two rows + half the central row also sum to 666 + 703.

This intriguing symmetry seems to revolve around the number 37, since 703 - 666 = 37 and 703 + 666 = 37 x 37


Speaker of the Word

So who is the speaker of these "words"? We have seen in point 1 above that the Genetic Code is a translation or reading mechanism similar to how we read marks as letters, but who spoke these letters or words? Point 2 above sheds a further interesting light upon this. Perhaps the speaker of the words is signified by the number 37, just as Logos or The Word has a gematria of 373, and just as Genesis 1 has a gematria of 37 x 73.


Comments Within the Genetic Code

Computer programs written by people contain areas of code to make a software program work. These code areas have a function in producing a physical result. However, in computer programs you also have "commented areas". Commented areas are notes and comments written into a program that tell the programmer what the functional code areas do. They might also tell us other information such as who made the software, and how to use the software for our benefit.

Similarly, in DNA there are "coding regions" that code for the production of amino acids, and there are also vast regions that DO NOT code for the production of amino acids. infact only 2% of DNA actually codes for the production of proteins (sequence of amino acids = protein)

So what is the other 98% of DNA coding for?

Initially, this mysterious 98% was referred to by scientists as "junk DNA" because they did not know what it did. Nowadays, it is simply referred to as non-coding. Infact the technical terms are -

coding region = Exon
non-coding region = Intron

So what is going on in the intron regions?

Given that the genetic code is very probably the product of an intelligence ( or intelligences, since the Bible uses the PLURAL "Elohim"), it is quite possible that the introns contain areas of "language" whose purpose is to provide a description and commentary on how the genetic code actually works and how we can use the code - a kind of instruction manual. This might sound far-fetched and fantastical, but it is well within the realms of possibility, considering what we already know in terms of the intelligent design and patterning of the code around 666 and 703.

So we can afford to speculate upon a rather odd question - "how could you represent Genesis 1 v 1 in DNA bases?". Lets see.


A Second Genetic Code

We know that IN THE CODING REGIONS, the 64 codons map onto 20 amino acids, BUT IN THE NON-CODING REGIONS THIS NEED NOT BE THE CASE AT ALL.

In the non-coding regions a different mapping could apply, so that the 64 codons could map on to the letters of a spoken alphabet, with the same level of redundancy as was found in the coding regions. For example, there are 22 letters in the Hebrew alphabet, and there are 64 possible codons - (each codon being a triplet of 3 bases). Each codon would map onto a single Hebrew letter, and a single Hebrew letter could be represented by more than one codon (this is referred to as redundancy).

This would constitute a Second Genetic Code.

First Genetic Code : Codon ---------------> Aminoacid

Second Genetic Code : Codon -------------> Letter


How Can We Test for a Second Genetic Code?

Well, if the codons mapped onto the letters of a spoken language, then we would expect that the frequency of occurrence of the codons would match the frequency of occurrence of the letters in that spoken language. In the English language, for example, the vowels occur more frequently than the consonants, and infact each letter of our alphabet has a specific frequency.

NON-CODING AREAS : Similarly, if the non-coding part of DNA maps onto a spoken alphabet, then we would expect the codons within non-coding regions to occur with frequences that correlated with the frequencies of letters within the spoken language.

"Linguistic Areas" : Codon frequency = Letter Frequency in Spoken Language

CODING AREAS : However, coding regions cannot contain linguistic structures because they are constrained by the the functions they perform. In a coding region, the code usually starts with a START SIGNAL. This start signal is usually the codon ATG that represents Methionine. Coding regions usually end with a STOP signal - which is usually the codons TAA or TAG. Consequently the frequencies of each codon in a coding region will be very different from the frequencies in a non-coding region.

Coding Areas : Codon frequency Not equal to (<>) Letter Frequency in Spoken Language


A Testable Hypothesis
I therefore propose a hypothesis.

1. That the frequencies of occurrence of codons within coding regions will be significantly different from the frequencies of occurrence of codons within non-coding regions, and

2. That within the non-coding regions there will be areas where the frequencies of occurrence of codons will correlate with the frequencies of occurrence of the letters within a spoken language - let us say.......Hebrew perhaps.

Both of these hypothesi are testable.


Method of Testing

Using the Perl programming language, it is fairly straight forward to compare coding and non-coding regions to see if these hypothesi hold.


The Next Step

If we do find regions where codon frequency differs markedly from the frequency in coding areas, then we may be looking at a "linguistic" area. Then the next step would be to match specific letter to codon, just as was done with matching amino acid to codon. That would constitute the Second Genetic Code.

This could, perhaps open up the Book of Life to us.


What Might be Found?

A provident Creator might likely place their signature phrase within the code sequence at some point. It would stand as a signature and statement as to who our Maker is. We have seen, from the work of Vernon Jenkins, Steven, and Richard McGough, that a phrase, found in Geness 1 v 1 has already been encoded in the Bible so that it embodies remarkable mathematical patterns.

So I would do a simple search for those codons matching the letters in this phrase -

"In the Beginning God Created the Heavens and the Earth"

Infact, once we know what letters match with each codon, then we could simply search the entire genetic code for the consecutive appearance of words from that spoken language. This would reveal all the "commented" areas in one swoop - whole passages - perhaps informing us of some new and remarkable things.

So there you have it. A testable hypothesis.

Craig.Paardekooper
04-29-2012, 06:40 AM
To test out the idea that DNA might contain a spoken language, I had to obtain the DNA code for an organism. I chose one of the simplest organisms - E.Coli. The DNA of E. Coli can easily be obtained online here http://www.ncbi.nlm.nih.gov/nuccore/X01714.

E Coli has only 1609 bases

CAGAGAAAATCAAAAAGCAGGCCACGCAGGGTGATGAATTAACAATAAAA ATGGTTAAAAACCCCGATAT
CGTCGCAGGCGTTGCCGCACTAAAAGACCATCGACCCTACGTCGTTGGAT TTGCCGCCGAAACAAATAAT
GTGGAAGAATACGCCCGGCAAAAACGTATCCGTAAAAACCTTGATCTGAT CTGCGCGAACGATGTTTCCC
AGCCAACTCAAGGATTTAACAGCGACAACAACGCATTACACCTTTTCTGG CAGGACGGAGATAAAGTCTT
ACCGCTTGAGCGCAAAGAGCTCCTTGGCCAATTATTACTCGACGAGATCG TGACCCGTTATGATGAAAAA
AATCGACGTTAAGATTCTGGACCCGCGCGTTGGGAAGGAATTTCCGCTCC CGACTTATGCCACCTCTGGC
TCTGCCGGACTTGACCTGCGTGCCTGTCTCAACGACGCCGTAGAACTGGC TCCGGGTGACACTACGCTGG
TTCCGACCGGGCTGGCGATTCATATTGCCGATCCTTCACTGGCGGCAATG ATGCTGCCGCGCTCCGGATT
GGGACATAAGCACGGTATCGTGCTTGGTAACCTGGTAGGATTGATCGATT CTGACTATCAGGGCCAGTTG
ATGATTTCCGTGTGGAACCGTGGTCAGGACAGCTTCACCATTCAACCTGG CGAACGCATCGCCCAGATGA
TTTTTGTTCCGGTAGTACAGGCTGAATTTAATCTGGTGGAAGATTTCGAC GCCACCGACCGCGGTGAAGG
CGGCTTTGGTCACTCTGGTCGTCAGTAACACATACGCATCCGAATAACGT CATAACATAGCCGCAAACAT
TTCGTTTGCGGTCATAGCGTGGGTGCCGCCTGGCAAGTGCTTATTTTCAG GGGTATTTTGTAACATGGCA
GAAAAACAAACTGCGAAAAGGAACCGTCGCGAGGAAATACTTCAGTCTCT GGCGCTGATGCTGGAATCCA
GCGATGGAAGCCAACGTATCACGACGGCAAAACTGGCCGCCTCTGTCGGC GTTTCCGAAGCGGCACTGTA
TCGCCACTTCCCCAGTAAGACCCGCATGTTCGATAGCCTGATTGAGTTTA TCGAAGATAGCCTGATTACT
CGCATCAACCTGATTCTGAAAGATGAGAAAGACACCACAGCGCGCCTGCG TCTGATTGTGTTGCTGCTTC
TCGGTTTTGGTGAGCGTAATCCTGGCCTGACCCGCATCCTCACTGGTCAT GCGCTAATGTTTGAACAGGA
TCGCCTGCAAGGGCGCATCAACCAGCTGTTCGAGCGTATTGAAGCGCAGC TGCGCCAGGTATTGCGTGAA
AAGAGAATGCGTGAGGGTGAAGGTTACACCACCGATGAAACCCTGCTGGC AAGCCAGATCCTGGCCTTCT
GTGAAGGTATGCTGTCACGTTTTGTCCGCAGCGAATTTAAATACCGCCCG ACGGATGATTTTGACGCCCG
CTGGCCGCTAATTGCGGCCAGTTGCAGTAATATGACGCCGGATGACTTTT CATCCGGCGAGTTTCTTTAA
ACGCCAAACTCTTCGCGATAGGCCTTAACCGCCGCCAGATGTTCCGCCAT TTCCGGCTTCTCTTCCAGG

It is amazing that this short code is able to create an entire organism.

Then I divided this DNA sequence into triplets (codons) using vb.net. The number in brackets is simply the position of this codon in the DNA sequence.

According to the website here - http://www.ncbi.nlm.nih.gov/nuccore/X01714, the E.Coli DNA has two coding regions. I have highlighted these two coding regions below in red. So the DNA is producing two different proteins. The rest of the DNA is noncoding.


(1) CAG (4) AGA (7) AAA (10) TCA (13) AAA (16) AGC (19) AGG (22) CCA (25) CGC (28) AGG (31) GTG (34) ATG (37) AAT (40) TAA (43) CAA (46) TAA (49) AAA (52) TGG (55) TTA (58) AAA (61) ACC (64) CCG (67) ATA (70) TCG (73) TCG (76) CAG (79) GCG (82) TTG (85) CCG (88) CAC (91) TAA (94) AAG (97) ACC (100) ATC (103) GAC (106) CCT (109) ACG (112) TCG (115) TTG (118) GAT (121) TTG (124) CCG (127) CCG (130) AAA (133) CAA (136) ATA (139) ATG (142) TGG (145) AAG (148) AAT (151) ACG (154) CCC (157) GGC (160) AAA (163) AAC (166) GTA (169) TCC (172) GTA (175) AAA (178) ACC (181) TTG (184) ATC (187) TGA (190) TCT (193) GCG (196) CGA (199) ACG (202) ATG (205) TTT (208) CCC (211) AGC (214) CAA (217) CTC (220) AAG (223) GAT (226) TTA (229) ACA (232) GCG (235) ACA (238) ACA (241) ACG (244) CAT (247) TAC (250) ACC (253) TTT (256) TCT (259) GGC (262) AGG (265) ACG (268) GAG (271) ATA (274) AAG (277) TCT (280) TAC (283) CGC (286) TTG (289) AGC (292) GCA (295) AAG (298) AGC (301) TCC (304) TTG (307) GCC (310) AAT (313) TAT (316) TAC (319) TCG (322) ACG (325) AGA (328) TCG (331) TGA (334) CCC (337) GTT (340) ATG (343) ATG (346) AAA (349) AAA (352) ATC (355) GAC (358) GTT (361) AAG (364) ATT (367) CTG (370) GAC (373) CCG (376) CGC (379) GTT (382) GGG (385) AAG (388) GAA (391) TTT (394) CCG (397) CTC (400) CCG (403) ACT (406) TAT (409) GCC (412) ACC (415) TCT (418) GGC (421) TCT (424) GCC (427) GGA (430) CTT (433) GAC (436) CTG (439) CGT (442) GCC (445) TGT (448) CTC (451) AAC (454) GAC (457) GCC (460) GTA (463) GAA (466) CTG (469) GCT (472) CCG (475) GGT (478) GAC (481) ACT (484) ACG (487) CTG (490) GTT (493) CCG (496) ACC (499) GGG (502) CTG (505) GCG (508) ATT (511) CAT (514) ATT (517) GCC (520) GAT (523) CCT (526) TCA (529) CTG (532) GCG (535) GCA (538) ATG (541) ATG (544) CTG (547) CCG (550) CGC (553) TCC (556) GGA (559) TTG (562) GGA (565) CAT (568) AAG (571) CAC (574) GGT (577) ATC (580) GTG (583) CTT (586) GGT (589) AAC (592) CTG (595) GTA (598) GGA (601) TTG (604) ATC (607) GAT (610) TCT (613) GAC (616) TAT (619) CAG (622) GGC (625) CAG (628) TTG (631) ATG (634) ATT (637) TCC (640) GTG (643) TGG (646) AAC (649) CGT (652) GGT (655) CAG (658) GAC (661) AGC (664) TTC (667) ACC (670) ATT (673) CAA (676) CCT (679) GGC (682) GAA (685) CGC (688) ATC (691) GCC (694) CAG (697) ATG (700) ATT (703) TTT (706) GTT (709) CCG (712) GTA (715) GTA (718) CAG (721) GCT (724) GAA (727) TTT (730) AAT (733) CTG (736) GTG (739) GAA (742) GAT (745) TTC (748) GAC (751) GCC (754) ACC (757) GAC (760) CGC (763) GGT (766) GAA (769) GGC (772) GGC (775) TTT (778) GGT (781) CAC (784) TCT (787) GGT (790) CGT (793) CAG (796) TAA (799) CAC (802) ATA (805) CGC (808) ATC (811) CGA (814) ATA (817) ACG (820) TCA (823) TAA (826) CAT (829) AGC (832) CGC (835) AAA (838) CAT (841) TTC (844) GTT (847) TGC (850) GGT (853) CAT (856) AGC (859) GTG (862) GGT (865) GCC (868) GCC (871) TGG (874) CAA (877) GTG (880) CTT (883) ATT (886) TTC (889) AGG (892) GGT (895) ATT (898) TTG (901) TAA (904) CAT (907) GGC (910) AGA (913) AAA (916) ACA (919) AAC (922) TGC (925) GAA (928) AAG (931) GAA (934) CCG (937) TCG (940) CGA (943) GGA (946) AAT (949) ACT (952) TCA (955) GTC (958) TCT (961) GGC (964) GCT (967) GAT (970) GCT (973) GGA (976) ATC (979) CAG (982) CGA (985) TGG (988) AAG (991) CCA (994) ACG (997) TAT (1000) CAC (1003) GAC (1006) GGC (1009) AAA (1012) ACT (1015) GGC (1018) CGC (1021) CTC (1024) TGT (1027) CGG (1030) CGT (1033) TTC (1036) CGA (1039) AGC (1042) GGC (1045) ACT (1048) GTA (1051) TCG (1054) CCA (1057) CTT (1060) CCC (1063) CAG (1066) TAA (1069) GAC (1072) CCG (1075) CAT (1078) GTT (1081) CGA (1084) TAG (1087) CCT (1090) GAT (1093) TGA (1096) GTT (1099) TAT (1102) CGA (1105) AGA (1108) TAG (1111) CCT (1114) GAT (1117) TAC (1120) TCG (1123) CAT (1126) CAA (1129) CCT (1132) GAT (1135) TCT (1138) GAA (1141) AGA (1144) TGA (1147) GAA (1150) AGA (1153) CAC (1156) CAC (1159) AGC (1162) GCG (1165) CCT (1168) GCG (1171) TCT (1174) GAT (1177) TGT (1180) GTT (1183) GCT (1186) GCT (1189) TCT (1192) CGG (1195) TTT (1198) TGG (1201) TGA (1204) GCG (1207) TAA (1210) TCC (1213) TGG (1216) CCT (1219) GAC (1222) CCG (1225) CAT (1228) CCT (1231) CAC (1234) TGG (1237) TCA (1240) TGC (1243) GCT (1246) AAT (1249) GTT (1252) TGA (1255) ACA (1258) GGA (1261) TCG (1264) CCT (1267) GCA (1270) AGG (1273) GCG (1276) CAT (1279) CAA (1282) CCA (1285) GCT (1288) GTT (1291) CGA (1294) GCG (1297) TAT (1300) TGA (1303) AGC (1306) GCA (1309) GCT (1312) GCG (1315) CCA (1318) GGT (1321) ATT (1324) GCG (1327) TGA (1330) AAA (1333) GAG (1336) AAT (1339) GCG (1342) TGA (1345) GGG (1348) TGA (1351) AGG (1354) TTA (1357) CAC (1360) CAC (1363) CGA (1366) TGA (1369) AAC (1372) CCT (1375) GCT (1378) GGC (1381) AAG (1384) CCA (1387) GAT (1390) CCT (1393) GGC (1396) CTT (1399) CTG (1402) TGA (1405) AGG (1408) TAT (1411) GCT (1414) GTC (1417) ACG (1420) TTT (1423) TGT (1426) CCG (1429) CAG (1432) CGA (1435) ATT (1438) TAA (1441) ATA (1444) CCG (1447) CCC (1450) GAC (1453) GGA (1456) TGA (1459) TTT (1462) TGA (1465) CGC (1468) CCG (1471) CTG (1474) GCC (1477) GCT (1480) AAT (1483) TGC (1486) GGC (1489) CAG (1492) TTG (1495) CAG (1498) TAA (1501) TAT (1504) GAC (1507) GCC (1510) GGA (1513) TGA (1516) CTT (1519) TTC (1522) ATC (1525) CGG (1528) CGA (1531) GTT (1534) TCT (1537) TTA (1540) AAC (1543) GCC (1546) AAA (1549) CTC (1552) TTC (1555) GCG (1558) ATA (1561) GGC (1564) CTT (1567) AAC (1570) CGC (1573) CGC (1576) CAG (1579) ATG (1582) TTC (1585) CGC (1588) CAT (1591) TTC (1594) CGG (1597) CTT (1600) CTC (1603) TTC (1606) CAG


Then I simply counted the occurrence of the STOP Codons TAA or TAG in the coding and noncoding regions and compared them.
Note: The second coding region appears to be shifted one base out of the reading frame compared to the first coding area. The DNA in the noncoding area between the two coding areas must contain an instruction to alter the reading frame.

Result
In the non-coding region before the first red area, the stop codon TAA occurs 3 times, whilst it occurs only once in the first coding area. So the first hypothesis is supported -there is a definite difference in the frequency of the STOP CODONS between coding and noncoding areas. In the coding areas, the STOP codons only occur once, at the end of the coding sequence. Whilst in non-coding areas, the stop codons occur with much greater frequency.

This isn't really anything new. Scientists already use this criteria to identify coding areas.

Also, the frequency of occurrence of the stop codons in the noncoding area is 3 times in 113 codons = 2.65 %. This is similar to the frequency of occurrence of a letter in the Hebrew alphabet. see here - http://www.sttmedia.com/characterfrequency-hebrew

Craig.Paardekooper
04-29-2012, 02:35 PM
Another characteristic of a spoken language would be the absence of repeating characters. For example, coding areas of DNA might have a sequence such as AATAATAATAATAATAAT. If noncoding areas of DNA represent letters in a spoken language, then I would not expect such repetitions. So it will be interesting to investigate the frequency of repetitions in both areas.

CWH
04-29-2012, 07:32 PM
To test out the idea that DNA might contain a spoken language, I had to obtain the DNA code for an organism. I chose one of the simplest organisms - E.Coli. The DNA of E. Coli can easily be obtained online here http://www.ncbi.nlm.nih.gov/nuccore/X01714.

E Coli has only 1609 bases

CAGAGAAAATCAAAAAGCAGGCCACGCAGGGTGATGAATTAACAATAAAA ATGGTTAAAAACCCCGATAT
CGTCGCAGGCGTTGCCGCACTAAAAGACCATCGACCCTACGTCGTTGGAT TTGCCGCCGAAACAAATAAT
GTGGAAGAATACGCCCGGCAAAAACGTATCCGTAAAAACCTTGATCTGAT CTGCGCGAACGATGTTTCCC
AGCCAACTCAAGGATTTAACAGCGACAACAACGCATTACACCTTTTCTGG CAGGACGGAGATAAAGTCTT
ACCGCTTGAGCGCAAAGAGCTCCTTGGCCAATTATTACTCGACGAGATCG TGACCCGTTATGATGAAAAA
AATCGACGTTAAGATTCTGGACCCGCGCGTTGGGAAGGAATTTCCGCTCC CGACTTATGCCACCTCTGGC
TCTGCCGGACTTGACCTGCGTGCCTGTCTCAACGACGCCGTAGAACTGGC TCCGGGTGACACTACGCTGG
TTCCGACCGGGCTGGCGATTCATATTGCCGATCCTTCACTGGCGGCAATG ATGCTGCCGCGCTCCGGATT
GGGACATAAGCACGGTATCGTGCTTGGTAACCTGGTAGGATTGATCGATT CTGACTATCAGGGCCAGTTG
ATGATTTCCGTGTGGAACCGTGGTCAGGACAGCTTCACCATTCAACCTGG CGAACGCATCGCCCAGATGA
TTTTTGTTCCGGTAGTACAGGCTGAATTTAATCTGGTGGAAGATTTCGAC GCCACCGACCGCGGTGAAGG
CGGCTTTGGTCACTCTGGTCGTCAGTAACACATACGCATCCGAATAACGT CATAACATAGCCGCAAACAT
TTCGTTTGCGGTCATAGCGTGGGTGCCGCCTGGCAAGTGCTTATTTTCAG GGGTATTTTGTAACATGGCA
GAAAAACAAACTGCGAAAAGGAACCGTCGCGAGGAAATACTTCAGTCTCT GGCGCTGATGCTGGAATCCA
GCGATGGAAGCCAACGTATCACGACGGCAAAACTGGCCGCCTCTGTCGGC GTTTCCGAAGCGGCACTGTA
TCGCCACTTCCCCAGTAAGACCCGCATGTTCGATAGCCTGATTGAGTTTA TCGAAGATAGCCTGATTACT
CGCATCAACCTGATTCTGAAAGATGAGAAAGACACCACAGCGCGCCTGCG TCTGATTGTGTTGCTGCTTC
TCGGTTTTGGTGAGCGTAATCCTGGCCTGACCCGCATCCTCACTGGTCAT GCGCTAATGTTTGAACAGGA
TCGCCTGCAAGGGCGCATCAACCAGCTGTTCGAGCGTATTGAAGCGCAGC TGCGCCAGGTATTGCGTGAA
AAGAGAATGCGTGAGGGTGAAGGTTACACCACCGATGAAACCCTGCTGGC AAGCCAGATCCTGGCCTTCT
GTGAAGGTATGCTGTCACGTTTTGTCCGCAGCGAATTTAAATACCGCCCG ACGGATGATTTTGACGCCCG
CTGGCCGCTAATTGCGGCCAGTTGCAGTAATATGACGCCGGATGACTTTT CATCCGGCGAGTTTCTTTAA
ACGCCAAACTCTTCGCGATAGGCCTTAACCGCCGCCAGATGTTCCGCCAT TTCCGGCTTCTCTTCCAGG

It is amazing that this short code is able to create an entire organism.

Then I divided this DNA sequence into triplets (codons) using vb.net. The number in brackets is simply the position of this codon in the DNA sequence.

According to the website here - http://www.ncbi.nlm.nih.gov/nuccore/X01714, the E.Coli DNA has two coding regions. I have highlighted these two coding regions below in red. The rest of the DNA is noncoding.


(1) CAG (4) AGA (7) AAA (10) TCA (13) AAA (16) AGC (19) AGG (22) CCA (25) CGC (28) AGG (31) GTG (34) ATG (37) AAT (40) TAA (43) CAA (46) TAA (49) AAA (52) TGG (55) TTA (58) AAA (61) ACC (64) CCG (67) ATA (70) TCG (73) TCG (76) CAG (79) GCG (82) TTG (85) CCG (88) CAC (91) TAA (94) AAG (97) ACC (100) ATC (103) GAC (106) CCT (109) ACG (112) TCG (115) TTG (118) GAT (121) TTG (124) CCG (127) CCG (130) AAA (133) CAA (136) ATA (139) ATG (142) TGG (145) AAG (148) AAT (151) ACG (154) CCC (157) GGC (160) AAA (163) AAC (166) GTA (169) TCC (172) GTA (175) AAA (178) ACC (181) TTG (184) ATC (187) TGA (190) TCT (193) GCG (196) CGA (199) ACG (202) ATG (205) TTT (208) CCC (211) AGC (214) CAA (217) CTC (220) AAG (223) GAT (226) TTA (229) ACA (232) GCG (235) ACA (238) ACA (241) ACG (244) CAT (247) TAC (250) ACC (253) TTT (256) TCT (259) GGC (262) AGG (265) ACG (268) GAG (271) ATA (274) AAG (277) TCT (280) TAC (283) CGC (286) TTG (289) AGC (292) GCA (295) AAG (298) AGC (301) TCC (304) TTG (307) GCC (310) AAT (313) TAT (316) TAC (319) TCG (322) ACG (325) AGA (328) TCG (331) TGA (334) CCC (337) GTT (340) ATG (343) ATG (346) AAA (349) AAA (352) ATC (355) GAC (358) GTT (361) AAG (364) ATT (367) CTG (370) GAC (373) CCG (376) CGC (379) GTT (382) GGG (385) AAG (388) GAA (391) TTT (394) CCG (397) CTC (400) CCG (403) ACT (406) TAT (409) GCC (412) ACC (415) TCT (418) GGC (421) TCT (424) GCC (427) GGA (430) CTT (433) GAC (436) CTG (439) CGT (442) GCC (445) TGT (448) CTC (451) AAC (454) GAC (457) GCC (460) GTA (463) GAA (466) CTG (469) GCT (472) CCG (475) GGT (478) GAC (481) ACT (484) ACG (487) CTG (490) GTT (493) CCG (496) ACC (499) GGG (502) CTG (505) GCG (508) ATT (511) CAT (514) ATT (517) GCC (520) GAT (523) CCT (526) TCA (529) CTG (532) GCG (535) GCA (538) ATG (541) ATG (544) CTG (547) CCG (550) CGC (553) TCC (556) GGA (559) TTG (562) GGA (565) CAT (568) AAG (571) CAC (574) GGT (577) ATC (580) GTG (583) CTT (586) GGT (589) AAC (592) CTG (595) GTA (598) GGA (601) TTG (604) ATC (607) GAT (610) TCT (613) GAC (616) TAT (619) CAG (622) GGC (625) CAG (628) TTG (631) ATG (634) ATT (637) TCC (640) GTG (643) TGG (646) AAC (649) CGT (652) GGT (655) CAG (658) GAC (661) AGC (664) TTC (667) ACC (670) ATT (673) CAA (676) CCT (679) GGC (682) GAA (685) CGC (688) ATC (691) GCC (694) CAG (697) ATG (700) ATT (703) TTT (706) GTT (709) CCG (712) GTA (715) GTA (718) CAG (721) GCT (724) GAA (727) TTT (730) AAT (733) CTG (736) GTG (739) GAA (742) GAT (745) TTC (748) GAC (751) GCC (754) ACC (757) GAC (760) CGC (763) GGT (766) GAA (769) GGC (772) GGC (775) TTT (778) GGT (781) CAC (784) TCT (787) GGT (790) CGT (793) CAG (796) TAA (799) CAC (802) ATA (805) CGC (808) ATC (811) CGA (814) ATA (817) ACG (820) TCA (823) TAA (826) CAT (829) AGC (832) CGC (835) AAA (838) CAT (841) TTC (844) GTT (847) TGC (850) GGT (853) CAT (856) AGC (859) GTG (862) GGT (865) GCC (868) GCC (871) TGG (874) CAA (877) GTG (880) CTT (883) ATT (886) TTC (889) AGG (892) GGT (895) ATT (898) TTG (901) TAA (904) CAT (907) GGC (910) AGA (913) AAA (916) ACA (919) AAC (922) TGC (925) GAA (928) AAG (931) GAA (934) CCG (937) TCG (940) CGA (943) GGA (946) AAT (949) ACT (952) TCA (955) GTC (958) TCT (961) GGC (964) GCT (967) GAT (970) GCT (973) GGA (976) ATC (979) CAG (982) CGA (985) TGG (988) AAG (991) CCA (994) ACG (997) TAT (1000) CAC (1003) GAC (1006) GGC (1009) AAA (1012) ACT (1015) GGC (1018) CGC (1021) CTC (1024) TGT (1027) CGG (1030) CGT (1033) TTC (1036) CGA (1039) AGC (1042) GGC (1045) ACT (1048) GTA (1051) TCG (1054) CCA (1057) CTT (1060) CCC (1063) CAG (1066) TAA (1069) GAC (1072) CCG (1075) CAT (1078) GTT (1081) CGA (1084) TAG (1087) CCT (1090) GAT (1093) TGA (1096) GTT (1099) TAT (1102) CGA (1105) AGA (1108) TAG (1111) CCT (1114) GAT (1117) TAC (1120) TCG (1123) CAT (1126) CAA (1129) CCT (1132) GAT (1135) TCT (1138) GAA (1141) AGA (1144) TGA (1147) GAA (1150) AGA (1153) CAC (1156) CAC (1159) AGC (1162) GCG (1165) CCT (1168) GCG (1171) TCT (1174) GAT (1177) TGT (1180) GTT (1183) GCT (1186) GCT (1189) TCT (1192) CGG (1195) TTT (1198) TGG (1201) TGA (1204) GCG (1207) TAA (1210) TCC (1213) TGG (1216) CCT (1219) GAC (1222) CCG (1225) CAT (1228) CCT (1231) CAC (1234) TGG (1237) TCA (1240) TGC (1243) GCT (1246) AAT (1249) GTT (1252) TGA (1255) ACA (1258) GGA (1261) TCG (1264) CCT (1267) GCA (1270) AGG (1273) GCG (1276) CAT (1279) CAA (1282) CCA (1285) GCT (1288) GTT (1291) CGA (1294) GCG (1297) TAT (1300) TGA (1303) AGC (1306) GCA (1309) GCT (1312) GCG (1315) CCA (1318) GGT (1321) ATT (1324) GCG (1327) TGA (1330) AAA (1333) GAG (1336) AAT (1339) GCG (1342) TGA (1345) GGG (1348) TGA (1351) AGG (1354) TTA (1357) CAC (1360) CAC (1363) CGA (1366) TGA (1369) AAC (1372) CCT (1375) GCT (1378) GGC (1381) AAG (1384) CCA (1387) GAT (1390) CCT (1393) GGC (1396) CTT (1399) CTG (1402) TGA (1405) AGG (1408) TAT (1411) GCT (1414) GTC (1417) ACG (1420) TTT (1423) TGT (1426) CCG (1429) CAG (1432) CGA (1435) ATT (1438) TAA (1441) ATA (1444) CCG (1447) CCC (1450) GAC (1453) GGA (1456) TGA (1459) TTT (1462) TGA (1465) CGC (1468) CCG (1471) CTG (1474) GCC (1477) GCT (1480) AAT (1483) TGC (1486) GGC (1489) CAG (1492) TTG (1495) CAG (1498) TAA (1501) TAT (1504) GAC (1507) GCC (1510) GGA (1513) TGA (1516) CTT (1519) TTC (1522) ATC (1525) CGG (1528) CGA (1531) GTT (1534) TCT (1537) TTA (1540) AAC (1543) GCC (1546) AAA (1549) CTC (1552) TTC (1555) GCG (1558) ATA (1561) GGC (1564) CTT (1567) AAC (1570) CGC (1573) CGC (1576) CAG (1579) ATG (1582) TTC (1585) CGC (1588) CAT (1591) TTC (1594) CGG (1597) CTT (1600) CTC (1603) TTC (1606) CAG


Then I simply counted the occurrence of the STOP Codons TAA or TAG in the coding and noncoding regions and compared them.

Result
In the non-coding region before the first red area, the stop codon TAA occurs 3 times, whilst it occurs only once in the first coding area. So the first hypothesis is supported -there is a definite difference in the frequency of the STOP CODONS between coding and noncoding areas. In the coding areas, the STOP codons only occur once, at the end of the coding sequence. Whilst in non-coding areas, the stop codons occur with much greater frequency.

This isn't really anything new. Scientists already use this criteria to identify coding areas.

Also, the frequency of occurrence of the stop codons in the noncoding area is 3 times in 113 codons = 2.65 %. This is similar to the frequency of occurrence of a letter in the Hebrew alphabet. see here - http://www.sttmedia.com/characterfrequency-hebrew

When I look at the DNA code that you present, it reminds me of the binary codes used in computers except that God uses code that is made from proteins. It certainly looks complex and more advanced than human binary codes. Just some food for thought, perhaps we could use alphabets instead of 0s and 1s in our binary codes. Another food for thought is that theorectically we can rearrange or manipulate these proteins and create new species of germs from these DNA protein codes of the germ E Coli. Craig, do you know of any research going on in which scientists are doing that to create new species of germs? The reason I asked is so as to prove that germs can be created and not evolved. I do know that you support creation than evolution.

God's creation amazes me. :pray:

Craig.Paardekooper
04-30-2012, 08:47 AM
Here is the DNA for muscles in Wild Pigs. It is called Sus Scrofa Myocin. You can find the code here - http://www.ncbi.nlm.nih.gov/nuccore/NM_214021.1

CTTATTTGCCCTGTGGTGTGGTGATGATCACAGATGTCTAATTTCCCCTT GCCTGCCATTGAGTTTACCG
AGCTGGGAGATAGTGGATAACTCACTTCCAAAATGGAGGATGGAAAACCC GTTTGGGCACCACACCCTAC
AGATGGATTTCAGGTGGGCAATATCGTGGATATTGGCCCTGACAGCTTAA CAATTGAACCCCTGAACCAA
AAAGGCAAGACCTTTTTGGCTCTCATAAACCAAGTGTTCCCTGCAGAAGA GGACAGTAAGAAAGATGTGG
AAGATAACTGTTCATTGATGTATTTAAATGAAGCCACACTCCTCCATAAT ATCAAAGTTCGATACAGTAA
AGACAGAATTTATACATATGTGGCCAACATTCTGATTGCCGTGAACCCAT ACTTTGACATTCCTAAAATC
TACTCTTCAGAAACAATAAAGTCCTACCAAGGAAAATCTCTTGGGACCAT GCCACCTCATGTCTTTGCAA
TTGCTGATAAGGCTTTTCGAGACATGAAGGTGCTCAAGCTGAGTCAGTCT ATCATTGTATCTGGAGAATC
AGGAGCTGGCAAAACGGAAAATACAAAATTTGTTCTAAGATATCTGACTG AATCCTATGGAACCGGTCAA
GATATTGATGATAGAATTGTTGAAGCTAACCCACTCCTAGAAGCCTTTGG AAATGCAAAGACTGTCCGCA
ACAATAATAGCAGTCGATTTGGGAAATTTGTAGAAATACATTTTAATGAA AAGAGTTCAGTTGTTGGAGG
ATTTGTCTCACATTATCTTCTAGAGAAATCTAGGATCTGTGTTCAAGGCA AAGAGGAAAGGAATTATCAT
ATCTTTTATAGGTTGTGTGCTGGTGCTTCTGAAGATATTAGGGAAAGACT TCATTTGAGCTCCCCAGATA
ATTTTCGGTATTTAAACCGGGGCTGCACTCGATATTTTGCTAACAAGGAA ACTGACAAACAGATTTTACA
GAACCGAAAAAGTCCTGAGTACCTTAAGGCAGGTTCCTTGAAAGACCCTT TGTTAGATGACCATGGAGAC
TTTATTAGAATGTGTACAGCCATGAAAAAAATCGGTTTGGATGATGAAGA AAAGCTCGATCTGTTCCGGG
TAGTAGCTGGCGTCCTACATCTTGGAAATATTGATTTTGAGGAAGCTGGC AGCACTTCAGGTGGTTGTAA
CCTGAAGAATAAATCTACTCAGGCATTGGAATATTGTGCAGAAAAATTAC TGGGTTTGGATCAAGACGAT
CTTCGTGTAAGTTTAACCACAAGAGTCATGCTAACAACAGCAGGGGGCGC CAAAGGAACAGTTATAAAGG
TGCCCTTGAAAGTGGAGCAAGCAAACAATGCCCGGGATGCCTTGGCAAAG ACTGTCTATAGCCATCTTTT
TGATCATGTAGTGAACAGAGTAAATCAGTGTTTTCCTTTTGAAACCTCAT CCTATTTTATTGGAGTCCTC
GACATTGCTGGTTTTGAGTACTTTGAACATAACAGTTTTGAACAATTTTG CATCAACTATTGCAATGAAA
AACTTCAACAGTTTTTTAATGAAAGGATTCTGAAGGAGGAACAAGAACTC TATCAAAAGGAAGGTTTAGG
TGTGAATGAAGTACATTACGTGGATAATCAGGACTGTATAGATTTAATTG AAGCAAGATTAGTGGGAATA
CTGGATATTCTGGATGAAGAAAATCGCCTTCCACAGCCAAGTGATCAACA CTTTACATCTGCAGGTCACC
AGAAGCACAAAGACCATTTCCGACTCTCTATTCCTAGAAAATCTAAGCTG GCAATCCATAGGAACATAGC
ATATGACGAAGGTTTCATTATCAGGCATTTTGCAGGGGCAGTTTGCTATG AAACTACTCAGTTCGTGGAA
AAAAATAATGATGCTTTGCATATGTCTCTCGAGTCCTTAATATGTGAATC CAGGGATAAATTCATCCGGG
AATTATTTGAATCATCCACAAATAACAACAAAGATACTAAACAAAAAGCA GGAAAACTTAGCTTCATCAG
TGTGGGAAACAAGTTTAAGACACAGTTAAATTTGCTTCTGGATAAACTTC GAAGTACTGGAGCAAGCTTT
ATTCGTTGTATCAAACCTAATTTAAAGATGACAAGCCACCACTTTGAAGG TGCTCAGATTTTGTCTCAAC
TTCAATGTTCAGGTATGGTGTCTGTTTTGGACCTGATGCAGGGCGGGTTT CCATCACGGGCTTCATTTCA
TGAAGTGTACAACATGTATAAGAAGTCTCTGCCGGATAAGCTTGCAAGAT TAGACCCAAGACTATTTTGT
AAGGCTCTTTTTAAAGCCCTGGGCTTAAATGAAATTGACTACAAGTTTGG GTTAACAAAAGTATTTTTTA
GACCTGGCAAGTTTGCAGAATTTGATCAGATTATGAAGTCCGACCCTGAC CACTTAGCAGAGCTGGTTAA
GAGAGTCAATCACTGGCTTATCTGCAGTCGCTGGAAGAAAGTTCAGTGGT GCTCGCTCTCAGTCATTAAA
TTGAAAAACAAAATAAAATATCGAGCTGAAGCCTGCATTAAAATGCAGAA AACTATTCGAATGTGGCTTT
GCAAAAGGAGACACAAACCTCGCATTGACGGCCTTGTTAAGGTGGGCACA CTGAAAAAACGGCTTGACAA
ATTTAACGAAGTAGTAAGTGCCCTGAAAGATGGAAAACAGGAAATGAGTA AACAGGTCAAGGACCTTGAA
ATCTCTATTGATGCTTTAATGGCCAAAATTAAGTCTACTATGATGACAAG GGAACAAATTCAGAAAGAAT
ATGATGCATTAGTTAAAAGCTCAGCCGTCCTCCTCAGTGCATTACAGAAA AAGAAGCAGCAAGAAGAGGA
AGCAGAAAGGCTGAGGCGTATTCAAGAAGAAATGGAAAAGGAAAGAAAAA GACGTGAAGAAGATGAACAA
CGTCGAAGAAAGGAGGAGGAGGAAAGGCGGATGAAACTTGAGATGGAAGC AAAGAGAAAACAAGAAGAAG
AAGAGAGAAAGAAAAGGGAAGATGATGAAAAACGTATTCAGGCTGAGGTG GAGGCGCAGCTGGCCCGACA
GCGGGAGGAGGAGTCCCAGCAGCAGGCAGTTCTGGAGCAGGAGCGCCGGG ACCGGGAGCTGGCCCTGCGA
ATTGCCCAGAGCGAGGCAGAGCTCATCAGTGACGAGGCGCAGGCCGACCC TGGGCTGCGCAGAGGCCCTG
CTGTACAAGCCACCAAAGCGGCTGCTGGTACCAAGAAATATGATCTTAGT AAATGGAAATATGCAGAACT
ACGGGATACCATCAATACTTCTTGTGATATTGAGCTCCTGGCAGCTTGCA GAGAAGAATTTCATAGGAGA
CTAAAAGTGTATCATGCTTGGAAGTCCAAGAACAAGAAGAGAAATACTGA AACAGAGCAACGTGCTCCAA
AGTCTGTTACTGATTATGCTCAGCAGAACCCAGCAGTGCAGCTCCCTGCC AGGCAGCAGGAGATCGAAAT
GAACCGGCAGCAGCGTTTCTTCCGCATTCCGTTCATCCGTTCTGCGGACC AGTACAAAGACCCTCAGAAT
AAGAAGAAAGGCTGGTGGTATGCCCATTTTGATGGACCGTGGATCGCCCG GCAAATGGAACTTCATCCTG
ACAAACCACCCATCCTCCTTGTGGCTGGTAAGGATGACATGGAGATGTGT GAGCTGAATCTTGAAGAGAC
AGGCCTGACTCGAAAGCGTGGTGCAGAGATTTTGCCAAGACAGTTCGAAG AAATTTGGGAACGCTGTGGA
GGCATCCAGTATCTTCAGAATGCAATTGAGAGCAGACAGGCTAGGCCCAC ATATGCCACGGCCATGCTGC
AGAACCTGTTAAAGTAGAAGTTGCACTAACCTTGCAGCTGGGAGCTCTTG CCATGGTACTGGGTAGGGAG
TGTGCCCCAGACATTGACCCATTCCAGGATCCAGTTAGAGTTATGTAAAC AAAGTGAACAGATTTTATTA
ATCATGGCTTTTTGTTAATTTAAGGTTAATTACAGTAGTGAATTGGGGAC CTGAAAATTAGTTTCTTGTA
TCCAGCTATAACTGTTGAACCTCTCATGATTTTAATACTTGTTACACTTG GGCAGATTCTGAACCATTTC
TCATTCTTTGCCAACTGACTACCTTAAATCTATCATCACTGTTCTTGAGG AAAGAAGTTTTTTAAAAAAA
TGCAGATTTCTTGCTTTTTAAGAATGACACAGTACCATATAACTGGAATA AAGAAAACTTAGTTTCAGTT
TTCCTACAAAACTAAGGCGCTTAAAATGATAAAGCACTGATGTTTTGATC TGAAAGCTGTGAATTTTATT
CATTTTTTCAGAAATTAATGGCATTTCCGTCAAAGGTAGAAATTTTTATT TTCCTCACTCTTTTGCAGTG
TTTTATTTGAGTAAAGCAATTTACCTGAAATTCTAGAATTCTGGAAGAAC CTAAATGTATTTGATGCTAT
CTGTGACAAAGAAGGTACATAGTATCCTGCAGAGATGTGTTTTGGTTTTC TGTCACATTGTATTGCTGTA
AGAATATGTTTCATGGACAAATAAAGGAAATTCAGATCAAAAAAAAAAAA AAAAAA

There is a coding area from base 103 to base 3867 shaded in red below. The rest is non coding

(1) CTT (4) ATT (7) TGC (10) CCT (13) GTG (16) GTG (19) TGG (22) TGA (25) TGA (28) TCA (31) CAG (34) ATG (37) TCT (40) AAT (43) TTC (46) CCC (49) TTG (52) CCT (55) GCC (58) ATT (61) GAG (64) TTT (67) ACC (70) GAG (73) CTG (76) GGA (79) GAT (82) AGT (85) GGA (88) TAA (91) CTC (94) ACT (97) TCC (100) AAA (103) ATG (106) GAG (109) GAT (112) GGA (115) AAA (118) CCC (121) GTT (124) TGG (127) GCA (130) CCA (133) CAC (136) CCT (139) ACA (142) GAT (145) GGA (148) TTT (151) CAG (154) GTG (157) GGC (160) AAT (163) ATC (166) GTG (169) GAT (172) ATT (175) GGC (178) CCT (181) GAC (184) AGC (187) TTA (190) ACA (193) ATT (196) GAA (199) CCC (202) CTG (205) AAC (208) CAA (211) AAA (214) GGC (217) AAG (220) ACC (223) TTT (226) TTG (229) GCT (232) CTC (235) ATA (238) AAC (241) CAA (244) GTG (247) TTC (250) CCT (253) GCA (256) GAA (259) GAG (262) GAC (265) AGT (268) AAG (271) AAA (274) GAT (277) GTG (280) GAA (283) GAT (286) AAC (289) TGT (292) TCA (295) TTG (298) ATG (301) TAT (304) TTA (307) AAT (310) GAA (313) GCC (316) ACA (319) CTC (322) CTC (325) CAT (328) AAT (331) ATC (334) AAA (337) GTT (340) CGA (343) TAC (346) AGT (349) AAA (352) GAC (355) AGA (358) ATT (361) TAT (364) ACA (367) TAT (370) GTG (373) GCC (376) AAC (379) ATT (382) CTG (385) ATT (388) GCC (391) GTG (394) AAC (397) CCA (400) TAC (403) TTT (406) GAC (409) ATT (412) CCT (415) AAA (418) ATC (421) TAC (424) TCT (427) TCA (430) GAA (433) ACA (436) ATA (439) AAG (442) TCC (445) TAC (448) CAA (451) GGA (454) AAA (457) TCT (460) CTT (463) GGG (466) ACC (469) ATG (472) CCA (475) CCT (478) CAT (481) GTC (484) TTT (487) GCA (490) ATT (493) GCT (496) GAT (499) AAG (502) GCT (505) TTT (508) CGA (511) GAC (514) ATG (517) AAG (520) GTG (523) CTC (526) AAG (529) CTG (532) AGT (535) CAG (538) TCT (541) ATC (544) ATT (547) GTA (550) TCT (553) GGA (556) GAA (559) TCA (562) GGA (565) GCT (568) GGC (571) AAA (574) ACG (577) GAA (580) AAT (583) ACA (586) AAA (589) TTT (592) GTT (595) CTA (598) AGA (601) TAT (604) CTG (607) ACT (610) GAA (613) TCC (616) TAT (619) GGA (622) ACC (625) GGT (628) CAA (631) GAT (634) ATT (637) GAT (640) GAT (643) AGA (646) ATT (649) GTT (652) GAA (655) GCT (658) AAC (661) CCA (664) CTC (667) CTA (670) GAA (673) GCC (676) TTT (679) GGA (682) AAT (685) GCA (688) AAG (691) ACT (694) GTC (697) CGC (700) AAC (703) AAT (706) AAT (709) AGC (712) AGT (715) CGA (718) TTT (721) GGG (724) AAA (727) TTT (730) GTA (733) GAA (736) ATA (739) CAT (742) TTT (745) AAT (748) GAA (751) AAG (754) AGT (757) TCA (760) GTT (763) GTT (766) GGA (769) GGA (772) TTT (775) GTC (778) TCA (781) CAT (784) TAT (787) CTT (790) CTA (793) GAG (796) AAA (799) TCT (802) AGG (805) ATC (808) TGT (811) GTT (814) CAA (817) GGC (820) AAA (823) GAG (826) GAA (829) AGG (832) AAT (835) TAT (838) CAT (841) ATC (844) TTT (847) TAT (850) AGG (853) TTG (856) TGT (859) GCT (862) GGT (865) GCT (868) TCT (871) GAA (874) GAT (877) ATT (880) AGG (883) GAA (886) AGA (889) CTT (892) CAT (895) TTG (898) AGC (901) TCC (904) CCA (907) GAT (910) AAT (913) TTT (916) CGG (919) TAT (922) TTA (925) AAC (928) CGG (931) GGC (934) TGC (937) ACT (940) CGA (943) TAT (946) TTT (949) GCT (952) AAC (955) AAG (958) GAA (961) ACT (964) GAC (967) AAA (970) CAG (973) ATT (976) TTA (979) CAG (982) AAC (985) CGA (988) AAA (991) AGT (994) CCT (997) GAG (1000) TAC (1003) CTT (1006) AAG (1009) GCA (1012) GGT (1015) TCC (1018) TTG (1021) AAA (1024) GAC (1027) CCT (1030) TTG (1033) TTA (1036) GAT (1039) GAC (1042) CAT (1045) GGA (1048) GAC (1051) TTT (1054) ATT (1057) AGA (1060) ATG (1063) TGT (1066) ACA (1069) GCC (1072) ATG (1075) AAA (1078) AAA (1081) ATC (1084) GGT (1087) TTG (1090) GAT (1093) GAT (1096) GAA (1099) GAA (1102) AAG (1105) CTC (1108) GAT (1111) CTG (1114) TTC (1117) CGG (1120) GTA (1123) GTA (1126) GCT (1129) GGC (1132) GTC (1135) CTA (1138) CAT (1141) CTT (1144) GGA (1147) AAT (1150) ATT (1153) GAT (1156) TTT (1159) GAG (1162) GAA (1165) GCT (1168) GGC (1171) AGC (1174) ACT (1177) TCA (1180) GGT (1183) GGT (1186) TGT (1189) AAC (1192) CTG (1195) AAG (1198) AAT (1201) AAA (1204) TCT (1207) ACT (1210) CAG (1213) GCA (1216) TTG (1219) GAA (1222) TAT (1225) TGT (1228) GCA (1231) GAA (1234) AAA (1237) TTA (1240) CTG (1243) GGT (1246) TTG (1249) GAT (1252) CAA (1255) GAC (1258) GAT (1261) CTT (1264) CGT (1267) GTA (1270) AGT (1273) TTA (1276) ACC (1279) ACA (1282) AGA (1285) GTC (1288) ATG (1291) CTA (1294) ACA (1297) ACA (1300) GCA (1303) GGG (1306) GGC (1309) GCC (1312) AAA (1315) GGA (1318) ACA (1321) GTT (1324) ATA (1327) AAG (1330) GTG (1333) CCC (1336) TTG (1339) AAA (1342) GTG (1345) GAG (1348) CAA (1351) GCA (1354) AAC (1357) AAT (1360) GCC (1363) CGG (1366) GAT (1369) GCC (1372) TTG (1375) GCA (1378) AAG (1381) ACT (1384) GTC (1387) TAT (1390) AGC (1393) CAT (1396) CTT (1399) TTT (1402) GAT (1405) CAT (1408) GTA (1411) GTG (1414) AAC (1417) AGA (1420) GTA (1423) AAT (1426) CAG (1429) TGT (1432) TTT (1435) CCT (1438) TTT (1441) GAA (1444) ACC (1447) TCA (1450) TCC (1453) TAT (1456) TTT (1459) ATT (1462) GGA (1465) GTC (1468) CTC (1471) GAC (1474) ATT (1477) GCT (1480) GGT (1483) TTT (1486) GAG (1489) TAC (1492) TTT (1495) GAA (1498) CAT (1501) AAC (1504) AGT (1507) TTT (1510) GAA (1513) CAA (1516) TTT (1519) TGC (1522) ATC (1525) AAC (1528) TAT (1531) TGC (1534) AAT (1537) GAA (1540) AAA (1543) CTT (1546) CAA (1549) CAG (1552) TTT (1555) TTT (1558) AAT (1561) GAA (1564) AGG (1567) ATT (1570) CTG (1573) AAG (1576) GAG (1579) GAA (1582) CAA (1585) GAA (1588) CTC (1591) TAT (1594) CAA (1597) AAG (1600) GAA (1603) GGT (1606) TTA (1609) GGT (1612) GTG (1615) AAT (1618) GAA (1621) GTA (1624) CAT (1627) TAC (1630) GTG (1633) GAT (1636) AAT (1639) CAG (1642) GAC (1645) TGT (1648) ATA (1651) GAT (1654) TTA (1657) ATT (1660) GAA (1663) GCA (1666) AGA (1669) TTA (1672) GTG (1675) GGA (1678) ATA (1681) CTG (1684) GAT (1687) ATT (1690) CTG (1693) GAT (1696) GAA (1699) GAA (1702) AAT (1705) CGC (1708) CTT (1711) CCA (1714) CAG (1717) CCA (1720) AGT (1723) GAT (1726) CAA (1729) CAC (1732) TTT (1735) ACA (1738) TCT (1741) GCA (1744) GGT (1747) CAC (1750) CAG (1753) AAG (1756) CAC (1759) AAA (1762) GAC (1765) CAT (1768) TTC (1771) CGA (1774) CTC (1777) TCT (1780) ATT (1783) CCT (1786) AGA (1789) AAA (1792) TCT (1795) AAG (1798) CTG (1801) GCA (1804) ATC (1807) CAT (1810) AGG (1813) AAC (1816) ATA (1819) GCA (1822) TAT (1825) GAC (1828) GAA (1831) GGT (1834) TTC (1837) ATT (1840) ATC (1843) AGG (1846) CAT (1849) TTT (1852) GCA (1855) GGG (1858) GCA (1861) GTT (1864) TGC (1867) TAT (1870) GAA (1873) ACT (1876) ACT (1879) CAG (1882) TTC (1885) GTG (1888) GAA (1891) AAA (1894) AAT (1897) AAT (1900) GAT (1903) GCT (1906) TTG (1909) CAT (1912) ATG (1915) TCT (1918) CTC (1921) GAG (1924) TCC (1927) TTA (1930) ATA (1933) TGT (1936) GAA (1939) TCC (1942) AGG (1945) GAT (1948) AAA (1951) TTC (1954) ATC (1957) CGG (1960) GAA (1963) TTA (1966) TTT (1969) GAA (1972) TCA (1975) TCC (1978) ACA (1981) AAT (1984) AAC (1987) AAC (1990) AAA (1993) GAT (1996) ACT (1999) AAA (2002) CAA (2005) AAA (2008) GCA (2011) GGA (2014) AAA (2017) CTT (2020) AGC (2023) TTC (2026) ATC (2029) AGT (2032) GTG (2035) GGA (2038) AAC (2041) AAG (2044) TTT (2047) AAG (2050) ACA (2053) CAG (2056) TTA (2059) AAT (2062) TTG (2065) CTT (2068) CTG (2071) GAT (2074) AAA (2077) CTT (2080) CGA (2083) AGT (2086) ACT (2089) GGA (2092) GCA (2095) AGC (2098) TTT (2101) ATT (2104) CGT (2107) TGT (2110) ATC (2113) AAA (2116) CCT (2119) AAT (2122) TTA (2125) AAG (2128) ATG (2131) ACA (2134) AGC (2137) CAC (2140) CAC (2143) TTT (2146) GAA (2149) GGT (2152) GCT (2155) CAG (2158) ATT (2161) TTG (2164) TCT (2167) CAA (2170) CTT (2173) CAA (2176) TGT (2179) TCA (2182) GGT (2185) ATG (2188) GTG (2191) TCT (2194) GTT (2197) TTG (2200) GAC (2203) CTG (2206) ATG (2209) CAG (2212) GGC (2215) GGG (2218) TTT (2221) CCA (2224) TCA (2227) CGG (2230) GCT (2233) TCA (2236) TTT (2239) CAT (2242) GAA (2245) GTG (2248) TAC (2251) AAC (2254) ATG (2257) TAT (2260) AAG (2263) AAG (2266) TCT (2269) CTG (2272) CCG (2275) GAT (2278) AAG (2281) CTT (2284) GCA (2287) AGA (2290) TTA (2293) GAC (2296) CCA (2299) AGA (2302) CTA (2305) TTT (2308) TGT (2311) AAG (2314) GCT (2317) CTT (2320) TTT (2323) AAA (2326) GCC (2329) CTG (2332) GGC (2335) TTA (2338) AAT (2341) GAA (2344) ATT (2347) GAC (2350) TAC (2353) AAG (2356) TTT (2359) GGG (2362) TTA (2365) ACA (2368) AAA (2371) GTA (2374) TTT (2377) TTT (2380) AGA (2383) CCT (2386) GGC (2389) AAG (2392) TTT (2395) GCA (2398) GAA (2401) TTT (2404) GAT (2407) CAG (2410) ATT (2413) ATG (2416) AAG (2419) TCC (2422) GAC (2425) CCT (2428) GAC (2431) CAC (2434) TTA (2437) GCA (2440) GAG (2443) CTG (2446) GTT (2449) AAG (2452) AGA (2455) GTC (2458) AAT (2461) CAC (2464) TGG (2467) CTT (2470) ATC (2473) TGC (2476) AGT (2479) CGC (2482) TGG (2485) AAG (2488) AAA (2491) GTT (2494) CAG (2497) TGG (2500) TGC (2503) TCG (2506) CTC (2509) TCA (2512) GTC (2515) ATT (2518) AAA (2521) TTG (2524) AAA (2527) AAC (2530) AAA (2533) ATA (2536) AAA (2539) TAT (2542) CGA (2545) GCT (2548) GAA (2551) GCC (2554) TGC (2557) ATT (2560) AAA (2563) ATG (2566) CAG (2569) AAA (2572) ACT (2575) ATT (2578) CGA (2581) ATG (2584) TGG (2587) CTT (2590) TGC (2593) AAA (2596) AGG (2599) AGA (2602) CAC (2605) AAA (2608) CCT (2611) CGC (2614) ATT (2617) GAC (2620) GGC (2623) CTT (2626) GTT (2629) AAG (2632) GTG (2635) GGC (2638) ACA (2641) CTG (2644) AAA (2647) AAA (2650) CGG (2653) CTT (2656) GAC (2659) AAA (2662) TTT (2665) AAC (2668) GAA (2671) GTA (2674) GTA (2677) AGT (2680) GCC (2683) CTG (2686) AAA (2689) GAT (2692) GGA (2695) AAA (2698) CAG (2701) GAA (2704) ATG (2707) AGT (2710) AAA (2713) CAG (2716) GTC (2719) AAG (2722) GAC (2725) CTT (2728) GAA (2731) ATC (2734) TCT (2737) ATT (2740) GAT (2743) GCT (2746) TTA (2749) ATG (2752) GCC (2755) AAA (2758) ATT (2761) AAG (2764) TCT (2767) ACT (2770) ATG (2773) ATG (2776) ACA (2779) AGG (2782) GAA (2785) CAA (2788) ATT (2791) CAG (2794) AAA (2797) GAA (2800) TAT (2803) GAT (2806) GCA (2809) TTA (2812) GTT (2815) AAA (2818) AGC (2821) TCA (2824) GCC (2827) GTC (2830) CTC (2833) CTC (2836) AGT (2839) GCA (2842) TTA (2845) CAG (2848) AAA (2851) AAG (2854) AAG (2857) CAG (2860) CAA (2863) GAA (2866) GAG (2869) GAA (2872) GCA (2875) GAA (2878) AGG (2881) CTG (2884) AGG (2887) CGT (2890) ATT (2893) CAA (2896) GAA (2899) GAA (2902) ATG (2905) GAA (2908) AAG (2911) GAA (2914) AGA (2917) AAA (2920) AGA (2923) CGT (2926) GAA (2929) GAA (2932) GAT (2935) GAA (2938) CAA (2941) CGT (2944) CGA (2947) AGA (2950) AAG (2953) GAG (2956) GAG (2959) GAG (2962) GAA (2965) AGG (2968) CGG (2971) ATG (2974) AAA (2977) CTT (2980) GAG (2983) ATG (2986) GAA (2989) GCA (2992) AAG (2995) AGA (2998) AAA (3001) CAA (3004) GAA (3007) GAA (3010) GAA (3013) GAG (3016) AGA (3019) AAG (3022) AAA (3025) AGG (3028) GAA (3031) GAT (3034) GAT (3037) GAA (3040) AAA (3043) CGT (3046) ATT (3049) CAG (3052) GCT (3055) GAG (3058) GTG (3061) GAG (3064) GCG (3067) CAG (3070) CTG (3073) GCC (3076) CGA (3079) CAG (3082) CGG (3085) GAG (3088) GAG (3091) GAG (3094) TCC (3097) CAG (3100) CAG (3103) CAG (3106) GCA (3109) GTT (3112) CTG (3115) GAG (3118) CAG (3121) GAG (3124) CGC (3127) CGG (3130) GAC (3133) CGG (3136) GAG (3139) CTG (3142) GCC (3145) CTG (3148) CGA (3151) ATT (3154) GCC (3157) CAG (3160) AGC (3163) GAG (3166) GCA (3169) GAG (3172) CTC (3175) ATC (3178) AGT (3181) GAC (3184) GAG (3187) GCG (3190) CAG (3193) GCC (3196) GAC (3199) CCT (3202) GGG (3205) CTG (3208) CGC (3211) AGA (3214) GGC (3217) CCT (3220) GCT (3223) GTA (3226) CAA (3229) GCC (3232) ACC (3235) AAA (3238) GCG (3241) GCT (3244) GCT (3247) GGT (3250) ACC (3253) AAG (3256) AAA (3259) TAT (3262) GAT (3265) CTT (3268) AGT (3271) AAA (3274) TGG (3277) AAA (3280) TAT (3283) GCA (3286) GAA (3289) CTA (3292) CGG (3295) GAT (3298) ACC (3301) ATC (3304) AAT (3307) ACT (3310) TCT (3313) TGT (3316) GAT (3319) ATT (3322) GAG (3325) CTC (3328) CTG (3331) GCA (3334) GCT (3337) TGC (3340) AGA (3343) GAA (3346) GAA (3349) TTT (3352) CAT (3355) AGG (3358) AGA (3361) CTA (3364) AAA (3367) GTG (3370) TAT (3373) CAT (3376) GCT (3379) TGG (3382) AAG (3385) TCC (3388) AAG (3391) AAC (3394) AAG (3397) AAG (3400) AGA (3403) AAT (3406) ACT (3409) GAA (3412) ACA (3415) GAG (3418) CAA (3421) CGT (3424) GCT (3427) CCA (3430) AAG (3433) TCT (3436) GTT (3439) ACT (3442) GAT (3445) TAT (3448) GCT (3451) CAG (3454) CAG (3457) AAC (3460) CCA (3463) GCA (3466) GTG (3469) CAG (3472) CTC (3475) CCT (3478) GCC (3481) AGG (3484) CAG (3487) CAG (3490) GAG (3493) ATC (3496) GAA (3499) ATG (3502) AAC (3505) CGG (3508) CAG (3511) CAG (3514) CGT (3517) TTC (3520) TTC (3523) CGC (3526) ATT (3529) CCG (3532) TTC (3535) ATC (3538) CGT (3541) TCT (3544) GCG (3547) GAC (3550) CAG (3553) TAC (3556) AAA (3559) GAC (3562) CCT (3565) CAG (3568) AAT (3571) AAG (3574) AAG (3577) AAA (3580) GGC (3583) TGG (3586) TGG (3589) TAT (3592) GCC (3595) CAT (3598) TTT (3601) GAT (3604) GGA (3607) CCG (3610) TGG (3613) ATC (3616) GCC (3619) CGG (3622) CAA (3625) ATG (3628) GAA (3631) CTT (3634) CAT (3637) CCT (3640) GAC (3643) AAA (3646) CCA (3649) CCC (3652) ATC (3655) CTC (3658) CTT (3661) GTG (3664) GCT (3667) GGT (3670) AAG (3673) GAT (3676) GAC (3679) ATG (3682) GAG (3685) ATG (3688) TGT (3691) GAG (3694) CTG (3697) AAT (3700) CTT (3703) GAA (3706) GAG (3709) ACA (3712) GGC (3715) CTG (3718) ACT (3721) CGA (3724) AAG (3727) CGT (3730) GGT (3733) GCA (3736) GAG (3739) ATT (3742) TTG (3745) CCA (3748) AGA (3751) CAG (3754) TTC (3757) GAA (3760) GAA (3763) ATT (3766) TGG (3769) GAA (3772) CGC (3775) TGT (3778) GGA (3781) GGC (3784) ATC (3787) CAG (3790) TAT (3793) CTT (3796) CAG (3799) AAT (3802) GCA (3805) ATT (3808) GAG (3811) AGC (3814) AGA (3817) CAG (3820) GCT (3823) AGG (3826) CCC (3829) ACA (3832) TAT (3835) GCC (3838) ACG (3841) GCC (3844) ATG (3847) CTG (3850) CAG (3853) AAC (3856) CTG (3859) TTA (3862) AAG (3865) TAG (3868) AAG (3871) TTG (3874) CAC (3877) **TAA (3880) CCT (3883) TGC (3886) AGC (3889) TGG (3892) GAG (3895) CTC (3898) TTG (3901) CCA (3904) TGG (3907) TAC (3910) TGG (3913) GTA (3916) GGG (3919) AGT (3922) GTG (3925) CCC (3928) CAG (3931) ACA (3934) TTG (3937) ACC (3940) CAT (3943) TCC (3946) AGG (3949) ATC (3952) CAG (3955) TTA (3958) GAG (3961) TTA (3964) TGT (3967) AAA (3970) CAA (3973) AGT (3976) GAA (3979) CAG (3982) ATT (3985) TTA (3988) TTA (3991) ATC (3994) ATG (3997) GCT (4000) TTT (4003) TGT (4006) **TAA (4009) TTT (4012) AAG (4015) GTT (4018) AAT (4021) TAC (4024) AGT (4027) AGT (4030) GAA (4033) TTG (4036) GGG (4039) ACC (4042) TGA (4045) AAA (4048) TTA (4051) GTT (4054) TCT (4057) TGT (4060) ATC (4063) CAG (4066) CTA (4069) **TAA (4072) CTG (4075) TTG (4078) AAC (4081) CTC (4084) TCA (4087) TGA (4090) TTT (4093) **TAA (4096) TAC (4099) TTG (4102) TTA (4105) CAC (4108) TTG (4111) GGC (4114) AGA (4117) TTC (4120) TGA (4123) ACC (4126) ATT (4129) TCT (4132) CAT (4135) TCT (4138) TTG (4141) CCA (4144) ACT (4147) GAC (4150) TAC (4153) CTT (4156) AAA (4159) TCT (4162) ATC (4165) ATC (4168) ACT (4171) GTT (4174) CTT (4177) GAG (4180) GAA (4183) AGA (4186) AGT (4189) TTT (4192) TTA (4195) AAA (4198) AAA (4201) TGC (4204) AGA (4207) TTT (4210) CTT (4213) GCT (4216) TTT (4219) **TAA (4222) GAA (4225) TGA (4228) CAC (4231) AGT (4234) ACC (4237) ATA (4240) **TAA (4243) CTG (4246) GAA (4249) **TAA (4252) AGA (4255) AAA (4258) CTT (4261) AGT (4264) TTC (4267) AGT (4270) TTT (4273) CCT (4276) ACA (4279) AAA (4282) CTA (4285) AGG (4288) CGC (4291) TTA (4294) AAA (4297) TGA (4300) **TAA (4303) AGC (4306) ACT (4309) GAT (4312) GTT (4315) TTG (4318) ATC (4321) TGA (4324) AAG (4327) CTG (4330) TGA (4333) ATT (4336) TTA (4339) TTC (4342) ATT (4345) TTT (4348) TCA (4351) GAA (4354) ATT (4357) AAT (4360) GGC (4363) ATT (4366) TCC (4369) GTC (4372) AAA (4375) GGT (4378) AGA (4381) AAT (4384) TTT (4387) TAT (4390) TTT (4393) CCT (4396) CAC (4399) TCT (4402) TTT (4405) GCA (4408) GTG (4411) TTT (4414) TAT (4417) TTG (4420) AGT (4423) AAA (4426) GCA (4429) ATT (4432) TAC (4435) CTG (4438) AAA (4441) TTC (4444) TAG (4447) AAT (4450) TCT (4453) GGA (4456) AGA (4459) ACC (4462) ** TAA (4465) ATG (4468) TAT (4471) TTG (4474) ATG (4477) CTA (4480) TCT (4483) GTG (4486) ACA (4489) AAG (4492) AAG (4495) GTA (4498) CAT (4501) AGT (4504) ATC (4507) CTG (4510) CAG (4513) AGA (4516) TGT (4519) GTT (4522) TTG (4525) GTT (4528) TTC (4531) TGT (4534) CAC (4537) ATT (4540) GTA (4543) TTG (4546) CTG (4549) **TAA (4552) GAA (4555) TAT (4558) GTT (4561) TCA (4564) TGG (4567) ACA (4570) AAT (4573) AAA (4576) GGA (4579) AAT (4582) TCA (4585) GAT (4588) CAA (4591) AAA (4594) AAA (4597) AAA (4600) AAA (4603) AAA

In the entire red area, a Stop Codon occurs only once, whilst in the non-coding area stop codons occur 12 times over 280 codons = 4.2%

Craig.Paardekooper
05-01-2012, 12:58 PM
Statistical and linguistic features of DNA sequences.
Havlin S, Buldyrev SV, Goldberger AL, Mantegna RN, Peng CK, Simons M, Stanley HE.
Center for Polymer Studies and Department of Physics, Boston University, MA 02215, USA.


Abstract

We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.


http://cps.bu.edu/hes/articles/mbghpss94.pdf


"Linguistic features of noncoding DNA sequences."
Mantegna RN, Buldyrev SV, Goldberger AL, Havlin S, Peng CK, Simons M, Stanley HE.
Center for Polymer Studies and Department of Physics, Boston University, Massachusetts 02215, USA.


Abstract

We extend the Zipf approach to analyzing linguistic texts to the statistical study of DNA base pair sequences and find that the noncoding regions are more similar to natural languages than the coding regions.

Richard Amiel McGough
05-01-2012, 01:43 PM
Statistical and linguistic features of DNA sequences.
Havlin S, Buldyrev SV, Goldberger AL, Mantegna RN, Peng CK, Simons M, Stanley HE.
Center for Polymer Studies and Department of Physics, Boston University, MA 02215, USA.


Abstract

We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.


http://cps.bu.edu/hes/articles/mbghpss94.pdf


"Linguistic features of noncoding DNA sequences."
Mantegna RN, Buldyrev SV, Goldberger AL, Havlin S, Peng CK, Simons M, Stanley HE.
Center for Polymer Studies and Department of Physics, Boston University, Massachusetts 02215, USA.


Abstract

We extend the Zipf approach to analyzing linguistic texts to the statistical study of DNA base pair sequences and find that the noncoding regions are more similar to natural languages than the coding regions.
Fascinating! Thanks.

:signthankspin:

Craig.Paardekooper
05-01-2012, 02:19 PM
If there are language areas within noncoding DNA, then the 64 codons would map onto the letters of an alphabet. For example, the 64 codons could map onto the 22 letters of the Hebrew alphabet.

We could test this by taking a DNA string and substituting each codon for a Hebrew letter, and then seeing if any intelligible words emerge.

In this scenario, a codon could represent any of the 22 letters. If we took a string of 5 different codons, then a software program could loop through each of these possible letters, and produce a list of 5 letter "words". If any of these words were then found in the dictionary, then we might have discovered something.

For 5 codons, the number of possible permutations is 22 x 21 x 20 x 19 x 18 = 3,160,080. This should produce a list of 5 letter words, most of which are meaningless. But some of the words will be meaningful. We would have to match each word to a Hebrew dictionary - using a spell-check program. If the word was the correct spelling of a Hebrew word, then it would be saved together with the codon sequence.

I would use a database of 22 columns, with each column representing a letter in the alphabet. When a meaningful word is found, it would be inserted into the database, so that the codon matching each letter, would be entered in the column for that letter

If this was repeated with 100 different groups of 5 codons, then we should end up with a batch of meaningful words matched with codons. In each case, the codons matching each letter would have been recorded.

The database could then be queried to determine the codons occurring with highest frequency for each letter. This would possibly reveal the genetic alphabet.

STEP 1
Create a looping program to substitute codons with letters - this will produce 3,160,080 "words"

STEP 2
Use a "spell-check" program to isolate "words" with correct spellings.

STEP 3
Enter the codons for correctly spelled words into a database.

STEP 4
Repeat with other codon sequences

STEP 5
Determine codons that occur with highest frequency in each database column (column = letter)

I think that this would work, but I am not sure if it is the best way to crack this code. Perhaps an easier method would be to find out what the most common word in the Hebrew dictionary is, then find out what are the most common noncoding codon sequences, and then see if a match can be found.

Craig.Paardekooper
05-03-2012, 05:08 AM
I decided that a faster method would be to determine the frequency of codons in the entire human genome, then see if I could match these with the frequency of occurrence of each of the 22 leters in the Hebrew alphabet. My reasoning was that the most commonly occurring Hebrew letters would match the most commonly occurring codons, and le least common hebrew letters would match the least common codons.

First I obtained the frequency of occurrence of every codon

Dim TTT As Double = 36530115
Dim ATT As Double = 23669701
Dim TCT As Double = 20990387
Dim TTA As Double = 19750578
Dim TAT As Double = 19568343
Dim CTG As Double = 19195946
Dim TGT As Double = 19152113
Dim CTT As Double = 18944797
Dim TTC As Double = 18708048
Dim TCA As Double = 18565027
Dim TTG As Double = 18005020
Dim TGG As Double = 17480496
Dim CAT As Double = 17423117
Dim CCT As Double = 16835177
Dim CTC As Double = 15942742
Dim AGT As Double = 15266057
Dim GGA As Double = 14619310
Dim GTG As Double = 14252868
Dim GTT As Double = 13852086
Dim TGC As Double = 13649076
Dim GCT As Double = 13252828
Dim GAT As Double = 12658530
Dim GGG As Double = 12446600
Dim TAG As Double = 12240281
Dim GCC As Double = 11268094
Dim GGT As Double = 11026602
Dim GTA As Double = 10766854
Dim GTC As Double = 8955434
Dim CCG As Double = 2606672
Dim CGT As Double = 2379612
Dim GCG As Double = 2247440
Dim TCG As Double = 2087242
Dim AAA As Double = 36381293
Dim AAT As Double = 23634011
Dim AGA As Double = 20948987
Dim TAA As Double = 19721149
Dim ATA As Double = 19548709
Dim CAG As Double = 19176935
Dim ACA As Double = 19073189
Dim AAG As Double = 18894716
Dim GAA As Double = 18678084
Dim TGA As Double = 18562015
Dim CAA As Double = 17927956
Dim CCA As Double = 17444649
Dim ATG As Double = 17409063
Dim AGG As Double = 16810797
Dim GAG As Double = 15939419
Dim ACT As Double = 15251455
Dim TCC As Double = 14614789
Dim CAC As Double = 14214421
Dim AAC As Double = 13794251
Dim GCA As Double = 13635427
Dim AGC As Double = 13242724
Dim ATC As Double = 12650299
Dim CCC As Double = 12428986
Dim CTA As Double = 12217331
Dim GGC As Double = 11258126
Dim ACC As Double = 11007307
Dim TAC As Double = 10755607
Dim GAC As Double = 8938833
Dim CGG As Double = 2604253
Dim ACG As Double = 2372235
Dim CGC As Double = 2244432
Dim CGA As Double = 2085226

There are more codons than there are letters in the alphabet, so I reasoned that maybe a letter can be coded for by more than one codon. This would mean that they may have a redundancy pattern similar to the amino acids. So I calculated the frequency the codons matching each amino acid in the human genome

17409063 MET 1.83%
17480496 TRP 1.84%
21597363 ASP 2.27%
30323950 TYR 3.19%
31637538 HIS 3.33%
32801189 CYS 3.46%
34617503 Glu 3.65%
37104891 Gln 3.91%
37428262 Asn 3.94%
40403789 Ala 4.26%
47073307 Arg 4.96%
47704186 Thr 5.03%
47827242 Val 5.04%
49315484 Pro 5.20%
49350638 Gly 5.206%
50523445 STOP 5.33%
55238163 Phe 5.82%
55276009 Lys 5.83%
55868709 Ile 5.89%
84766226 Ser 8.94%
104056414 LEU 10.97%

Now I can begin to make some tentative codon letter matches

Here are the frequencies of each letter in the Hebrew alphabet




Character

Frequency
א
6,11%
ב
4,57%
ג
1,26%
ד
2,49%
ה
10,48%
ו
10,01%
ז
1,28%
ח
2,39%
ט
1,19%
י
10,67%
ך
0,78%
כ
2,60%
ל
7,12%
ם
2,92%
מ
4,43%
ן
1,06%
נ
2,76%
ס
1,43%
ע
3,11%
ף
0,26%
פ
1,63%
ץ
0,12%
צ
1,20%
ק
2,06%
ר
5,40%
ש
4,25%
ת
4,84%
י
11,03%
ה
10,84%
ו
10,35%
ל
7,36%
א
6,32%
ר
5,59%
ת
5,00%
ב
4,73%
מ
4,58%
ש
4,39%
ע
3,22%
ם
3,02%
נ
2,85%
כ
2,69%
ד
2,58%
ח
2,47%
ק
2,13%
פ
1,68%
ס
1,48%
ז
1,32%
ג
1,30%
צ
1,24%
ט
1,23%
ן
1,09%
ך
0,81%
ף
0,27%
ץ
0,12%

Krakers
05-03-2012, 10:20 AM
Some years ago I put up a website that argued for the possibility that DNA could be translated into Hebrew.
I took it down but someone thought enough of it to put up a copy.

http://www.bibliotecapleyades.net/ciencia/occultgeneticcode/index.htm#CONTENTS

I have waited a long time to see if someone would continue on with the idea and provide additional paths
for research.

I have been reading the essays of Paardekoop, Jenkins, et al, hoping that one or more would land on the
idea of searching the human genome for messages in a human language. It's the kind of fringe idea that
leads to novels, such as:

"The Messiah Code" Michael Cordy
"The Genesis Code" John Case
"The Genesis Code" Christopher Forrest"

Such an idea might also lead to new interpretations for traditional religions or to entirely new stories that
may serve to produce new religions.

Might I suggest that one examine the alternate genetic code found in the human mitochondrial DNA. The
mitochondrial genome has some interesting structural qualities that may connect to elements within the
biblical Genesis account of human history up to the deluge. The length of that genome divided by 10 and
the number of "biblical years" from Adam to deluge seems provocative within the framework of the hidden
messages hypothesis.

regards,
Steve Krakowski

Craig.Paardekooper
05-03-2012, 05:04 PM
Dear Kraker

Please could you let me know what were the resulting matches between codons and letters that you arrived at?

Also, did you apply your alphabet to DNA using a computer program?

Krakers
05-03-2012, 10:18 PM
Dear Craig.

The following address will take you to a site that has all of my work regarding DNA and the Hebrew language.

http://www.bibliotecapleyades.net/ci...x.htm#CONTENTS

Regards,
Steve Krakowski

Richard Amiel McGough
05-03-2012, 10:36 PM
Dear Craig.

The following address will take you to a site that has all of my work regarding DNA and the Hebrew language.

http://www.bibliotecapleyades.net/ci...x.htm#CONTENTS

Regards,
Steve Krakowski
Hi Steve,

Welcome to our forum!

:welcome:

The url you posted was not copied correctly. Please try again. I'd like to see the research you have presented.

All the best,

Richard

Krakers
05-04-2012, 01:21 AM
Thanks for the welcome Richard.

The link that I put in message #159 (my original post) seems to work ok.

http://www.bibliotecapleyades.net/ciencia/occultgeneticcode/


regards,
Krakers

Craig.Paardekooper
05-07-2012, 02:35 PM
In Krakers article, Kraker makes the following matches between Amino Acid and Hebrew letters

1. Kaph = Phenylalanine
2. Pe = Leucine
3. Gimel = Isoleucine
4. Shin = Methionine
5. Beth = Valine
6. Zain = Serine
7. Daleth = Proline
8. Teth = Threonine
9. Tau = Alanine
10. He = Tyrosine
11. Aleph = Stop 1
12. Nun = Histidine
13. Tzaddi = Glutamine
14. Cheth = Asparagine
15. Ayin = Lysine
16. Yod = Aspartic Acid
17. Samekh = Glutamic Acid
18. Vau = Cysteine
19. Mem = Stop 2
20. Resh = Tryptophan
21. Lamed = Arginine
22. Qoph = Glycine

A way to test this would be to take a stretch of non-coding DNA and translate it into Hebrew using this alphabet. Then see if any Hebrew words emerge.
we could make this task easier by doing a preliminary search for the most common words in the Hebrew language.

Here are the 500 most frequent words in the Old Testament

http://www.kreuzer-siegfried.de/hilfsmittel/hebr-500-engl.pdf

So here is the experiment.

1. Take a stretch of noncoding DNA from the Human Genome

2. Translate it into Hebrew using Krakers alphabet

3. Search this string for specific words that occur with highest frequency in the Hebrew Language


This should be straight forward enough. If these Hebrew words emerge with the expected frequency then we are probably onto something.

We could formulate this as a hypothesis, such that -

"The frequency of appearance of common Hebrew words in DNA will be significantly higher than the frequency of appearance of uncommon Hebrew words, where word length is a constant."

In the following posts we will be testing Krakers alphabet by obtaining a representative strtch of non-coding human DNA, translating it into Hebrew, then searching it for 100 very common Hebrew words, then for 100 uncommon Hebrew . (Common and uncommon words will be matched on word length) - and then comparing the frequency of occurrence of both. If the hypothesis is correct, then there will be a significant difference.

Craig.Paardekooper
05-10-2012, 12:35 PM
Here is a DNA sequence that I am going to use for testing the hypothesis. The complete human genome can be found online here -

ftp://ftp.ensembl.org/pub/release-67/fasta/homo_sapiens/dna/

I chose the shortest file to download, since some of these files are very big.

These are zip files, so once you have downloaded one, you will need to unzip it.

The files are .gz files, so you will need a software tool that can unzip these files. The free software tool is Power Archiver 2011, which you can download here -

http://www.powerarchiver.com/download-powerarchiver/

Once you have installed Power Archiver, then you will be able to extract the file.

Once extraction is complete, you can view the extracted file by right-clicking on it and choosing "Open with notepad"

Anyway, here is a sample of human DNA that I will start working with for now -

>MT dna:chromosome chromosome:GRCh37:MT:1:16569:1
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT TTGGTATTTT
CGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGC ACCCTATGTC
GCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTAC GTTCAATATT
ACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGA CATAATAATA
ACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAA ATTTCCACCA
AACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA AACCCCAAAA
ACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGG CGGTATGCAC
TTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCA TACTACTAAT
CTCATCAATACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGC TAACCCCATA
CCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTA CCTCCTCAAA
GCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAAT AGGTTTGGTC
CTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGT TCCAGTGAGT
TCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGC AATGCAGCTC
AAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCT TTAGCAATAA
ACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGC CAGCCACCGC
GGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTA GATCACCCCC
TCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACA CAAAATAGAC
TACGAAAGTGGCTTTAACATATCTGAACACACAATAGCTAAGACCCAAAC TGGGATTAGA
TACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTG CTCGCCAGAA
CACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATC CCTCTAGAGG
AGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTC AGCCTATATA
CCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTAC CCACGTAAAG
ACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTT TCTACCCCAG
AAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCA GTAAACTAAG
AGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGT CACCCTCCTC
AAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGA GGAGACAAGT
CGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTA GCTTAACACA
AAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGA GCTAAACCTA
GCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTT ACCCAAATAA
AGTATAGGCGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAA GGGAAAGATG
AAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCT GCATAATGAA
TTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAAC CAGACGAGCT
ACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCAAAATAGTGGG AAGATTTATA
GGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGAT AGAATCTTAG
TTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTA ACTGTTAGTC
CAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGT AAAAAATTTA
ACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGC TCAACACCCA
CTACCTAAAAAATCCCAAACATATAACTGAACTCCTCACACCCAATTGGA CCAATCTATC
ACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAAACATTCTCCT CCGCATAAGC
CTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCCCAATATCTACA ATCAACCAAC
AAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGA AAGGTTAAAA
AAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACAT CACCTCTAGC
ATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCC GCGGTACCCT
AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTAT GAATGGCTCC
ACGAGGGTTCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCG TGAAGAGGCG
GGCATAACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTAAT GCAAACAGTA
CCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATTAAAAATTTCG GTTGGGGCGA
CCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAG TCAAAGCGAA
CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCT AGGGATAACA
GCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGA TGTTGGATCA
GGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATT AAAGTCCTAC
GTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACNTTC AAATTCCTCC
CTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCC CCGTAAATGA
TATCATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTG TTAAGATGGC
AGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAAT TCCTCTTCTT
AACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAAT CGCAATGGCA
TTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAA AGGCCCCAAC
GTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACT CTTCACCAAA
GAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCC GACCTTAGCT
CTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCT GGTCAACCTC
AACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTC AATCCTCTGA
TCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGC AGTAGCCCAA
ACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACT AATAAGTGGC
TCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACT CCTGCCATCA
TGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCG AACCCCCTTC
GACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATA CGCCGCAGGC
CCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAA CACCCTCACC
ACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTA CACAACATAT
TTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAAC AGCATACCCC
CGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACC ACTCACCCTA
GCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCC CCCTCAAACC
TAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGA GCTTAAACCC
CCTTATTTCTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAAT TCTCCGTGCC
ACCTATCACACCCCATCCTAAAGTAAGGTCAGCTAAATAAGCTATCGGGC CCATACCCCG
AAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCC GTCATCTACT
CTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTT TTTACCTGAG
TAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAA ATAAACCCTC
GTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCC ATAATCCTTC
TAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACC AATACTACCA
ATCAATACTCATCATTAATAATCATAATAGCTATAGCAATAAAACTAGGA ATAGCCCCCT
TTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGC CTGCTTCTTC
TCACATGACAAAAACTAGCCCCCATCTCAATCATATACCAAATCTCTCCC TCACTAAACG
TAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGA GGTGGATTAA
ACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATA GGATGAATAA
TAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATT TATATTATCC
TAACTACTACCGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACC CTACTACTAT
CTCGCACCTGAAACAAGCTAACATGACTAACACCCTTAATTCCATCCACC CTCCTCTCCC
TAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATC GAAGAATTCA
CAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTC CTTAACCTCT
ACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATA TCTAACAACG
TAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCC ACACTCATCG
CCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTA TAGAAATTTA
GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACT TAATTTCTGT
AACAGCTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCA GCCACTTTAA
TTAAGCTAAGCCCTTACTAGACCAATGGGACTTAAACCCACAAACACTTA GTTAACAGCT
AAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAA AAGGCGGGAG
AAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGA AAATCACCTC
GGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAAT GCTTCACTCA
GCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCT ACAAACCACA
AAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTA GGCACAGCTC
TAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGT AACGACCACA
TCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATA GTAATACCCA
TCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCC CCCGATATGG
CGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTC CTACTCCTGC
TCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTAC CCTCCCTTAG
CAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCC TTACACCTAG
CAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATC AATATAAAAC
CCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTA ATCACAGCAG
TCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTA CTAACAGACC
GCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATT CTATACCAAC
ACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCA GGCTTCGGAA
TAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGA TACATAGGTA
TGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCA CACCATATAT
TTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACC ATAATCATCG
CTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGA AGCAATATGA
AATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACC GTAGGTGGCC
TGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGAC ACGTACTACG
TTGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATC ATAGGAGGCT
TCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTAC GCCAAAATCC
ATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACAC TTTCTCGGCC
TATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACA TGAAACATCC
TATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATT TTCATGATTT
GAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCC ATAAACCTGG
AGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTA TACATAAAAT
CTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAA CCCCATGGCC
TCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTC AAAGTTAAAT
TATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTC TACAAGACGC
TACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCA TAATCATTTT
CCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAA AACTAACTAA
TACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGC CCGCCATCAT
CCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACG AGGTCAACGA
TCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACG AGTACACCGA
CTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAG AACCAGGCGA
CCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCC CCATTCGTAT
AATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAG GCTTAAAAAC
AGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGAC CGGGGGTATA
CTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCA TCGTCCTAGA
ATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAGC ACCCCCTCTA
CCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTT AAAGATTAAG
AGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTAT GGCCCACCAT
AATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATAT TAAACACAAA
CTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACA AACCCTGAGA
ACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCT AGGCCTACCC
GCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAA ATATCTCATC
AACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAA ACAAATGATA
ACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTT AATCATTTTT
ATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAAC CACCCAACTA
TCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTAT AGGCTTTCGC
TCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTAC ACCCCTTATC
CCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGC CCTGGCCGTA
CGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGG AAGCGCCACC
CTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAAT TCTAATTCTA
CTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCAC ACTTCTAGTA
AGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTAT CATATAGTAA
AACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACC TCCGGCCTAG
CCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTA ACCAACACAC
TAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAA GGCCACCACA
CACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACC TCAGAAGTTT
TTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCT ACCCCCCAAT
TAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAA GTCCCACTCC
TAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCAC CATAGTCTAA
TAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTA CTGGGTCTCT
ATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATT TCCGACGGCA
TCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTC ATTATTGGCT
CAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACA TCCAAACATC
ACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTT TGACTATTTC
TGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGT ACCGTTAACT
TCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCC TTAATTTTAA
TAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTA CCACAACTCA
ACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATA TCCCCCGCCC
GCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTA TTTGATCTAG
AAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTG CCACTAATAG
TTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTAT GAGTGACTAC
AAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAAACGAAT GATTTCGACT
CATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAAT ATTATACTAG
CATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATA TCCTCCCTAC
TATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATA ACCCTCAACA
CCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCC GCCTGCGAAG
CAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTA GACTACGTAC
ATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATAT TACTACCACT
GACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACA GCCTAATTAT
TAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTA GCTGTTCCCC
AACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCT GACTCCTACC
CCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCAC GAAAAAAACT
CTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCA CAGCCACAGA
ACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGG CTATCATCAC
CCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTAT TCTACACCCT
AGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCC TAGGCTCACT
AAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAG CCAACAACTT
AATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACG GACTCCACTT
ATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTAC TTGCCGCAGT
ACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCA ACCCCCTGAC
AAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTA TAACAAGCTC
CATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAA TCAGCCACAT
AGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCG GCGCAGTCAT
TCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAA ACTCAAACTA
CGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTC TACTCCCACT
AATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCC CCACTATTAA
CCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATA TCACTCTCCT
ACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATAT TTACCACAAC
ACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCA CACGAGAAAA
CACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACC CCGACATCAT
TACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTG AATCTGACAA
CAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAA CTCATGCCCC
CATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCA TTGGTCTTAG
GCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACAC TACTATAACC
ACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAA CCCTAACAAA
AAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTAT TATCAGTCTC
TTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAA CTGACACTGA
GCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTT CTCCATAATA
TTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACT GTGATATATA
AACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCT AATTACCATA
CTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGA GGGCGTAGGA
ATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGAGCAGATGCCAA CACAGCAGCC
ATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGC CTTAGCATGA
TTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAA CGCTAATCCA
AGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGC CCAATTAGGT
CTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGC CCTACTCCAC
TCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCC CCTAGCAGAA
AATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCAC TCTGTTCGCA
GCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTC CACTTCAAGT
CAACTAGGACTCATAATAGTTACAATCGGCATCAACCAACCACACCTAGC ATTCCTGCAC
ATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTC CATCATCCAC
AACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAAC CATACCTCTC
ACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTT CCTCACAGGT
TTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAA CGCCTGAGCC
CTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCTATAGCACTCG AATAATTCTT
CTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGA AAATAACCCC
ACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGG ATTTCTCATT
ACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTA CCTAAAACTC
ACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAA CTACCTAACC
AACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACAT ACTCGGATTC
TACCCTAGCATCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAG CCAAAACCTG
CCCCTACTCCTCCTAGACCTAACCTGACTAGAAAAGCTATTACCTAAAAC AATTTCACAG
CACCAAATCTCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAA ACTTTACTTC
CTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACC TATTCCCCCG
AGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAA CTACTACTAA
TCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAA TCAACCCTGA
CCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCA CAACCACCAC
CCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACC CCACTAAAAC
ACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAA TAGCCATCGC
TGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAA CTATTAAACC
CATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGC TAACAATCAA
TACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACC CCATTACTAA
ACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTA CAACCACGAC
CAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGA CCCCAATACG
CAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCC CCACCCCATC
CAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGA TCCTCCAAAT
CACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCG CCTTTTCATC
AATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACC TTCACGCCAA
TGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCC TATATTACGG
ATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTG CAACTATAGC
AACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAG GGGCCACAGT
AATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTC AATGAATCTG
AGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTC ACTTCATCTT
GCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACG AAACGGGATC
AAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACC CTTACTACAC
AATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACAT TAACACTATT
CTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCT TAAACACCCC
TCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCC GATCCGTCCC
TAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAG CAATAATCCC
CATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCC AATCACTTTA
TTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAAC CAGTAAGCTA
CCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAA TCCTAATCCT
AATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTC CTTGTAGTAT
AAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGG ACAAATCAGA
GAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTT AAACTATTCT
CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCA CCCATCAACA
ACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGG TACCATAAAT
ACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTC CCCATGCTTA
CAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTC CAAAGCCACC
CCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAG TACATAAAGC
CATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGG ATGACCCCCC
TCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCA CAAGAGTGCT
ACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTG TATCCGACAT
CTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCT TAAATAAGAC
ATCACGATG

Craig.Paardekooper
05-10-2012, 12:42 PM
Step 2 is to translate the nucleotide sequence into Hebrew using Krakers alphabet

1. Kaph = Phenylalanine
2. Pe = Leucine
3. Gimel = Isoleucine
4. Shin = Methionine
5. Beth = Valine
6. Zain = Serine
7. Daleth = Proline
8. Teth = Threonine
9. Tau = Alanine
10. He = Tyrosine
11. Aleph = Stop 1
12. Nun = Histidine
13. Tzaddi = Glutamine
14. Cheth = Asparagine
15. Ayin = Lysine
16. Yod = Aspartic Acid
17. Samekh = Glutamic Acid
18. Vau = Cysteine
19. Mem = Stop 2
20. Resh = Tryptophan
21. Lamed = Arginine
22. Qoph = Glycine

First I will convert the DNA sample into an aminoacid sequence
Then I will convert the amino acid sequence into Hebrew Letters
Then I will start searching for the most common Hebrew words.

(PS. It is also possible to use the BLAST program to search the entire Human Genome for a particular sequence. The BLAST program can be found here -
http://www.ensembl.org/Homo_sapiens/blastview)

Richard Amiel McGough
05-10-2012, 01:33 PM
Step 2 is to translate the nucleotide sequence into Hebrew using Krakers alphabet

1. Kaph = Phenylalanine
2. Pe = Leucine
3. Gimel = Isoleucine
4. Shin = Methionine
5. Beth = Valine
6. Zain = Serine
7. Daleth = Proline
8. Teth = Threonine
9. Tau = Alanine
10. He = Tyrosine
11. Aleph = Stop 1
12. Nun = Histidine
13. Tzaddi = Glutamine
14. Cheth = Asparagine
15. Ayin = Lysine
16. Yod = Aspartic Acid
17. Samekh = Glutamic Acid
18. Vau = Cysteine
19. Mem = Stop 2
20. Resh = Tryptophan
21. Lamed = Arginine
22. Qoph = Glycine

First I will convert the DNA sample into an aminoacid sequence
Then I will convert the amino acid sequence into Hebrew Letters
Then I will start searching for the most common Hebrew words.

(PS. It is also possible to use the BLAST program to search the entire Human Genome for a particular sequence. The BLAST program can be found here -
http://www.ensembl.org/Homo_sapiens/blastview)

Fascinating project Craig. If I can find a little time I might jump in on it. But I've got a lot on my plate right now.

duxrow
05-10-2012, 02:01 PM
:specool:
I loved the bottom line:


Imagine my shock and surprise when I discovered that these two diverse approaches to divination, one Eastern and one Western, demonstrated an enormous similarity of content; symbolic, imagistic, and conceptual - WHEN GROUPED AND ARRANGED AS THE NUCLEIC ACIDS AND AMINO ACIDS ARE GROUPED AND ARRANGED IN THE GENETIC CODE.

I couldn't shake the idea that these two symbol systems may be vehicles for the transport of two halves of what may be a textual virus - set to infect the body politic of Earth at a time when that knowledge is needed. Perhaps somewhere in the vast genetic library that is the human genome there is a clear message, in the Hebrew or a precursor language, from "The Creator(s)."

If "The Creator(s)" have a sense of humor similar to ours, maybe they would get a kick out of the idea of letting us know, at a future time when we are technologically advanced enough, just who we are and how we came to be.

Makes me wonder if He was RIBBING US all along! :winking0071:

Craig.Paardekooper
05-11-2012, 09:35 AM
I divided the sample up into codons. A typical essay contains 280 words per page. The nucleotides form 5707 codons or triplets, each presumably corresponding to a single Hebrew letter. If we take the average word length as 5 letters, then our sample would only amount to about 1100 words =about 4 x A4 sides of text (typical student essay)

To convert this nucleotide string into the aminoacids, I have written a simple program that stores each codon in an array. Then it loops through the array and uses the Genetic Code to translate that codon into an amino acid.

The result is

Asp His Arg Ser Ile Thr Leu Leu Thr Thr His Gly Ser Ser Pro Cys Leu Val Phe Val Trp Gly Val Cys Thr Arg Stop1 His Cys Glu Thr Leu Glu Pro Glu Pro Tyr Val Ser Ile Cys Leu Stop2 Phe Leu Pro His Pro Ile Ile Tyr Arg Thr Tyr Ser Ile Thr Gly Glu His Thr Tyr Stop1 Ser Val Leu Ile Asn Stop1 Cys Leu Stop1 His Asn Asn Gln Leu Asn Val Cys Thr Ala Thr Phe His Thr Asp Ile Ile Thr Lys Phe Pro Pro Pro Pro Leu Pro Arg Phe Trp Pro Gln His Leu Asn Thr Ser Leu Pro Pro Gln Thr Lys Asn Pro Asn Thr Ser Leu Thr Arg Phe Gln Ile Leu Ser Phe Arg Tyr Ala Phe Asn Ser His Pro Pro Thr Asn Thr Leu Phe Ser Pro Pro Thr Pro Thr Thr Asn His Gln Tyr Asn Pro Arg Pro Ser Tyr Pro Ala His Thr His Arg Cys Thr Pro Pro Arg Thr Asn Gln Thr Pro Lys Thr Pro Pro Thr Val Tyr Val Ala Pro Pro Gln Gln Tyr Thr Glu Asn Val Stop1 Thr Gly Ser His His Pro Ile Asn Lys Gly Leu Val Ser Leu Ser Ile Ser Ser Stop1 Stop1 Asp Tyr Thr Cys Lys His Pro Arg Gln Stop2 Ser Pro Ser Lys Ser Pro Arg Ser Lys Gly Thr Ser Ile Lys His Ala Asn Ala Ala Lys Arg Leu Ala Stop1 Pro His Pro His Gly Lys Gln Gln Stop2 Leu Thr Stop1 Gln Stop1 Glu Ser Leu Thr Lys Leu Tyr Stop1 Pro Gln Gly Trp Ser Ile Ser Cys Ala Thr Gly His Thr Ile Asn Pro Ser Gln Stop1 Lys Pro Ala Stop1 Arg Val Phe Asp His Pro Pro Gln Stop1 Ser Stop1 Asn Ser Pro Glu Leu Stop1 Lys Thr Pro Val Asp Lys Ile Asp Arg Lys Trp Leu Stop1 His Ile Stop2 Thr His Asn Ser Stop1 Asp Pro Asn Gly Leu Tyr Pro Thr Met Leu Ser Pro Lys Pro Gln Gln Leu Asn Gln Gln Asn Leu Ala Arg Thr Thr Ser His Ser Leu Lys Leu Lys Gly Pro Gly Gly Ala Ser Tyr Leu Stop1 Arg Pro Val Leu Stop1 Ser Ile Asn Pro Asp Gln Pro His His Leu Leu Leu Pro Ile Pro Pro Ser Ser Ala Asn Pro Asp Glu Gly Tyr Lys Val Ser Ala Ser Pro Arg Lys Arg Stop1 Val Lys Val Stop1 Pro Met Arg Trp Gln Glu Met Gly Tyr Ile Leu Pro Gln Asn Tyr Asp Ser Pro Tyr Glu Thr Stop1 Gly Ser Lys Val Asp Leu Ala Lys Leu Ser Arg Val Leu Ser Stop2 Thr Gly Pro Stop2 Ser Ala Tyr Thr Pro Pro His Pro Pro Ser Ile Leu Gln Arg Thr Phe Asn Stop1 Asn Pro Tyr Ala Phe Ile Stop1 Glu Thr Ser Stop1 His Gly Lys Cys Thr Gly Lys Cys Thr Trp Thr Asn Gln Ser Val Leu Thr Lys His Pro Thr Tyr Thr Stop1 Glu Ile Ser Thr Stop1 Leu Asp Arg Ser Ala Lys Pro Pro Gln Thr His Ser Thr Leu Leu Pro Asp Asn Leu Ser Gln Thr Ile Pro Lys Stop1 Tyr Arg Arg Stop1 Lys Leu Lys Pro Gly Ala Ile Asp Ile Val Pro Gln Glu Arg Lys Asn Tyr Asn Gln Ala Stop1 Tyr Ser Lys Asp Stop1 Pro Leu Tyr Leu Ala Stop1 Stop2 Stop1 Leu Glu Ile Thr Leu Gln Gly Glu Pro Lys Leu Arg Pro Pro Lys Arg Arg Ala Leu Arg Thr Ala Lys Arg Ala His Pro Ser Met Stop1 Gln Asn Ser Gly Asp Leu Gly Arg Gly Asp Lys Pro Thr Glu Pro Gly Asp Ser Trp Leu Ser Lys Arg Ile Leu Ser Thr Leu Asn Leu Pro Thr Glu Pro Ser Lys Ser Pro Cys Lys Phe Leu Leu Val Lys Arg Asn Ser Ser Leu Asp Thr Arg Lys Lys Pro Cys Arg Glu Ser Lys Ile Thr Pro Ile Val Gly Leu Lys Ala Ala Thr Asn Stop1 Glu Ser Val Gln Ser Thr Pro Tyr Leu Lys Asn Pro Lys His Ile Thr Glu Leu Leu Thr Pro Asn Trp Gln Ser Ile Pro Ile Glu Glu Leu Met Leu Val Stop1 Val Thr Stop2 Lys His Ser Pro Ala Stop1 Leu Arg Gln Ile Lys Thr Leu Asn Stop2 Gln Leu Thr Ala Gln Tyr Leu Ile Asn Gln Ser His Tyr Tyr Pro His Cys Gln Pro Asn Thr Gly Met Leu Ile Arg Arg Leu Lys Ser Lys Arg Asn Ser Ala Asn Leu Thr Pro Pro Val Tyr Gln Lys His Pro Leu Ile Thr Ser Ile Arg Gly Thr Ala Cys Pro Val Thr His Val Stop1 Arg Ala Val Pro Thr Val Gln Arg Stop1 His Asn His Leu Phe Leu Lys Stop1 Gly Pro Val Asn Gly Ser Glu Gly Ser Ala Val Ser Tyr Phe Stop1 Pro Val Lys Leu Thr Cys Pro Lys Arg Gly Ile Thr Gln Gln Asp Glu Lys Thr Leu Trp Ser Phe Asn Leu Leu Ala Asn Ser Leu Thr Asn Pro Gln Val Leu Asn Tyr Gln Thr Cys Ile Lys Asn Phe Leu Gly Arg Ser Glu Gln Asn Pro Thr Ser Glu Gln Tyr Met Leu Arg Leu His Gln Lys Ala Leu Leu Tyr Ser Ile Asp Pro Ile Thr Stop2 Pro Thr Glu Gln Val Thr Arg Asp Asn Arg Asn Pro Ile Leu Glu Ser Ile Ser Thr Ile Gly Phe Thr Thr Ser Val Gly Ser Thr Ser Arg Trp Cys Ser Arg Tyr Stop1 Arg Phe Val Cys Ser Thr Ile Ser Pro Val Ile Stop2 Val Gln Thr Gly Val Ile Gln Val Gly Phe Tyr Leu Lys Phe Leu Cys Thr Lys Gly Gln Glu Lys Stop1 Gly Leu Leu His Lys Ala Pro Ser Arg Lys Stop2 Ser Ser Gln Leu Ser Ile Ile Pro Thr Pro Thr Gln Glu Gln Gly Leu Lys Met Arg Ala Arg Stop1 Ser His Lys Thr Stop1 Asn Phe Thr Val Arg Gly Ser Ser Ser Ser Thr Thr Tyr Pro Trp Pro Thr Ser Tyr Ser Ser Leu Tyr Pro Phe Stop1 Ala Met Ala Pro Asn Ala Tyr Arg Thr Lys Asn Ser Arg Leu Tyr Thr Thr Thr Gln Ala Pro Val Val Gly Pro Tyr Gly Leu Leu Gln Pro Phe Ala Asp Ala Ile Lys Leu His Gln Ser Pro Stop1 Asn Pro Pro His Leu Pro Ser Pro Ser Thr Ser Pro Pro Thr Leu Ala His His Arg Ser Ser Thr Met Asn Pro Pro Pro His Thr Gln Pro Pro Ser Thr Asn Leu Gly Leu Leu Phe Ile Leu Ala Thr Ser Ser Leu Ala Val Tyr Asn Pro Leu Gln Gly Glu His Gln Thr Gln Thr Thr Pro Stop2 Ser Ala His Cys Glu Val Ala Gln Asn Leu Ile Stop2 Ser His Pro Ser His His Ser Thr Ile Asn Ile Thr Stop1 Val Ser Phe Asn Leu Ser Thr Leu Ile Thr Thr Gln Glu His Leu Stop2 Leu Pro Ala Ile Asp Pro Trp Pro Stop1 Tyr Asp Leu Ser Pro His Stop1 Gln Arg Pro Thr Thr Pro Phe Pro Cys Arg Arg Gly Val Arg Thr Ser Leu Arg Leu Gln His Arg Ile Pro Gln Pro Phe Ala Leu Phe Phe Ile Ala Glu Tyr Thr Asn Ile Ile Ile Ile His Pro His Leu Gln Ser Ser Stop1 Glu Gln His Met Thr His Ser Pro Leu Asn Ser Thr Thr Tyr Cys His Gln Asp Pro Thr Ser Asn Leu Pro Val Leu Met Asn Ser Asn His Thr Arg Phe Arg Tyr Asp Gln Leu Ile His Leu Leu Stop2 Lys Asn Phe Leu Thr His Pro His Tyr Leu Tyr Asp Met Ser Pro Tyr Pro Leu Gln Ser Pro Ala Phe Pro Gln Thr Arg Asn Met Ser Asp Lys Arg Val Thr Leu Ile Glu Stop1 Ile Ile Gly Leu Asn Pro Tyr Phe Stop1 Asp Tyr Glu Asn Arg Thr His Pro Stop2 Glu Ser Lys Ser Pro Cys Pro Ile Thr Pro His Pro Lys Val Arg Ser Ala Lys Stop1 Ala Ile Gly His Thr Pro Asn Val Gly Tyr Thr Leu Pro Val Leu Ile Asn Pro Leu Ala Gln Pro His Leu Leu Pro Ser Leu Gln Ala His Ser Ser Gln Arg Stop1 Ala Arg Thr Asp Phe Thr Stop2 Arg Pro Arg Asn Lys His Ala Ser Phe Tyr Ser Ser Ser Asn Gln Lys Stop1 Thr Leu Ser Thr Glu Ala Ala Ile Lys Tyr Phe Leu Thr Gln Ala Thr Ala Ser Asn Pro Stop1 Stop1 Leu Ser Ser Ser Thr Ile Tyr Ser Pro Asp Asn Glu Pro Stop1 Asn Thr Thr Ser Ile Leu Ile Ile Asn Asn His Asn Ser Tyr Ser Asn Lys Thr Arg Stop1 Pro Pro His Phe Stop2 Val Pro Glu Val Thr Gln Gly Thr Pro Leu Thr Ser Gly Ala Ser Ser His Asp Lys Asn Stop1 Pro Pro Ser Gln Ser Tyr Thr Lys Ser Leu Ser Leu Asn Lys Pro Ser Pro His Ser Leu Asn Leu Ile His His Ser Arg Gln Leu Val Asp Stop1 Gln Thr Gln Leu Arg Lys Ile Leu Ala Tyr Ser Ser Ile Thr His Ile Met Asn Stop1 Gln Phe Tyr Arg Thr Thr Leu Thr Stop1 Pro Phe Leu Ile Stop1 Leu Tyr Ile Ile Asn Tyr Tyr Arg Ile Pro Thr Thr Gln Leu Lys Leu Gln His His Asp Tyr Tyr Tyr Arg Thr Stop2 Asn Lys Leu Thr Stop2 Leu Thr Pro Leu Ile Pro Ser Thr Pro Leu Stop1 Glu Ala Cys Pro Arg Stop1 Pro Ala Phe Cys Pro Asn Gly Pro Leu Glu Glu Phe Lys Lys Gln Stop1 Pro His His Pro His His His Ser His His His Pro Leu Thr Ser Phe Tyr Leu Arg Leu Ile Tyr Ser Thr Ser Ile Thr Leu Leu Pro Ile Stop1 Gln Stop1 Lys Stop1 Asn Asp Ser Leu Asn Ile Gln Asn Pro Pro His Ser Ser Thr Leu Ile Pro Tyr His Ala Thr Pro Thr Tyr Leu Pro Phe Tyr Thr Asn Asn Leu Arg Asn Leu Leu Asn Thr Asp Gln Glu Pro Ser Lys Pro Ser Val Ser Cys Asn Thr Ile Ser Asn Ser Stop1 Gly Leu Gln Asn Pro Thr Leu His Gln Leu Asn Ala Asn Ala Thr Leu Stop1 Ala Lys Pro Leu Leu Asp Gln Trp Asp Leu Asn Pro Gln Thr Leu Leu Thr Ala Ala Pro Stop1 Ser Thr Gly Phe Asn Leu Leu Leu Pro Pro Pro Gly Lys Gly Gly Lys Pro Arg Gln Val Stop2 Ser Cys Phe Phe Glu Phe Ala Ile Gln Tyr Lys Ser Pro Glu Leu Val Lys Arg Gly Leu Thr Pro Val Phe Arg Phe Thr Val Gln Leu His Ser His Phe Thr Ser Pro Pro Leu Met Phe Ala Asp Arg Stop2 Leu Phe Ser Lys Pro Lys Thr Leu Glu His Tyr Thr Tyr Tyr Ser Ala His Glu Leu Glu Ser Gly Thr Ala Lys Pro Pro Tyr Ser Ser Arg Ala Gly Pro Ala Arg Gln Pro Ser Arg Thr Thr Thr Tyr Asn Val Ile Val Thr Ala His Ala Phe Val Ile Ile Phe Phe Ile Asn Thr Ser Stop1 Ser Glu Ala Leu Ala Thr Asp Stop1 Phe Pro Stop1 Stop1 Ser Val Pro Asp Met Val Ser Pro His Lys Gln His Lys Leu Leu Thr Leu Thr Ser Leu Ser Tyr Ser Cys Ala Ser Ala Ile Val Glu Ala Gly Ala Gly Thr Gly Stop2 Thr Val Tyr Ser Leu Gln Gly Thr Thr Pro Thr Leu Glu Pro Pro Stop1 Thr Stop1 Pro Ser Ser Leu His Leu Arg Cys Leu Leu Tyr Leu Arg Gly His Gln Phe His His Asn Asn Tyr Ile Stop1 Asn Pro Ala Ile Thr Gln Tyr Gln Thr Pro Leu Phe Val Stop2 Ser Val Leu His Ser Ser Tyr Phe Ser Tyr Leu Ser Gln Ser Stop1 Leu Leu Ala Ser Leu Tyr Leu Thr Asp Gln Pro Gln His His Leu Leu Arg Pro Arg Arg Arg Arg Arg Pro His Tyr Thr Asn Leu Phe Stop2 Phe Phe Gly His Pro Glu Val Tyr Ile Leu Ile Leu Pro Leu Arg Stop1 Ser Pro Ile Leu Stop1 Leu Thr Thr Pro Glu Lys Lys Asn His Leu Tyr Ile Gly Gly Leu Ser Tyr Asp Ile Asn Trp Leu Pro Arg Val Tyr Arg Val Ser Thr Ile Tyr Thr Val Gly Ile Asp Val Asp Thr Arg Ala Tyr Phe Thr Ser Ala Thr Asn His Leu Ser Pro Pro Ala Ser Lys Tyr Leu Ala Asp Ser Pro His Ser Thr Ser Asn Met Met Ile Cys Cys Ser Ala Leu Ser Pro Arg Ile His Leu Ser Phe His Stop1 Val Ala Thr Gly Ile Val Leu Ala Asn Ser Ser Leu Asp Ile Val Leu His Asp Val Leu Leu Stop1 Pro Thr Ser Thr Met Ser Tyr Gln Stop1 Glu Leu Tyr Leu Pro Ile Gly Gly His Ser Leu Ile Ser Pro Ile Leu Arg Leu His Pro Arg Pro Asn Leu Pro Lys Ser Phe Thr Ile Ile Phe Ile Gly Val Asn Leu Thr Phe Phe Pro Gln His Ser Arg Tyr Pro Glu Cys Pro Asp Val Thr Arg Thr Thr Pro Met His Thr Pro Stop2 Asn Ile Ile Ile Cys Arg Leu Ile His Phe Ser Asn Ser Ser Asn Ile Asn Asn Ser Stop2 Phe Glu Ala Phe Ala Ser Lys Arg Lys Val Leu Ile Val Glu Glu Pro Ser Lys Pro Ser Asp Tyr Met Asp Ala Pro His Pro Thr Thr His Ser Lys Asn Pro Tyr Ile Lys Stop1 Thr Lys Lys Glu Gly Ile Glu Pro Pro Lys Ala Gly Phe Lys Pro Pro Met Ala His Asp Phe Phe Lys Lys Val Leu Glu Lys Pro Phe His Asn Phe Val Ser Stop1 Tyr Arg Leu Asn Pro Ile Tyr Leu Asn Gly Thr Cys Ser Ala Ser Arg Tyr Lys Thr Thr Ser Pro Ile Ile Glu Glu Leu Ile Thr Phe His Asp His Ala Leu Asn His Phe Leu Ser Ala Ser Stop1 Ser Cys Met Pro Phe Ser Stop1 His Ser Gln Gln Leu Thr Tyr Stop1 His Leu Arg Arg Ser Gly Asn Arg Asn Arg Leu Asn Tyr Pro Pro Pro Ser Leu Val Leu Ile Ala Leu Pro Ser Leu Arg Ile Leu Tyr Ile Thr Asp Gly Gln Arg Pro Pro Leu Pro Ser Asn Gln Leu Ala Thr Asn Gly Thr Glu Pro Thr Tyr Thr Leu Arg Arg Thr Asn Leu Gln Leu Leu His Thr Ser Pro Ile Ile Pro Asn Gln Ala Leu Arg Leu Leu Asp Val Asp Asn Arg Val Val Leu Pro Ile Glu Ala His Ser Tyr Stop1 Leu His His Lys Thr Ser Cys Thr His Glu Leu Ser Pro His Stop1 Leu Lys Arg Cys Asn Ser Arg Thr Ser Lys Pro Asn His Phe His Arg Tyr Thr Arg Gly Tyr Tyr Gly Gln Cys Ser Glu Ile Cys Gly Ala Asn His Ser Phe Met Pro Arg Pro Arg Stop1 Phe Pro Stop1 Lys Ser Leu Lys Stop1 Gly Pro Tyr Leu Pro Tyr Ser Pro Leu Pro Pro Leu Glu Pro Thr Val Lys Leu Thr Stop1 His Stop1 Pro Phe Lys Lys Asp Stop1 Glu Pro Thr Pro Leu Tyr Ser Glu Met Pro Gln Leu Asn Thr Thr Val Ala His His Leu Pro Pro Tyr Ser Leu His Tyr Ser Ser Ser Pro Asn Stop1 Lys Tyr Asn Thr Leu Pro Pro Thr Ser Leu Thr Lys Ala His Lys Asn Lys Lys Leu Stop1 Asn Pro Glu Pro Lys Stop2 Thr Lys Ile Cys Ser Leu His Ser Leu Pro Pro Gln Ser Gly Leu Pro Arg Ser Thr Asp His Ser Ile Ser Pro Ser Ile Asp Pro His Leu Gln Ile Ser Asn Asn Arg Leu Ile Thr Thr Gln Gln Stop2 Leu Ile Lys Leu Thr Ser Thr Asn Asp Pro Tyr Thr Thr Leu Lys Asp Glu Pro Asp Leu Leu Tyr Stop1 Tyr Pro Ile Ile Phe Cys His Asn Stop1 Pro Pro Arg Thr Pro Ala Ser Leu Ile Tyr Thr Asn Pro Asn Ser Ile Asn Leu Ala Met Ala Ile Pro Leu Stop2 Ala Gly Thr Val Ile Arg Leu Ser Leu Arg Leu Lys Met Pro Stop1 Pro Thr Ser Tyr His Lys Ala His Leu Pro Leu Ile His Thr Ser Tyr Tyr Arg Asn His Gln Pro Thr His Ser Thr Asn Ser Trp Pro Arg Leu Thr Ala Asn Ile Thr Ala Gly His Leu Leu Met His Leu Ile Lys Arg His Stop1 Gln Tyr Gln Pro Leu Thr Phe Pro Leu His Leu Ser Ser Ser Gln Leu Ile Leu Asp Tyr Pro Arg Asn Arg Cys Arg Leu Asn Pro Ser Leu Arg Phe His Phe Stop1 Ser Leu Tyr Leu His Asp Asn Thr Stop1 Stop2 Pro Thr Asn His Met Pro His Ile Val Thr Gln Pro Met Thr Pro Asn Arg Gly Pro Leu Ser Pro Pro Asn Asp Pro Ala Stop1 Met Stop2 Phe His Phe His Ser Ile Thr Leu Leu Ile Leu Gly Leu Leu Gln His Stop1 Pro Tyr Thr Asn Asp Gly Ala Met Stop1 His Glu Lys Ala His Thr Gly His His Thr Thr Cys Pro Lys Arg Pro Ser Ile Arg Asp Asn Pro Ile Tyr Tyr Gln Lys Phe Phe Phe Ala Gly Phe Phe Stop2 Ala Phe Tyr His Ser Ser Leu Ala Pro Pro Pro Stop1 Glu Gly Thr Gly Pro Gln Gln Ala Ser Pro Arg Stop1 Ile Pro Stop1 Val Pro Leu Lys His Ile Arg Ile Thr Arg Ile Arg Ser Ile Asn His Leu Ser Ser Ile Val Stop1 Glu Asn Asn Arg Asn Gln Ile Ile Gln Ala Leu Leu Ile Thr Ile Leu Gly Ser Ile Leu Pro Ser Tyr Lys Pro Gln Ser Thr Ser Ser Leu Pro Ser Pro Ser Asp Gly Leu Arg Leu Asn Ile Phe Cys Ser His Arg Leu Pro Arg Thr Ser Arg Leu Leu Ala Thr Phe Leu Thr Ile Cys Phe Ile Arg Gln Leu Ile Phe His Phe Thr Gln Thr Thr Leu Ala Ser Lys Pro Pro Pro Asp Thr Gly Ile Leu Stop1 Met Trp Stop2 Leu Phe Val Cys Leu His Leu Leu Met Arg Val Leu Leu Phe Stop1 Tyr Lys Stop1 Pro Leu Thr Gln Leu Thr Ser Phe Asp Asn Ile Gln Lys Arg Val Ile Asn Phe Ala Asn Phe Stop1 Ser Thr Pro Ser Stop1 Pro Tyr Tyr Stop1 Stop1 Leu Leu His Phe Asp Pro Gln Leu Arg Leu His Arg Lys Ile His Pro Leu Arg Val Arg Leu Arg Pro Tyr Pro Pro Pro Val Pro Phe Ser Ile Lys Phe Phe Leu Val Ala Ile Thr Phe Leu Leu Stop2 Ser Lys Leu Pro Ser Phe Tyr Pro Tyr His Glu Pro Tyr Lys Gln Leu Thr Pro Leu Ile Tyr Val Ile Pro Leu Ile Asn His His Pro Ser Pro Lys Ser Gly Leu Ser Asp Tyr Lys Gly Leu Asp Stop2 Thr Glu Leu Val Tyr Ser Leu Asn Lys Thr Asn Phe Arg His Stop1 Ile Met Ile Ile Ile Phe Thr Lys Cys Pro Ser Phe Thr Stop1 Ile Ile Leu Ile Tyr His Leu Thr Ser Arg Asn Thr Ser Ile Ser Leu Thr Pro His Pro Pro Tyr Cys Leu Glu Gly Ile Ile Leu Ser Leu Phe Ile Ile Ala Thr Leu Ile Pro Gln Pro Thr Pro Ser Stop1 Pro Ile Leu Cys Leu Leu Pro Tyr Stop1 Ser Leu Ala Cys Glu Ser Gly Gly Pro Ser Pro Thr Ser Leu Asn Leu Gln His Ile Trp Pro Thr Thr Tyr Asn Leu Asn Leu Leu Gln Cys Stop1 Asn Stop1 Ser Ser Gln Gln Leu Tyr Leu Pro Asp Met Thr Phe Gln Lys Thr His Asn Leu Asn Gln His Asn His Pro Ala Stop1 Leu Ser Ile Ile Pro Leu Leu Phe Phe Asn Gln Ile Asn Asn Asn Leu Phe Leu Phe Pro Pro Phe Pro Pro Thr Pro Stop1 Gln Pro Pro Ser Stop1 Tyr Stop1 Leu Pro Leu Leu Pro His Asn His Gly Lys Pro Thr Pro Leu Ile Gln Stop2 Thr Thr Ile Glu Lys Asn Tyr Leu Ser Ile Leu Ile Ser Leu Gln Ile Ser Leu Ile Ile Thr Phe Ser His Arg Stop1 Ser Tyr Phe Ile Ser Ser Ser Lys Pro His Leu Ser Pro Pro Trp Ile Ile Pro Met Arg Gln Pro Ala Arg Thr Pro Glu Arg Arg His Ile Leu Pro Ser Thr Pro Val Gly Ser Leu Pro Leu Leu Ile Ala Leu Ile Tyr Thr His Asn Thr Arg Leu Thr Thr Phe Tyr Tyr Ser Leu Ser Leu Pro Lys Asn Tyr Gln Thr Pro Glu Asn Asn Asn Met Thr Ser Leu His Asn Ser Phe Tyr Ser Lys Asp Thr Ser Leu Asp Ser Thr Stop2 Leu Pro Lys Ala His Val Glu Ala Pro Ile Ala Gly Ser Ile Val Cys Arg Ser Ser Stop1 Asn Stop1 Ala Ala Met Val Stop1 Tyr Ala Ser His Ser Phe Ser Pro Leu Lys Thr His Ser Leu Pro Leu Pro Cys Thr Ile Pro Met Arg His Asn Stop1 Gln Ala Ile Cys Leu Arg Gln Thr Asp Leu Lys Ser Leu Ile Ala Tyr Ser Ser Gln Pro His Pro Ser Stop1 Stop1 Gln Pro Phe Ser Ser Lys Pro Pro Glu Ala Ser Pro Ala Val Ser His Asn Arg Pro Arg Ala Tyr Ile Leu Ile Thr Ile Leu Pro Ser Thr Gln Thr Glu Arg Thr His Ser Arg Ile Ile Ile Leu Ser Gln Gly Leu Gln Thr Thr Pro Thr Stop1 Leu Phe Asp Asp Phe Stop1 Gln Ala Ser Leu Thr Ser Pro Tyr Pro Thr Ile Pro Thr Gly Arg Thr Leu Cys Ala Ser Asn His Val Leu Leu Ile Lys Ser Leu Ser Leu Thr Gly Leu Asn Ile Leu Val Thr Ala Leu Tyr Ser Leu Tyr Ile Tyr His Asn Asn Gly Ala His Ser Pro Thr Thr Leu Thr Thr Stop1 Asn Pro His Ser Arg Glu His Pro His Val His Thr Pro Ile Pro His Ser Pro Pro Ile Pro Gln Pro Thr Ser Thr Gly Phe Ser Ser Cys Lys Tyr Ser Leu Thr Lys Thr Ser Asp Cys Ile Stop2 Gln Glu Ala Tyr Asp Pro Leu Phe Thr Glu Lys Ala His Lys Asn Cys Stop1 His Ala His Val Stop1 Gln His Gly Phe Leu Asn Phe Stop1 Arg Ile Thr Ala Ile Leu Val Leu Pro Gln Lys Phe Trp Cys Asn Ser Lys Stop1 Lys Stop1 Stop1 Pro Cys Thr Thr Ile Thr Pro Asn Pro Asp Phe Pro Asn Ser Pro His Pro Tyr His Pro Arg Stop1 Leu Thr Lys Asn Ser Tyr Pro His Tyr Val Lys Ser Ile Val Ala Ser Thr Phe Tyr Gln Ser Ser Pro Gln Gln Tyr Ser Cys Ala Stop1 Thr Lys Lys Leu Leu Ser Arg Stop2 His Stop2 His Asn Pro Asn Asn Pro Ala Leu Pro Lys Leu Gln Thr Arg Leu Leu Pro Stop1 Phe Ile Pro Val Ala Leu Phe Val Thr Trp Ser Ile Ile Glu Phe Ser Val Ile Tyr Thr Gln Thr Gln Thr Leu Ile Ser Ser Ser Asn Ile Tyr Ser Ser Ser Ile Thr Ile Asn Leu Ser Tyr Arg Stop1 Gln Pro Ile Pro Thr Val His Arg Leu Arg Ala Stop1 Ile Ile Ser Phe Leu Leu Ile Ser Stop2 Stop2 Tyr Ala Arg Ala Asp Ala His Ser Ser Phe Lys Gln Ser Tyr Thr Thr Val Ser Ala Ile Ser Val Ser Ser Ser Leu Ala Stop2 Tyr Pro Thr Leu Gln Leu Met Arg Pro Thr Thr Asn Ser Pro Ser Lys Leu Ile Ser Leu Thr Pro Leu Leu Gly Leu Leu Leu Ala Ala Ala Gly Lys Ser Pro Ile Arg Ser Thr Pro Asp Ser Pro Gln Pro Stop1 Lys Ala Pro Pro Gln Ser Gln Leu Leu His Lys His Tyr Ser Cys Ser Arg Asn Leu Leu Thr His Pro Leu Pro Pro Stop1 Gln Asn Ser Pro Leu Ile Gln Thr Leu Thr Leu Cys Leu Gly Ala Ile Thr Ser Val Arg Gln Ser Ala Pro Leu His Lys Met Thr Ser Lys Lys Ser Stop1 Pro Ser Thr Ser Ser Thr Arg Thr His Asn Ser Tyr Asn Arg His Gln Pro Thr Thr Pro Ser Ser Cys Ile Cys Thr His Ala Phe Phe Lys Ala Ile Leu Phe Met Cys Ser Gly His His Pro Thr Leu Thr Met Asn Lys Ile Phe Glu Lys Stop1 Glu Asp Tyr Ser Lys Ile Pro Leu Phe Asn Leu Pro His His Trp Gln Pro Ser Ile Ser Arg Asn Thr Phe Ser Gln Phe Tyr Ser Lys Asp His Ile Ile Glu Thr Ala Asn Ile Ser Tyr Thr Arg Leu Ser Tyr Leu Leu Leu Ser Ser Leu Pro Pro Stop2 Gln Ala Pro Ile Ala Leu Ile Ile Leu His Pro Asn Arg Ser Thr Ser Leu Pro His Pro Tyr Stop1 His Stop1 Arg Ile Thr Thr Leu Leu Asn Pro Ile Lys Arg Leu Ala Ala Gly Ser Leu Phe Ala Ile Ser His Leu Thr Thr Phe Pro Pro His Pro Pro Ser Lys Gln Gln Ser Pro Ser Leu Lys Leu Ser Pro Arg Cys His Phe Pro Arg Thr Ser Asn Ser Pro Arg Pro Gln Thr Stop1 Asn Lys Leu Lys Ile Lys Ser Pro Leu Cys Thr Phe Tyr Phe Ser Asn Thr Arg Ile Thr Leu Ala Ser His Thr Ala Gln Ser Pro Ile Stop1 Ala Phe Leu Arg Gln Asn Leu Pro Thr Pro Pro Arg Pro Asn Leu Thr Arg Lys Ala Ile Thr Stop1 Asn Phe His His Gln Ile Ser Thr Ser Ile Ile Thr Ser Thr Gln Lys Gly Ile Ile Thr Leu Leu Ser Leu Ser Ser Ser His Ser Ser Stop1 Pro Tyr Ser Stop1 Ser His Asn Ile Pro Pro Gln Ser Gln Leu Gln Tyr Ile His Gln Gln Thr Met Phe Asn Gln Stop1 Thr Thr Ser Thr Pro Ile Ile Ile Gln Ser Pro Arg Thr Asn Arg Ile Leu Pro Ser Thr Leu Pro Ser Pro Ser Stop1 Ile Ile Gln Leu Pro Thr Leu Leu Lys Phe Thr Asn His His His His Thr Leu Ser Pro Thr Ala Pro Ile Leu Pro Pro Ser Leu Thr Thr Lys Thr His Gln Asp Leu Asn Pro Stop2 Pro Pro Cys Leu Arg Ile Leu Leu Stop1 Pro Ser Val Val Tyr Pro Lys Thr Thr Ile Ile Pro Pro Lys Stop1 Ile Lys Lys Tyr Stop1 Thr Tyr Asn Leu Pro Gln Asn Ser Glu Stop1 Stop1 His Thr Arg Pro His Arg Thr Ile Tyr Stop1 Thr Pro Ile Asn Arg Arg Arg Leu Arg Arg Lys Pro His Lys Pro Leu Leu Pro Thr Leu Asn Arg Asn Lys Ala Tyr Ile Ile Ile Leu Ala Arg Thr Asn His Asp Met Ile Stop2 Lys Thr Ile Val Val Phe Gln Leu Gln Glu His Gln Stop2 Pro Ile Gln Asn Stop1 Pro Pro Asn Lys Ile Asn Stop1 Pro Leu Ile His Arg Pro Pro Pro His Asn Ile Ser Ala Stop2 Stop2 Asn Phe Gly Ser Leu Leu Gly Ala Cys Leu Pro Pro Asn Pro Gln Asp Tyr Ser Stop1 Pro Cys Thr Thr His Gln Thr Pro Gln Pro Phe Ser Asn Arg Pro His His Ser Arg Arg Lys Leu Trp Leu Asn His Pro Leu Phe Thr Pro Gly Ala Ser Ile Phe Phe Ile Cys Leu Phe Leu His Ile Gly Arg Gly Ile Leu Arg His Phe Ser Thr Gln Lys Pro Glu Thr Ser Ala Leu Ser Ser Cys Leu Thr Ile Asn Ser Leu His Arg Leu Cys Pro Pro Val Arg Pro Asn Ile Ile Leu Gly Pro Gln Ile Thr Asn Leu Leu Ser Ala Ile Pro Tyr Ile Gly Thr Asp Leu Val Met Asn Leu Glu Ala Thr Gln Stop1 Thr Val Pro Pro Ser His Asp Ser Leu Pro Phe Phe Ile Ala Leu His Tyr Cys Ser Pro Ser Asn Thr Pro Pro Pro Ile Leu Ala Lys Arg Asp Asn Asn Pro Leu Gly Ile Thr Ser His Ser Asp Lys Ile Thr Phe His Leu Leu His Ser Lys Thr Pro Ser Ala Tyr Phe Ser Ser Phe Ser Pro Stop1 Stop2 His Thr Leu Leu Thr Arg Pro Pro Arg Arg Pro Arg Gln Leu Tyr Pro Ser Gln Pro Stop1 Thr Pro Pro His Ile Lys Pro Glu Stop2 Tyr Phe Leu Phe Ala Tyr Thr Ile Leu Ile Arg Pro Thr Asn Stop1 Glu Ala Ser Leu Pro Tyr Tyr Tyr Pro Ser Ser Ser Stop1 Ile Ile His Pro Pro Tyr Ile Gln Thr Thr Lys His Asn Ile Ser Pro Thr Lys Asn His Phe Stop2 Leu Leu Ala Ala Asp Leu Leu Ile Leu Thr Stop2 Ile Gly Gly Gln Ser Lys Leu Leu Leu Pro Ser Leu Asp Lys Stop1 His Pro Tyr Tyr Thr Ser Gln Gln Leu Ile Asn Thr Asn Tyr Leu Pro Asn Stop2 Lys Gln Asn Thr Gln Met Gly Leu Leu Val Val Asn Stop1 Tyr Thr Ser Leu Val Asn Arg Arg Stop2 Lys Pro Phe Ser Lys Gln Ile Arg Lys Ser Leu Stop1 Leu His His Stop1 His Pro Lys Leu Arg Phe Stop1 Phe Thr Ile Leu Phe Phe His Gly Glu Ala Asp Leu Gly Thr Thr Gln Val Leu Thr Pro Ile Asn Pro Leu Cys Ile Ser Tyr Ile Thr Ala Ser His His Glu Tyr Cys Thr Thr Ile Asn Leu Thr Thr Cys Ser Thr Stop1 Lys Pro Asn Pro His Gln Asn Pro Leu His Ala Gln Ala Ser Thr Ala Ile Asn Pro Gln Leu Ser His Ile Asn Cys Asn Gln Ser His Leu Thr His Stop1 Asp Thr Asn Lys Pro Thr His Pro Stop1 Gln Tyr Ile Thr Stop1 Ser Phe Thr Val His Ser Thr Leu Gln Ser Asn Pro Phe Ser Ser Pro Trp Asp Pro Ser Asp Arg Gly Pro Leu Thr Thr Ile Leu Arg Glu Ile Asn Ile Pro Gln Glu Cys Leu Ser Ser Leu Arg Ala His Asn Thr Trp Gly Stop1 Leu Lys Stop2 Thr Ile Arg His Gly Ser Tyr Phe Arg Val Ile Lys Pro Lys Stop1 Pro Thr Arg Ser Pro Asn Lys Ile Thr Met

Krakers
05-11-2012, 09:40 AM
:specool:
I loved the bottom line:



Makes me wonder if He was RIBBING US all along! :winking0071:



Bob, it is right that you should wonder. It is fair to say that my approach to this idea is one of "seriously playing" as distinct from "playing seriously". I remember when I first spoke aloud about this idea.
I was sitting with a bunch of my friends (an eclectic group of artists, engineers, seekers and believers) in our favorite restaurant and we were playing the game of "what's new with you?" When it was my turn I said, "I'm trying to translate DNA into Hebrew." Silence and quizzical looks, then laughter and friendly ribbing and jokes and then... ideas. Lively and productive conversation ensued all concerned with providing the best possible punch-line for the straight-line, "I'm trying to translate DNA into Hebrew."

Regards,
Krakers

Craig.Paardekooper
05-11-2012, 10:31 AM
Here is the Hebrew resulting from the translation of DNA into Hebrew using Krakers alphabet

Yod Nun Lamed Zain Gimel Teth Pe Pe Teth Teth Nun Qoph Zain Zain Daleth Vau Pe Beth Kaph Beth Resh Qoph Beth Vau Teth Lamed Aleph Nun Vau Samekh Teth Pe Samekh Daleth Samekh Daleth He Beth Zain Gimel Vau Pe Mem Kaph Pe Daleth Nun Daleth Gimel Gimel He Lamed Teth He Zain Gimel Teth Qoph Samekh Nun Teth He Aleph Zain Beth Pe Gimel Cheth Aleph Vau Pe Aleph Nun Cheth Cheth Tzaddi Pe Cheth Beth Vau Teth Tau Teth Kaph Nun Teth Yod Gimel Gimel Teth Ayin Kaph Daleth Daleth Daleth Daleth Pe Daleth Lamed Kaph Resh Daleth Tzaddi Nun Pe Cheth Teth Zain Pe Daleth Daleth Tzaddi Teth Ayin Cheth Daleth Cheth Teth Zain Pe Teth Lamed Kaph Tzaddi Gimel Pe Zain Kaph Lamed He Tau Kaph Cheth Zain Nun Daleth Daleth Teth Cheth Teth Pe Kaph Zain Daleth Daleth Teth Daleth Teth Teth Cheth Nun Tzaddi He Cheth Daleth Lamed Daleth Zain He Daleth Tau Nun Teth Nun Lamed Vau Teth Daleth Daleth Lamed Teth Cheth Tzaddi Teth Daleth Ayin Teth Daleth Daleth Teth Beth He Beth Tau Daleth Daleth Tzaddi Tzaddi He Teth Samekh Cheth Beth Aleph Teth Qoph Zain Nun Nun Daleth Gimel Cheth Ayin Qoph Pe Beth Zain Pe Zain Gimel Zain Zain Aleph Aleph Yod He Teth Vau Ayin Nun Daleth Lamed Tzaddi Mem Zain Daleth Zain Ayin Zain Daleth Lamed Zain Ayin Qoph Teth Zain Gimel Ayin Nun Tau Cheth Tau Tau Ayin Lamed Pe Tau Aleph Daleth Nun Daleth Nun Qoph Ayin Tzaddi Tzaddi Mem Pe Teth Aleph Tzaddi Aleph Samekh Zain Pe Teth Ayin Pe He Aleph Daleth Tzaddi Qoph Resh Zain Gimel Zain Vau Tau Teth Qoph Nun Teth Gimel Cheth Daleth Zain Tzaddi Aleph Ayin Daleth Tau Aleph Lamed Beth Kaph Yod Nun Daleth Daleth Tzaddi Aleph Zain Aleph Cheth Zain Daleth Samekh Pe Aleph Ayin Teth Daleth Beth Yod Ayin Gimel Yod Lamed Ayin Resh Pe Aleph Nun Gimel Mem Teth Nun Cheth Zain Aleph Yod Daleth Cheth Qoph Pe He Daleth Teth Shin Pe Zain Daleth Ayin Daleth Tzaddi Tzaddi Pe Cheth Tzaddi Tzaddi Cheth Pe Tau Lamed Teth Teth Zain Nun Zain Pe Ayin Pe Ayin Qoph Daleth Qoph Qoph Tau Zain He Pe Aleph Lamed Daleth Beth Pe Aleph Zain Gimel Cheth Daleth Yod Tzaddi Daleth Nun Nun Pe Pe Pe Daleth Gimel Daleth Daleth Zain Zain Tau Cheth Daleth Yod Samekh Qoph He Ayin Beth Zain Tau Zain Daleth Lamed Ayin Lamed Aleph Beth Ayin Beth Aleph Daleth Shin Lamed Resh Tzaddi Samekh Shin Qoph He Gimel Pe Daleth Tzaddi Cheth He Yod Zain Daleth He Samekh Teth Aleph Qoph Zain Ayin Beth Yod Pe Tau Ayin Pe Zain Lamed Beth Pe Zain Mem Teth Qoph Daleth Mem Zain Tau He Teth Daleth Daleth Nun Daleth Daleth Zain Gimel Pe Tzaddi Lamed Teth Kaph Cheth Aleph Cheth Daleth He Tau Kaph Gimel Aleph Samekh Teth Zain Aleph Nun Qoph Ayin Vau Teth Qoph Ayin Vau Teth Resh Teth Cheth Tzaddi Zain Beth Pe Teth Ayin Nun Daleth Teth He Teth Aleph Samekh Gimel Zain Teth Aleph Pe Yod Lamed Zain Tau Ayin Daleth Daleth Tzaddi Teth Nun Zain Teth Pe Pe Daleth Yod Cheth Pe Zain Tzaddi Teth Gimel Daleth Ayin Aleph He Lamed Lamed Aleph Ayin Pe Ayin Daleth Qoph Tau Gimel Yod Gimel Beth Daleth Tzaddi Samekh Lamed Ayin Cheth He Cheth Tzaddi Tau Aleph He Zain Ayin Yod Aleph Daleth Pe He Pe Tau Aleph Mem Aleph Pe Samekh Gimel Teth Pe Tzaddi Qoph Samekh Daleth Ayin Pe Lamed Daleth Daleth Ayin Lamed Lamed Tau Pe Lamed Teth Tau Ayin Lamed Tau Nun Daleth Zain Shin Aleph Tzaddi Cheth Zain Qoph Yod Pe Qoph Lamed Qoph Yod Ayin Daleth Teth Samekh Daleth Qoph Yod Zain Resh Pe Zain Ayin Lamed Gimel Pe Zain Teth Pe Cheth Pe Daleth Teth Samekh Daleth Zain Ayin Zain Daleth Vau Ayin Kaph Pe Pe Beth Ayin Lamed Cheth Zain Zain Pe Yod Teth Lamed Ayin Ayin Daleth Vau Lamed Samekh Zain Ayin Gimel Teth Daleth Gimel Beth Qoph Pe Ayin Tau Tau Teth Cheth Aleph Samekh Zain Beth Tzaddi Zain Teth Daleth He Pe Ayin Cheth Daleth Ayin Nun Gimel Teth Samekh Pe Pe Teth Daleth Cheth Resh Tzaddi Zain Gimel Daleth Gimel Samekh Samekh Pe Shin Pe Beth Aleph Beth Teth Mem Ayin Nun Zain Daleth Tau Aleph Pe Lamed Tzaddi Gimel Ayin Teth Pe Cheth Mem Tzaddi Pe Teth Tau Tzaddi He Pe Gimel Cheth Tzaddi Zain Nun He He Daleth Nun Vau Tzaddi Daleth Cheth Teth Qoph Shin Pe Gimel Lamed Lamed Pe Ayin Zain Ayin Lamed Cheth Zain Tau Cheth Pe Teth Daleth Daleth Beth He Tzaddi Ayin Nun Daleth Pe Gimel Teth Zain Gimel Lamed Qoph Teth Tau Vau Daleth Beth Teth Nun Beth Aleph Lamed Tau Beth Daleth Teth Beth Tzaddi Lamed Aleph Nun Cheth Nun Pe Kaph Pe Ayin Aleph Qoph Daleth Beth Cheth Qoph Zain Samekh Qoph Zain Tau Beth Zain He Kaph Aleph Daleth Beth Ayin Pe Teth Vau Daleth Ayin Lamed Qoph Gimel Teth Tzaddi Tzaddi Yod Samekh Ayin Teth Pe Resh Zain Kaph Cheth Pe Pe Tau Cheth Zain Pe Teth Cheth Daleth Tzaddi Beth Pe Cheth He Tzaddi Teth Vau Gimel Ayin Cheth Kaph Pe Qoph Lamed Zain Samekh Tzaddi Cheth Daleth Teth Zain Samekh Tzaddi He Shin Pe Lamed Pe Nun Tzaddi Ayin Tau Pe Pe He Zain Gimel Yod Daleth Gimel Teth Mem Daleth Teth Samekh Tzaddi Beth Teth Lamed Yod Cheth Lamed Cheth Daleth Gimel Pe Samekh Zain Gimel Zain Teth Gimel Qoph Kaph Teth Teth Zain Beth Qoph Zain Teth Zain Lamed Resh Vau Zain Lamed He Aleph Lamed Kaph Beth Vau Zain Teth Gimel Zain Daleth Beth Gimel Mem Beth Tzaddi Teth Qoph Beth Gimel Tzaddi Beth Qoph Kaph He Pe Ayin Kaph Pe Vau Teth Ayin Qoph Tzaddi Samekh Ayin Aleph Qoph Pe Pe Nun Ayin Tau Daleth Zain Lamed Ayin Mem Zain Zain Tzaddi Pe Zain Gimel Gimel Daleth Teth Daleth Teth Tzaddi Samekh Tzaddi Qoph Pe Ayin Shin Lamed Tau Lamed Aleph Zain Nun Ayin Teth Aleph Cheth Kaph Teth Beth Lamed Qoph Zain Zain Zain Zain Teth Teth He Daleth Resh Daleth Teth Zain He Zain Zain Pe He Daleth Kaph Aleph Tau Shin Tau Daleth Cheth Tau He Lamed Teth Ayin Cheth Zain Lamed Pe He Teth Teth Teth Tzaddi Tau Daleth Beth Beth Qoph Daleth He Qoph Pe Pe Tzaddi Daleth Kaph Tau Yod Tau Gimel Ayin Pe Nun Tzaddi Zain Daleth Aleph Cheth Daleth Daleth Nun Pe Daleth Zain Daleth Zain Teth Zain Daleth Daleth Teth Pe Tau Nun Nun Lamed Zain Zain Teth Shin Cheth Daleth Daleth Daleth Nun Teth Tzaddi Daleth Daleth Zain Teth Cheth Pe Qoph Pe Pe Kaph Gimel Pe Tau Teth Zain Zain Pe Tau Beth He Cheth Daleth Pe Tzaddi Qoph Samekh Nun Tzaddi Teth Tzaddi Teth Teth Daleth Mem Zain Tau Nun Vau Samekh Beth Tau Tzaddi Cheth Pe Gimel Mem Zain Nun Daleth Zain Nun Nun Zain Teth Gimel Cheth Gimel Teth Aleph Beth Zain Kaph Cheth Pe Zain Teth Pe Gimel Teth Teth Tzaddi Samekh Nun Pe Mem Pe Daleth Tau Gimel Yod Daleth Resh Daleth Aleph He Yod Pe Zain Daleth Nun Aleph Tzaddi Lamed Daleth Teth Teth Daleth Kaph Daleth Vau Lamed Lamed Qoph Beth Lamed Teth Zain Pe Lamed Pe Tzaddi Nun Lamed Gimel Daleth Tzaddi Daleth Kaph Tau Pe Kaph Kaph Gimel Tau Samekh He Teth Cheth Gimel Gimel Gimel Gimel Nun Daleth Nun Pe Tzaddi Zain Zain Aleph Samekh Tzaddi Nun Shin Teth Nun Zain Daleth Pe Cheth Zain Teth Teth He Vau Nun Tzaddi Yod Daleth Teth Zain Cheth Pe Daleth Beth Pe Shin Cheth Zain Cheth Nun Teth Lamed Kaph Lamed He Yod Tzaddi Pe Gimel Nun Pe Pe Mem Ayin Cheth Kaph Pe Teth Nun Daleth Nun He Pe He Yod Shin Zain Daleth He Daleth Pe Tzaddi Zain Daleth Tau Kaph Daleth Tzaddi Teth Lamed Cheth Shin Zain Yod Ayin Lamed Beth Teth Pe Gimel Samekh Aleph Gimel Gimel Qoph Pe Cheth Daleth He Kaph Aleph Yod He Samekh Cheth Lamed Teth Nun Daleth Mem Samekh Zain Ayin Zain Daleth Vau Daleth Gimel Teth Daleth Nun Daleth Ayin Beth Lamed Zain Tau Ayin Aleph Tau Gimel Qoph Nun Teth Daleth Cheth Beth Qoph He Teth Pe Daleth Beth Pe Gimel Cheth Daleth Pe Tau Tzaddi Daleth Nun Pe Pe Daleth Zain Pe Tzaddi Tau Nun Zain Zain Tzaddi Lamed Aleph Tau Lamed Teth Yod Kaph Teth Mem Lamed Daleth Lamed Cheth Ayin Nun Tau Zain Kaph He Zain Zain Zain Cheth Tzaddi Ayin Aleph Teth Pe Zain Teth Samekh Tau Tau Gimel Ayin He Kaph Pe Teth Tzaddi Tau Teth Tau Zain Cheth Daleth Aleph Aleph Pe Zain Zain Zain Teth Gimel He Zain Daleth Yod Cheth Samekh Daleth Aleph Cheth Teth Teth Zain Gimel Pe Gimel Gimel Cheth Cheth Nun Cheth Zain He Zain Cheth Ayin Teth Lamed Aleph Daleth Daleth Nun Kaph Mem Beth Daleth Samekh Beth Teth Tzaddi Qoph Teth Daleth Pe Teth Zain Qoph Tau Zain Zain Nun Yod Ayin Cheth Aleph Daleth Daleth Zain Tzaddi Zain He Teth Ayin Zain Pe Zain Pe Cheth Ayin Daleth Zain Daleth Nun Zain Pe Cheth Pe Gimel Nun Nun Zain Lamed Tzaddi Pe Beth Yod Aleph Tzaddi Teth Tzaddi Pe Lamed Ayin Gimel Pe Tau He Zain Zain Gimel Teth Nun Gimel Shin Cheth Aleph Tzaddi Kaph He Lamed Teth Teth Pe Teth Aleph Daleth Kaph Pe Gimel Aleph Pe He Gimel Gimel Cheth He He Lamed Gimel Daleth Teth Teth Tzaddi Pe Ayin Pe Tzaddi Nun Nun Yod He He He Lamed Teth Mem Cheth Ayin Pe Teth Mem Pe Teth Daleth Pe Gimel Daleth Zain Teth Daleth Pe Aleph Samekh Tau Vau Daleth Lamed Aleph Daleth Tau Kaph Vau Daleth Cheth Qoph Daleth Pe Samekh Samekh Kaph Ayin Ayin Tzaddi Aleph Daleth Nun Nun Daleth Nun Nun Nun Zain Nun Nun Nun Daleth Pe Teth Zain Kaph He Pe Lamed Pe Gimel He Zain Teth Zain Gimel Teth Pe Pe Daleth Gimel Aleph Tzaddi Aleph Ayin Aleph Cheth Yod Zain Pe Cheth Gimel Tzaddi Cheth Daleth Daleth Nun Zain Zain Teth Pe Gimel Daleth He Nun Tau Teth Daleth Teth He Pe Daleth Kaph He Teth Cheth Cheth Pe Lamed Cheth Pe Pe Cheth Teth Yod Tzaddi Samekh Daleth Zain Ayin Daleth Zain Beth Zain Vau Cheth Teth Gimel Zain Cheth Zain Aleph Qoph Pe Tzaddi Cheth Daleth Teth Pe Nun Tzaddi Pe Cheth Tau Cheth Tau Teth Pe Aleph Tau Ayin Daleth Pe Pe Yod Tzaddi Resh Yod Pe Cheth Daleth Tzaddi Teth Pe Pe Teth Tau Tau Daleth Aleph Zain Teth Qoph Kaph Cheth Pe Pe Pe Daleth Daleth Daleth Qoph Ayin Qoph Qoph Ayin Daleth Lamed Tzaddi Beth Mem Zain Vau Kaph Kaph Samekh Kaph Tau Gimel Tzaddi He Ayin Zain Daleth Samekh Pe Beth Ayin Lamed Qoph Pe Teth Daleth Beth Kaph Lamed Kaph Teth Beth Tzaddi Pe Nun Zain Nun Kaph Teth Zain Daleth Daleth Pe Shin Kaph Tau Yod Lamed Mem Pe Kaph Zain Ayin Daleth Ayin Teth Pe Samekh Nun He Teth He He Zain Tau Nun Samekh Pe Samekh Zain Qoph Teth Tau Ayin Daleth Daleth He Zain Zain Lamed Tau Qoph Daleth Tau Lamed Tzaddi Daleth Zain Lamed Teth Teth Teth He Cheth Beth Gimel Beth Teth Tau Nun Tau Kaph Beth Gimel Gimel Kaph Kaph Gimel Cheth Teth Zain Aleph Zain Samekh Tau Pe Tau Teth Yod Aleph Kaph Daleth Aleph Aleph Zain Beth Daleth Yod Shin Beth Zain Daleth Nun Ayin Tzaddi Nun Ayin Pe Pe Teth Pe Teth Zain Pe Zain He Zain Vau Tau Zain Tau Gimel Beth Samekh Tau Qoph Tau Qoph Teth Qoph Mem Teth Beth He Zain Pe Tzaddi Qoph Teth Teth Daleth Teth Pe Samekh Daleth Daleth Aleph Teth Aleph Daleth Zain Zain Pe Nun Pe Lamed Vau Pe Pe He Pe Lamed Qoph Nun Tzaddi Kaph Nun Nun Cheth Cheth He Gimel Aleph Cheth Daleth Tau Gimel Teth Tzaddi He Tzaddi Teth Daleth Pe Kaph Beth Mem Zain Beth Pe Nun Zain Zain He Kaph Zain He Pe Zain Tzaddi Zain Aleph Pe Pe Tau Zain Pe He Pe Teth Yod Tzaddi Daleth Tzaddi Nun Nun Pe Pe Lamed Daleth Lamed Lamed Lamed Lamed Lamed Daleth Nun He Teth Cheth Pe Kaph Mem Kaph Kaph Qoph Nun Daleth Samekh Beth He Gimel Pe Gimel Pe Daleth Pe Lamed Aleph Zain Daleth Gimel Pe Aleph Pe Teth Teth Daleth Samekh Ayin Ayin Cheth Nun Pe He Gimel Qoph Qoph Pe Zain He Yod Gimel Cheth Resh Pe Daleth Lamed Beth He Lamed Beth Zain Teth Gimel He Teth Beth Qoph Gimel Yod Beth Yod Teth Lamed Tau He Kaph Teth Zain Tau Teth Cheth Nun Pe Zain Daleth Daleth Tau Zain Ayin He Pe Tau Yod Zain Daleth Nun Zain Teth Zain Cheth Shin Shin Gimel Vau Vau Zain Tau Pe Zain Daleth Lamed Gimel Nun Pe Zain Kaph Nun Aleph Beth Tau Teth Qoph Gimel Beth Pe Tau Cheth Zain Zain Pe Yod Gimel Beth Pe Nun Yod Beth Pe Pe Aleph Daleth Teth Zain Teth Shin Zain He Tzaddi Aleph Samekh Pe He Pe Daleth Gimel Qoph Qoph Nun Zain Pe Gimel Zain Daleth Gimel Pe Lamed Pe Nun Daleth Lamed Daleth Cheth Pe Daleth Ayin Zain Kaph Teth Gimel Gimel Kaph Gimel Qoph Beth Cheth Pe Teth Kaph Kaph Daleth Tzaddi Nun Zain Lamed He Daleth Samekh Vau Daleth Yod Beth Teth Lamed Teth Teth Daleth Shin Nun Teth Daleth Mem Cheth Gimel Gimel Gimel Vau Lamed Pe Gimel Nun Kaph Zain Cheth Zain Zain Cheth Gimel Cheth Cheth Zain Mem Kaph Samekh Tau Kaph Tau Zain Ayin Lamed Ayin Beth Pe Gimel Beth Samekh Samekh Daleth Zain Ayin Daleth Zain Yod He Shin Yod Tau Daleth Nun Daleth Teth Teth Nun Zain Ayin Cheth Daleth He Gimel Ayin Aleph Teth Ayin Ayin Samekh Qoph Gimel Samekh Daleth Daleth Ayin Tau Qoph Kaph Ayin Daleth Daleth Shin Tau Nun Yod Kaph Kaph Ayin Ayin Beth Pe Samekh Ayin Daleth Kaph Nun Cheth Kaph Beth Zain Aleph He Lamed Pe Cheth Daleth Gimel He Pe Cheth Qoph Teth Vau Zain Tau Zain Lamed He Ayin Teth Teth Zain Daleth Gimel Gimel Samekh Samekh Pe Gimel Teth Kaph Nun Yod Nun Tau Pe Cheth Nun Kaph Pe Zain Tau Zain Aleph Zain Vau Shin Daleth Kaph Zain Aleph Nun Zain Tzaddi Tzaddi Pe Teth He Aleph Nun Pe Lamed Lamed Zain Qoph Cheth Lamed Cheth Lamed Pe Cheth He Daleth Daleth Daleth Zain Pe Beth Pe Gimel Tau Pe Daleth Zain Pe Lamed Gimel Pe He Gimel Teth Yod Qoph Tzaddi Lamed Daleth Daleth Pe Daleth Zain Cheth Tzaddi Pe Tau Teth Cheth Qoph Teth Samekh Daleth Teth He Teth Pe Lamed Lamed Teth Cheth Pe Tzaddi Pe Pe Nun Teth Zain Daleth Gimel Gimel Daleth Cheth Tzaddi Tau Pe Lamed Pe Pe Yod Beth Yod Cheth Lamed Beth Beth Pe Daleth Gimel Samekh Tau Nun Zain He Aleph Pe Nun Nun Ayin Teth Zain Vau Teth Nun Samekh Pe Zain Daleth Nun Aleph Pe Ayin Lamed Vau Cheth Zain Lamed Teth Zain Ayin Daleth Cheth Nun Kaph Nun Lamed He Teth Lamed Qoph He He Qoph Tzaddi Vau Zain Samekh Gimel Vau Qoph Tau Cheth Nun Zain Kaph Shin Daleth Lamed Daleth Lamed Aleph Kaph Daleth Aleph Ayin Zain Pe Ayin Aleph Qoph Daleth He Pe Daleth He Zain Daleth Pe Daleth Daleth Pe Samekh Daleth Teth Beth Ayin Pe Teth Aleph Nun Aleph Daleth Kaph Ayin Ayin Yod Aleph Samekh Daleth Teth Daleth Pe He Zain Samekh Shin Daleth Tzaddi Pe Cheth Teth Teth Beth Tau Nun Nun Pe Daleth Daleth He Zain Pe Nun He Zain Zain Zain Daleth Cheth Aleph Ayin He Cheth Teth Pe Daleth Daleth Teth Zain Pe Teth Ayin Tau Nun Ayin Cheth Ayin Ayin Pe Aleph Cheth Daleth Samekh Daleth Ayin Mem Teth Ayin Gimel Vau Zain Pe Nun Zain Pe Daleth Daleth Tzaddi Zain Qoph Pe Daleth Lamed Zain Teth Yod Nun Zain Gimel Zain Daleth Zain Gimel Yod Daleth Nun Pe Tzaddi Gimel Zain Cheth Cheth Lamed Pe Gimel Teth Teth Tzaddi Tzaddi Mem Pe Gimel Ayin Pe Teth Zain Teth Cheth Yod Daleth He Teth Teth Pe Ayin Yod Samekh Daleth Yod Pe Pe He Aleph He Daleth Gimel Gimel Kaph Vau Nun Cheth Aleph Daleth Daleth Lamed Teth Daleth Tau Zain Pe Gimel He Teth Cheth Daleth Cheth Zain Gimel Cheth Pe Tau Shin Tau Gimel Daleth Pe Mem Tau Qoph Teth Beth Gimel Lamed Pe Zain Pe Lamed Pe Ayin Shin Daleth Aleph Daleth Teth Zain He Nun Ayin Tau Nun Pe Daleth Pe Gimel Nun Teth Zain He He Lamed Cheth Nun Tzaddi Daleth Teth Nun Zain Teth Cheth Zain Resh Daleth Lamed Pe Teth Tau Cheth Gimel Teth Tau Qoph Nun Pe Pe Shin Nun Pe Gimel Ayin Lamed Nun Aleph Tzaddi He Tzaddi Daleth Pe Teth Kaph Daleth Pe Nun Pe Zain Zain Zain Tzaddi Pe Gimel Pe Yod He Daleth Lamed Cheth Lamed Vau Lamed Pe Cheth Daleth Zain Pe Lamed Kaph Nun Kaph Aleph Zain Pe He Pe Nun Yod Cheth Teth Aleph Mem Daleth Teth Cheth Nun Shin Daleth Nun Gimel Beth Teth Tzaddi Daleth Shin Teth Daleth Cheth Lamed Qoph Daleth Pe Zain Daleth Daleth Cheth Yod Daleth Tau Aleph Shin Mem Kaph Nun Kaph Nun Zain Gimel Teth Pe Pe Gimel Pe Qoph Pe Pe Tzaddi Nun Aleph Daleth He Teth Cheth Yod Qoph Tau Shin Aleph Nun Samekh Ayin Tau Nun Teth Qoph Nun Nun Teth Teth Vau Daleth Ayin Lamed Daleth Zain Gimel Lamed Yod Cheth Daleth Gimel He He Tzaddi Ayin Kaph Kaph Kaph Tau Qoph Kaph Kaph Mem Tau Kaph He Nun Zain Zain Pe Tau Daleth Daleth Daleth Aleph Samekh Qoph Teth Qoph Daleth Tzaddi Tzaddi Tau Zain Daleth Lamed Aleph Gimel Daleth Aleph Beth Daleth Pe Ayin Nun Gimel Lamed Gimel Teth Lamed Gimel Lamed Zain Gimel Cheth Nun Pe Zain Zain Gimel Beth Aleph Samekh Cheth Cheth Lamed Cheth Tzaddi Gimel Gimel Tzaddi Tau Pe Pe Gimel Teth Gimel Pe Qoph Zain Gimel Pe Daleth Zain He Ayin Daleth Tzaddi Zain Teth Zain Zain Pe Daleth Zain Daleth Zain Yod Qoph Pe Lamed Pe Cheth Gimel Kaph Vau Zain Nun Lamed Pe Daleth Lamed Teth Zain Lamed Pe Pe Tau Teth Kaph Pe Teth Gimel Vau Kaph Gimel Lamed Tzaddi Pe Gimel Kaph Nun Kaph Teth Tzaddi Teth Teth Pe Tau Zain Ayin Daleth Daleth Daleth Yod Teth Qoph Gimel Pe Aleph Shin Resh Mem Pe Kaph Beth Vau Pe Nun Pe Pe Shin Lamed Beth Pe Pe Kaph Aleph He Ayin Aleph Daleth Pe Teth Tzaddi Pe Teth Zain Kaph Yod Cheth Gimel Tzaddi Ayin Lamed Beth Gimel Cheth Kaph Tau Cheth Kaph Aleph Zain Teth Daleth Zain Aleph Daleth He He Aleph Aleph Pe Pe Nun Kaph Yod Daleth Tzaddi Pe Lamed Pe Nun Lamed Ayin Gimel Nun Daleth Pe Lamed Beth Lamed Pe Lamed Daleth He Daleth Daleth Daleth Beth Daleth Kaph Zain Gimel Ayin Kaph Kaph Pe Beth Tau Gimel Teth Kaph Pe Pe Mem Zain Ayin Pe Daleth Zain Kaph He Daleth He Nun Samekh Daleth He Ayin Tzaddi Pe Teth Daleth Pe Gimel He Beth Gimel Daleth Pe Gimel Cheth Nun Nun Daleth Zain Daleth Ayin Zain Qoph Pe Zain Yod He Ayin Qoph Pe Yod Mem Teth Samekh Pe Beth He Zain Pe Cheth Ayin Teth Cheth Kaph Lamed Nun Aleph Gimel Shin Gimel Gimel Gimel Kaph Teth Ayin Vau Daleth Zain Kaph Teth Aleph Gimel Gimel Pe Gimel He Nun Pe Teth Zain Lamed Cheth Teth Zain Gimel Zain Pe Teth Daleth Nun Daleth Daleth He Vau Pe Samekh Qoph Gimel Gimel Pe Zain Pe Kaph Gimel Gimel Tau Teth Pe Gimel Daleth Tzaddi Daleth Teth Daleth Zain Aleph Daleth Gimel Pe Vau Pe Pe Daleth He Aleph Zain Pe Tau Vau Samekh Zain Qoph Qoph Daleth Zain Daleth Teth Zain Pe Cheth Pe Tzaddi Nun Gimel Resh Daleth Teth Teth He Cheth Pe Cheth Pe Pe Tzaddi Vau Aleph Cheth Aleph Zain Zain Tzaddi Tzaddi Pe He Pe Daleth Yod Shin Teth Kaph Tzaddi Ayin Teth Nun Cheth Pe Cheth Tzaddi Nun Cheth Nun Daleth Tau Aleph Pe Zain Gimel Gimel Daleth Pe Pe Kaph Kaph Cheth Tzaddi Gimel Cheth Cheth Cheth Pe Kaph Pe Kaph Daleth Daleth Kaph Daleth Daleth Teth Daleth Aleph Tzaddi Daleth Daleth Zain Aleph He Aleph Pe Daleth Pe Pe Daleth Nun Cheth Nun Qoph Ayin Daleth Teth Daleth Pe Gimel Tzaddi Mem Teth Teth Gimel Samekh Ayin Cheth He Pe Zain Gimel Pe Gimel Zain Pe Tzaddi Gimel Zain Pe Gimel Gimel Teth Kaph Zain Nun Lamed Aleph Zain He Kaph Gimel Zain Zain Zain Ayin Daleth Nun Pe Zain Daleth Daleth Resh Gimel Gimel Daleth Shin Lamed Tzaddi Daleth Tau Lamed Teth Daleth Samekh Lamed Lamed Nun Gimel Pe Daleth Zain Teth Daleth Beth Qoph Zain Pe Daleth Pe Pe Gimel Tau Pe Gimel He Teth Nun Cheth Teth Lamed Pe Teth Teth Kaph He He Zain Pe Zain Pe Daleth Ayin Cheth He Tzaddi Teth Daleth Samekh Cheth Cheth Cheth Shin Teth Zain Pe Nun Cheth Zain Kaph He Zain Ayin Yod Teth Zain Pe Yod Zain Teth Mem Pe Daleth Ayin Tau Nun Beth Samekh Tau Daleth Gimel Tau Qoph Zain Gimel Beth Vau Lamed Zain Zain Aleph Cheth Aleph Tau Tau Shin Beth Aleph He Tau Zain Nun Zain Kaph Zain Daleth Pe Ayin Teth Nun Zain Pe Daleth Pe Daleth Vau Teth Gimel Daleth Shin Lamed Nun Cheth Aleph Tzaddi Tau Gimel Vau Pe Lamed Tzaddi Teth Yod Pe Ayin Zain Pe Gimel Tau He Zain Zain Tzaddi Daleth Nun Daleth Zain Aleph Aleph Tzaddi Daleth Kaph Zain Zain Ayin Daleth Daleth Samekh Tau Zain Daleth Tau Beth Zain Nun Cheth Lamed Daleth Lamed Tau He Gimel Pe Gimel Teth Gimel Pe Daleth Zain Teth Tzaddi Teth Samekh Lamed Teth Nun Zain Lamed Gimel Gimel Gimel Pe Zain Tzaddi Qoph Pe Tzaddi Teth Teth Daleth Teth Aleph Pe Kaph Yod Yod Kaph Aleph Tzaddi Tau Zain Pe Teth Zain Daleth He Daleth Teth Gimel Daleth Teth Qoph Lamed Teth Pe Vau Tau Zain Cheth Nun Beth Pe Pe Gimel Ayin Zain Pe Zain Pe Teth Qoph Pe Cheth Gimel Pe Beth Teth Tau Pe He Zain Pe He Gimel He Nun Cheth Cheth Qoph Tau Nun Zain Daleth Teth Teth Pe Teth Teth Aleph Cheth Daleth Nun Zain Lamed Samekh Nun Daleth Nun Beth Nun Teth Daleth Gimel Daleth Nun Zain Daleth Daleth Gimel Daleth Tzaddi Daleth Teth Zain Teth Qoph Kaph Zain Zain Vau Ayin He Zain Pe Teth Ayin Teth Zain Yod Vau Gimel Mem Tzaddi Samekh Tau He Yod Daleth Pe Kaph Teth Samekh Ayin Tau Nun Ayin Cheth Vau Aleph Nun Tau Nun Beth Aleph Tzaddi Nun Qoph Kaph Pe Cheth Kaph Aleph Lamed Gimel Teth Tau Gimel Pe Beth Pe Daleth Tzaddi Ayin Kaph Resh Vau Cheth Zain Ayin Aleph Ayin Aleph Aleph Daleth Vau Teth Teth Gimel Teth Daleth Cheth Daleth Yod Kaph Daleth Cheth Zain Daleth Nun Daleth He Nun Daleth Lamed Aleph Pe Teth Ayin Cheth Zain He Daleth Nun He Beth Ayin Zain Gimel Beth Tau Zain Teth Kaph He Tzaddi Zain Zain Daleth Tzaddi Tzaddi He Zain Vau Tau Aleph Teth Ayin Ayin Pe Pe Zain Lamed Mem Nun Mem Nun Cheth Daleth Cheth Cheth Daleth Tau Pe Daleth Ayin Pe Tzaddi Teth Lamed Pe Pe Daleth Aleph Kaph Gimel Daleth Beth Tau Pe Kaph Beth Teth Resh Zain Gimel Gimel Samekh Kaph Zain Beth Gimel He Teth Tzaddi Teth Tzaddi Teth Pe Gimel Zain Zain Zain Cheth Gimel He Zain Zain Zain Gimel Teth Gimel Cheth Pe Zain He Lamed Aleph Tzaddi Daleth Gimel Daleth Teth Beth Nun Lamed Pe Lamed Tau Aleph Gimel Gimel Zain Kaph Pe Pe Gimel Zain Mem Mem He Tau Lamed Tau Yod Tau Nun Zain Zain Kaph Ayin Tzaddi Zain He Teth Teth Beth Zain Tau Gimel Zain Beth Zain Zain Zain Pe Tau Mem He Daleth Teth Pe Tzaddi Pe Shin Lamed Daleth Teth Teth Cheth Zain Daleth Zain Ayin Pe Gimel Zain Pe Teth Daleth Pe Pe Qoph Pe Pe Pe Tau Tau Tau Qoph Ayin Zain Daleth Gimel Lamed Zain Teth Daleth Yod Zain Daleth Tzaddi Daleth Aleph Ayin Tau Daleth Daleth Tzaddi Zain Tzaddi Pe Pe Nun Ayin Nun He Zain Vau Zain Lamed Cheth Pe Pe Teth Nun Daleth Pe Daleth Daleth Aleph Tzaddi Cheth Zain Daleth Pe Gimel Tzaddi Teth Pe Teth Pe Vau Pe Qoph Tau Gimel Teth Zain Beth Lamed Tzaddi Zain Tau Daleth Pe Nun Ayin Shin Teth Zain Ayin Ayin Zain Aleph Daleth Zain Teth Zain Zain Teth Lamed Teth Nun Cheth Zain He Cheth Lamed Nun Tzaddi Daleth Teth Teth Daleth Zain Zain Vau Gimel Vau Teth Nun Tau Kaph Kaph Ayin Tau Gimel Pe Kaph Shin Vau Zain Qoph Nun Nun Daleth Teth Pe Teth Shin Cheth Ayin Gimel Kaph Samekh Ayin Aleph Samekh Yod He Zain Ayin Gimel Daleth Pe Kaph Cheth Pe Daleth Nun Nun Resh Tzaddi Daleth Zain Gimel Zain Lamed Cheth Teth Kaph Zain Tzaddi Kaph He Zain Ayin Yod Nun Gimel Gimel Samekh Teth Tau Cheth Gimel Zain He Teth Lamed Pe Zain He Pe Pe Pe Zain Zain Pe Daleth Daleth Mem Tzaddi Tau Daleth Gimel Tau Pe Gimel Gimel Pe Nun Daleth Cheth Lamed Zain Teth Zain Pe Daleth Nun Daleth He Aleph Nun Aleph Lamed Gimel Teth Teth Pe Pe Cheth Daleth Gimel Ayin Lamed Pe Tau Tau Qoph Zain Pe Kaph Tau Gimel Zain Nun Pe Teth Teth Kaph Daleth Daleth Nun Daleth Daleth Zain Ayin Tzaddi Tzaddi Zain Daleth Zain Pe Ayin Pe Zain Daleth Lamed Vau Nun Kaph Daleth Lamed Teth Zain Cheth Zain Daleth Lamed Daleth Tzaddi Teth Aleph Cheth Ayin Pe Ayin Gimel Ayin Zain Daleth Pe Vau Teth Kaph He Kaph Zain Cheth Teth Lamed Gimel Teth Pe Tau Zain Nun Teth Tau Tzaddi Zain Daleth Gimel Aleph Tau Kaph Pe Lamed Tzaddi Cheth Pe Daleth Teth Daleth Daleth Lamed Daleth Cheth Pe Teth Lamed Ayin Tau Gimel Teth Aleph Cheth Kaph Nun Nun Tzaddi Gimel Zain Teth Zain Gimel Gimel Teth Zain Teth Tzaddi Ayin Qoph Gimel Gimel Teth Pe Pe Zain Pe Zain Zain Zain Nun Zain Zain Aleph Daleth He Zain Aleph Zain Nun Cheth Gimel Daleth Daleth Tzaddi Zain Tzaddi Pe Tzaddi He Gimel Nun Tzaddi Tzaddi Teth Shin Kaph Cheth Tzaddi Aleph Teth Teth Zain Teth Daleth Gimel Gimel Gimel Tzaddi Zain Daleth Lamed Teth Cheth Lamed Gimel Pe Daleth Zain Teth Pe Daleth Zain Daleth Zain Aleph Gimel Gimel Tzaddi Pe Daleth Teth Pe Pe Ayin Kaph Teth Cheth Nun Nun Nun Nun Teth Pe Zain Daleth Teth Tau Daleth Gimel Pe Daleth Daleth Zain Pe Teth Teth Ayin Teth Nun Tzaddi Yod Pe Cheth Daleth Mem Daleth Daleth Vau Pe Lamed Gimel Pe Pe Aleph Daleth Zain Beth Beth He Daleth Ayin Teth Teth Gimel Gimel Daleth Daleth Ayin Aleph Gimel Ayin Ayin He Aleph Teth He Cheth Pe Daleth Tzaddi Cheth Zain Samekh Aleph Aleph Nun Teth Lamed Daleth Nun Lamed Teth Gimel He Aleph Teth Daleth Gimel Cheth Lamed Lamed Lamed Pe Lamed Lamed Ayin Daleth Nun Ayin Daleth Pe Pe Daleth Teth Pe Cheth Lamed Cheth Ayin Tau He Gimel Gimel Gimel Pe Tau Lamed Teth Cheth Nun Yod Shin Gimel Mem Ayin Teth Gimel Beth Beth Kaph Tzaddi Pe Tzaddi Samekh Nun Tzaddi Mem Daleth Gimel Tzaddi Cheth Aleph Daleth Daleth Cheth Ayin Gimel Cheth Aleph Daleth Pe Gimel Nun Lamed Daleth Daleth Daleth Nun Cheth Gimel Zain Tau Mem Mem Cheth Kaph Qoph Zain Pe Pe Qoph Tau Vau Pe Daleth Daleth Cheth Daleth Tzaddi Yod He Zain Aleph Daleth Vau Teth Teth Nun Tzaddi Teth Daleth Tzaddi Daleth Kaph Zain Cheth Lamed Daleth Nun Nun Zain Lamed Lamed Ayin Pe Resh Pe Cheth Nun Daleth Pe Kaph Teth Daleth Qoph Tau Zain Gimel Kaph Kaph Gimel Vau Pe Kaph Pe Nun Gimel Qoph Lamed Qoph Gimel Pe Lamed Nun Kaph Zain Teth Tzaddi Ayin Daleth Samekh Teth Zain Tau Pe Zain Zain Vau Pe Teth Gimel Cheth Zain Pe Nun Lamed Pe Vau Daleth Daleth Beth Lamed Daleth Cheth Gimel Gimel Pe Qoph Daleth Tzaddi Gimel Teth Cheth Pe Pe Zain Tau Gimel Daleth He Gimel Qoph Teth Yod Pe Beth Shin Cheth Pe Samekh Tau Teth Tzaddi Aleph Teth Beth Daleth Daleth Zain Nun Yod Zain Pe Daleth Kaph Kaph Gimel Tau Pe Nun He Vau Zain Daleth Zain Cheth Teth Daleth Daleth Daleth Gimel Pe Tau Ayin Lamed Yod Cheth Cheth Daleth Pe Qoph Gimel Teth Zain Nun Zain Yod Ayin Gimel Teth Kaph Nun Pe Pe Nun Zain Ayin Teth Daleth Zain Tau He Kaph Zain Zain Kaph Zain Daleth Aleph Mem Nun Teth Pe Pe Teth Lamed Daleth Daleth Lamed Lamed Daleth Lamed Tzaddi Pe He Daleth Zain Tzaddi Daleth Aleph Teth Daleth Daleth Nun Gimel Ayin Daleth Samekh Mem He Kaph Pe Kaph Tau He Teth Gimel Pe Gimel Lamed Daleth Teth Cheth Aleph Samekh Tau Zain Pe Daleth He He He Daleth Zain Zain Zain Aleph Gimel Gimel Nun Daleth Daleth He Gimel Tzaddi Teth Teth Ayin Nun Cheth Gimel Zain Daleth Teth Ayin Cheth Nun Kaph Mem Pe Pe Tau Tau Yod Pe Pe Gimel Pe Teth Mem Gimel Qoph Qoph Tzaddi Zain Ayin Pe Pe Pe Daleth Zain Pe Yod Ayin Aleph Nun Daleth He He Teth Zain Tzaddi Tzaddi Pe Gimel Cheth Teth Cheth He Pe Daleth Cheth Mem Ayin Tzaddi Cheth Teth Tzaddi Shin Qoph Pe Pe Beth Beth Cheth Aleph He Teth Zain Pe Beth Cheth Lamed Lamed Mem Ayin Daleth Kaph Zain Ayin Tzaddi Gimel Lamed Ayin Zain Pe Aleph Pe Nun Nun Aleph Nun Daleth Ayin Pe Lamed Kaph Aleph Kaph Teth Gimel Pe Kaph Kaph Nun Qoph Samekh Tau Yod Pe Qoph Teth Teth Tzaddi Beth Pe Teth Daleth Gimel Cheth Daleth Pe Vau Gimel Zain He Gimel Teth Tau Zain Nun Nun Samekh He Vau Teth Teth Gimel Cheth Pe Teth Teth Vau Zain Teth Aleph Ayin Daleth Cheth Daleth Nun Tzaddi Cheth Daleth Pe Nun Tau Tzaddi Tau Zain Teth Tau Gimel Cheth Daleth Tzaddi Pe Zain Nun Gimel Cheth Vau Cheth Tzaddi Zain Nun Pe Teth Nun Aleph Yod Teth Cheth Ayin Daleth Teth Nun Daleth Aleph Tzaddi He Gimel Teth Aleph Zain Kaph Teth Beth Nun Zain Teth Pe Tzaddi Zain Cheth Daleth Kaph Zain Zain Daleth Resh Yod Daleth Zain Yod Lamed Qoph Daleth Pe Teth Teth Gimel Pe Lamed Samekh Gimel Cheth Gimel Daleth Tzaddi Samekh Vau Pe Zain Zain Pe Lamed Tau Nun Cheth Teth Resh Qoph Aleph Pe Ayin Mem Teth Gimel Lamed Nun Qoph Zain He Kaph Lamed Beth Gimel Ayin Daleth Ayin Aleph Daleth Teth Lamed Zain Daleth Cheth Ayin Gimel Teth Shin

Richard Amiel McGough
05-11-2012, 10:37 AM
Hey there Craig,

I think it would be a LOT better to just use a single symbol for each Hebrew letter. It's really hard to read with the full names spelled out. And for that matter, why not just use Unicode Hebrew characters?

Richard

Richard Amiel McGough
05-11-2012, 10:43 AM
Here's a suggestion on an effective methodology that will determine which codon corresponds to which letter. If there are Hebrew words encoded then we would expect the relative frequency of the codons to correspond to the relative frequency of the Hebrew letters in an average Hebrew text. This then would tell us which letter each codon corresponds to. It would also be a quick test to see if Hebrew words are coded at all, since if they are we would expect the letter frequencies to match. Here a table (http://www.sttmedia.com/characterfrequency-hebrew) of the frequencies for you to use:



Character
Frequency




א
6,11%


ב
4,57%


ג
1,26%


ד
2,49%


ה
10,48%


ו
10,01%


ז
1,28%


ח
2,39%


ט
1,19%


י
10,67%


ך
0,78%


כ
2,60%


ל
7,12%


ם
2,92%


מ
4,43%


ן
1,06%


נ
2,76%


ס
1,43%


ע
3,11%


ף
0,26%


פ
1,63%


ץ
0,12%


צ
1,20%


ק
2,06%


ר
5,40%


ש
4,25%


ת
4,84%

Richard Amiel McGough
05-11-2012, 10:50 AM
I can tell you right off the bat that Kraker's alphabetic correlation is wrong. The letter TETH is very rare in Hebrew (1.1%) but look how frequently it occurs in the first short segment of the "translation" that you posted. It occurs 16/143 = 11.1%.

Yod Nun Lamed Zain Gimel Teth Pe Pe Teth Teth Nun Qoph Zain Zain Daleth Vau Pe Beth Kaph Beth Resh Qoph Beth Vau Teth Lamed Aleph Nun Vau Samekh Teth Pe Samekh Daleth Samekh Daleth He Beth Zain Gimel Vau Pe Mem Kaph Pe Daleth Nun Daleth Gimel Gimel He Lamed Teth He Zain Gimel Teth Qoph Samekh Nun Teth He Aleph Zain Beth Pe Gimel Cheth Aleph Vau Pe Aleph Nun Cheth Cheth Tzaddi Pe Cheth Beth Vau Teth Tau Teth Kaph Nun Teth Yod Gimel Gimel Teth Ayin Kaph Daleth Daleth Daleth Daleth Pe Daleth Lamed Kaph Resh Daleth Tzaddi Nun Pe Cheth Teth Zain Pe Daleth Daleth Tzaddi Teth Ayin Cheth Daleth Cheth Teth Zain Pe Teth Lamed

And just looking at the code shows immediately that it can't be Hebrew at all because there are too many sequences of repetitions of the same letter like Daleth Daleth Daleth Daleth Pe Daleth and Teth Pe Pe Teth Teth.

I think you should put this project to rest. There's no Hebrew in the DNA.

Craig.Paardekooper
05-12-2012, 01:19 AM
Hi Richard,

Thanks for your suggestion. The piece of DNA that I used was a random bit taken from the Human Genome. I really was looking at it in order to just get the methodology right first. I think that next I will look at just non-coding areas - which might produce different results.

I will do as you suggested and compare the frequency of codons in each sample with the frequency of letters in the Hebrew alphabet.

It is early days yet.

Also there are three reading frames for DNA determined by which of the 3 nucleotides you choose as marking the beginning of a codon, and so there are effectively three possible translations - all quite different.


And just looking at the code shows immediately that it can't be Hebrew at all because there are too many sequences of repetitions of the same letter like Daleth Daleth Daleth Daleth Pe Daleth and Teth Pe Pe Teth Teth.

I will do the experiment with different samples that are specifically non-coding, and we will see if these repetitions disappear.

I would agree that triple repetitions are normally a sign of non-language.

Craig.Paardekooper
05-14-2012, 05:29 AM
Here is the DNA for Zinc Fingerprint. I found it here - http://www.ncbi.nlm.nih.gov/nuccore/NM_005257.4


What it Does
This gene is a member of a small family of zinc finger
transcription factors that play an important role in the regulation
of cellular differentiation and organogenesis during vertebrate
development. This gene is expressed during early embryogenesis and
localizes to endo- and mesodermally derived cells during later
embryogenesis and thereby plays an important role in gut, lung, and
heart development.


The DNA splits into 3 areas - there is a non-coding area followed by a coding area, then another non-coding area.

Non Coding Area

gacccacagc ctggcaccct tcggcgagcg ctgtttgttt agggctcggt gagtccaatc
aggagcccag gctgcagttt tccggcagag cagtaagagg cgcctcctct ctccttttta
ttcaccagca gcgcggcgca gaccccggac tcgcgctcgc ccgctggcgc cctcggcttc
tctccgcgcc tgggagcacc ctccgccgcg gccgttctcc atgcgcagcg cccgcccgag
gagctagacg tcagcttgga gcggcgccgg accgtggatg


Coding Area

atg gccttgactg acggcggctg
gtgcttgccg aagcgcttcg gggccgcggg tgcggacgcc agcgactcca gagcctttcc
agcgcgggag ccctccacgc cgccttcccc catctcttcc tcgtcctcct cctgctcccg
gggcggagag cggggccccg gcggcgccag caactgcggg acgcctcagc tcgacacgga
ggcggcggcc ggacccccgg cccgctcgct gctgctcagt tcctacgctt cgcatccctt
cggggctccc cacggacctt cggcgcctgg ggtcgcgggc cccgggggca acctgtcgag
ctgggaggac ttgctgctgt tcactgacct cgaccaagcc gcgaccgcca gcaagctgct
gtggtccagc cgcggcgcca agctgagccc cttcgcaccc gagcagccgg aggagatgta
ccagaccctc gccgctctct ccagccaggg tccggccgcc tacgacggcg cgcccggcgg
cttcgtgcac tctgcggccg cggcggcagc agccgcggcg gcggccagct ccccggtcta
cgtgcccacc acccgcgtgg gttccatgct gcccggccta ccgtaccacc tgcaggggtc
gggcagtggg ccagccaacc acgcgggcgg cgcgggcgcg caccccggct ggcctcaggc
ctcggccgac agccctccat acggcagcgg aggcggcgcg gctggcggcg gggccgcggg
gcctggcggc gctggctcag ccgcggcgca cgtctcggcg cgcttcccct actctcccag
cccgcccatg gccaacggcg ccgcgcggga gccgggaggc tacgcggcgg cgggcagtgg
gggcgcggga ggcgtgagcg gcggcggcag tagcctggcg gccatgggcg gccgcgagcc
ccagtacagc tcgctgtcgg ccgcgcggcc gctgaacggg acgtaccacc accaccacca
ccaccaccac caccatccga gcccctactc gccctacgtg ggggcgccac tgacgcctgc
ctggcccgcc ggacccttcg agaccccggt gctgcacagc ctgcagagcc gcgccggagc
cccgctcccg gtgccccggg gtcccagtgc agacctgctg gaggacctgt ccgagagccg
cgagtgcgtg aactgcggct ccatccagac gccgctgtgg cggcgggacg gcaccggcca
ctacctgtgc aacgcctgcg ggctctacag caagatgaac ggcctcagcc ggcccctcat
caagccgcag aagcgcgtgc cttcatcacg gcggcttgga ttgtcctgtg ccaactgtca
caccacaact accaccttat ggcgcagaaa cgccgagggt gaacccgtgt gcaatgcttg
tggactctac atgaaactcc atggggtgcc cagaccactt gctatgaaaa aagagggaat
tcaaaccagg aaacgaaaac ctaagaacat aaataaatca aagacttgct ctggtaatag
caataattcc attcccatga ctccaacttc cacctcttct aactcagatg attgcagcaa
aaatacttcc cccacaacac aacctacagc ctcaggggcg ggtgccccgg tgatgactgg
tgcgggagag agcaccaatc ccgagaacag cgagctcaag tattcgggtc aagatgggct
ctacataggc gtcagtctcg cctcgccggc cgaagtcacg tcctccgtgc gaccggattc
ctggtgcgcc ctggccctgg cctga


Non Coding Area

cctgagccca cgccgccagg aggcagggag ggctccgccg
cgggcctcac tccactcgtg tctgcttttg tgcagcggtc cagacagtgg cgactgcgct
gacagaacgt gattctcgtg cctttatttt gaaagagatg tttttcccaa gaggcttgct
gaaagagtga gagaagatgg aagggaaggg ccagtgcaac tgggcgcttg ggccactcca
gccagcccgc ctccggggcg gaccctgctc cacttccaga agccaggact aggacctggg
ccttgcctgc tatggaatat tgagagagat tttttaaaaa agattttgca ttttgtccaa
aatcatgtgc ttcttctgat caattttggt tgttccagaa tttcttcata ccttttccac
atccagattt catgtgcgtt catggagaag atcacttgag gccatttggt acacatctct
ggaggctgag tcggttcatg aggtctctta tcaaaaatat tactcagttt gcaagactgc
attgtaactt taacatacac tgtgactgac gtttctcaaa gttcatattg tgtggctgat
ctgaagtcag tcggaatttg taaacagggt agcaaacaag atatttttct tccatgtata
caataatttt tttaaaaagt gcaatttgcg ttgcagcaat cagtgttaaa tcatttgcat
aagatttaac agcatttttt ataatgaatg taaacatttt aacttaatgg tacttaaaat
aatttaaaag aaaaatgtta acttagacat tcttatgctt cttttacaac tacatcccat
tttatatttc caattgttaa agaaaaatat ttcaagaaca aatcttctct caggaaaatt
gcctttctct atttgttaag aatttttata caagaacacc aatatacccc ctttatttta
ctgtggaata tgtgctggaa aaattgcaac aacactttac tacctaacgg atagcatttg
taaatactct aggtatctgt aaacactctg atgaagtctg tatagtgtga ctaacccaca
ggcaggttgg tttacattaa tttttttttt tgaatgggat gtcctatgga aacctatttc
accagagttt taaaaataaa aagggtattg ttttgtcttc tgtacagtga gttccttccc
ttttcaaagc tttcttttta tgctgtatgt gactatagat attcatataa aacaagtgca
cgtgaagttt gcaaaatgct ttaaggcctt cctttcaaag catagtcctt ttggagccgt
tttgtacctt ttataccttg gcttatttga agttgacaca tggggttagt tactactctc
catgtgcatt ggggacagtt tttataagtg ggaaggactc agtattatta tatttgagat
gataagcatt ttgtttggga acaatgctta aaaatattcc agaaagttca gatttttttt
ctttgtgaat gaaatatatt ctggcccacg aacagggcga tttcctttca gttttttcct
tttgcaacgt gccttgaagt ctcaaagctc acctgaggtt gcagacgtta cccccaacag
aagataggta gaaatgattc cagtggcctc tttgtatttt cttcattgtt gagtagattt
caggaaatca ggaggtgttt cacaatacag aatgatggcc tttaactgtg


I will analyse the frequency of the codons mapping to each of the amino acids in both coding and non-coding areas. This will show whether the codons occur with a different frequency. Then we will compare the frequency of amino acod codons woth the frequency of letters in the Hebrew alphabet to see if there is any correlation..

Here are the results for the Non-Coding area showing the % occurrence of codons mapping to each amino acid

Phe : 8.03
Leu : 11.52
Ile : 5.15
Met : 1.21
Val : 5.45
Ser : 8.18
Pro : 5.91
Thr : 4.7
Ala : 4.55
Tyr : 2.88
Stop1 : 2.88
His : 2.88
Gln : 4.55
Asn : 2.88
Lys : 4.7
Asp : 2.88
Glu : 3.33
Cys : 3.79
Stop2 : 1.67
Trp : 1.36
Arg : 5.91
Gly : 5.61

And here are the results for the coding area - showing the % occurrence of codons mapping to each amino acid

Phe : 1.34
Leu : 7.55
Ile : 1.17
Met : 1.68
Val : 3.02
Ser : 12.92
Pro : 10.91
Thr : 5.2
Ala : 13.93
Tyr : 2.85
Stop1 : 0
His : 3.52
Gln : 2.35
Asn : 3.36
Lys : 2.68
Asp : 2.68
Glu : 3.36
Cys : 2.35
Stop2 : .17
Trp : 1.34
Arg : 4.53
Gly : 13.09

Here are the results on a graph395

Oddly enough, it looks as if the codon frequency in coding areas follows a similar pattern to the codon frequency in non coding areas, except that the peaks and troughs are more extreme in the coding areas.

In the non-coding area there are two places where a letter occurs 3 times in succession

Repetition = TTT : 1359
Repetition = TAT : 1680

In the coding area there are eleven places where a letter occurs 3 times in succession

Repetition = TCC : 132
Repetition = GCG : 543
Repetition = GCG : 852
Repetition = GGC : 888
Repetition = CAC : 975
Repetition = CAC : 978
Repetition = CAC : 981
Repetition = CAC : 984
Repetition = CAC : 987
Repetition = CAC : 990
Repetition = CAC : 993

Now that we have the frequences, it will be interesting to see if we can match them to the letter frequencies in the Hebrew alphabet. Before we can do this with any confidence, we will need to carry out a similar analysis on 20 more DNA samples of non-coding DNA to see if the frequency pattern persists.

Craig.Paardekooper
05-22-2012, 08:13 AM
Biosystems. 1997;44(1):17-39.

Isomorphism between cell and human languages: molecular biological, bioinformatic and linguistic implications.

Ji S.


Source

Department of Pharmacology and Toxicology, College of Pharmacy, Rutgers University, Piscataway, NJ 08855, USA.


Abstract

The concept of cell language has been defined in molecular terms. The molecule-based cell language is shown to be isomorphic with the sound- and visual signal-based human language with respect to ten out of the 13 design features of human language characterized by Hockett. Biocybernetics, a general molecular theory of living systems developed over the past two and a half decades, is found to provide a physical theory underlying the phenomenon of cell language. The concept of cell language integrates bioenergetics and bioinformatics on the one hand and reductionistic and holistic experimental data on the other to account for living processes on the molecular level. The isomorphism between cell and human languages suggests that the DNA of higher eucaryotes contains two classes of genes--structural genes corresponding to the lexicon and 'spatiotemporal genes' corresponding to the grammar of cell language. The former is located in coding regions of DNA and the latter is predicted to reside primarily in noncoding regions. The grammar of cell language is identified with the mapping of the nucleotide sequences of DNA onto its 4-dimensional folding patterns that control the spatiotemporal evolution of gene expression. Such a mapping has been referred to as the second genetic code, in contrast to the first genetic code which maps nucleotide triplets onto amino acids. The cell language theory introduces into biology the linguistic principle of 'rule-governed creativity,' leading to the formulation of the concept of 'rule-governed creative molecules' or 'creations.' This concept sheds new light on molecular biology, bioinformatics, protein folding, and developmental biology. In addition, the cell language theory suggests that human language is ultimately founded on cell language.


This interesting paper sheds more light upon the emerging impression that the non-coding areas of DNA contain a language. "In the beginning was the Word!"

Richard Amiel McGough
05-22-2012, 08:31 AM
Biosystems. 1997;44(1):17-39.

Isomorphism between cell and human languages: molecular biological, bioinformatic and linguistic implications.

Ji S.


Source

Department of Pharmacology and Toxicology, College of Pharmacy, Rutgers University, Piscataway, NJ 08855, USA.


Abstract

The concept of cell language has been defined in molecular terms. The molecule-based cell language is shown to be isomorphic with the sound- and visual signal-based human language with respect to ten out of the 13 design features of human language characterized by Hockett. Biocybernetics, a general molecular theory of living systems developed over the past two and a half decades, is found to provide a physical theory underlying the phenomenon of cell language. The concept of cell language integrates bioenergetics and bioinformatics on the one hand and reductionistic and holistic experimental data on the other to account for living processes on the molecular level. The isomorphism between cell and human languages suggests that the DNA of higher eucaryotes contains two classes of genes--structural genes corresponding to the lexicon and 'spatiotemporal genes' corresponding to the grammar of cell language. The former is located in coding regions of DNA and the latter is predicted to reside primarily in noncoding regions. The grammar of cell language is identified with the mapping of the nucleotide sequences of DNA onto its 4-dimensional folding patterns that control the spatiotemporal evolution of gene expression. Such a mapping has been referred to as the second genetic code, in contrast to the first genetic code which maps nucleotide triplets onto amino acids. The cell language theory introduces into biology the linguistic principle of 'rule-governed creativity,' leading to the formulation of the concept of 'rule-governed creative molecules' or 'creations.' This concept sheds new light on molecular biology, bioinformatics, protein folding, and developmental biology. In addition, the cell language theory suggests that human language is ultimately founded on cell language.


This interesting paper sheds more light upon the emerging impression that the non-coding areas of DNA contain a language. "In the beginning was the Word!"
Good morning Craig, :tea:

Thanks for the most fascinating information! Genetics is a most amazing field of study. I can see why it would make you think of "I the beginning was the Word." But it also gives the strongest evidence for evolution. What do you think about that? What is your position on evolution?

Richard

Krakers
05-24-2012, 05:02 AM
Dear Craig;

Obviously you are not afraid of hard work! Pulling random segments of human DNA from the internet and running them through a converter while looking for patterns of similarity between the DNA cypher-text in order to find an associated Hebrew plain-text! That's not something I would do (any more!). The chances of finding something that would be convincing to a skeptical audience is very low. Oddly enough though, your first pick of a DNA segment was the human mitochondrial genome (you mentioned that it was the shortest segment listed). I mentioned this segment as a good place to start in my first post to this forum. The mtDNA genome has 16569 base pairs; it codes for 37 genes among which are 22 tRNA genes.

This coincidence of 37 & 22 with all the other 37 & 22 stuff you, Jenkins, RAM and others have found to be central to the biblical textural structure is intriguing. The number of base pairs is also fascinating because of the following connections that may either be important or symptoms of my increasing apophenia. If we allow 10 base pairs to define a 360 degree turn on the genomes helix and think (metaphorically) of 360 degrees as a nominal year then 16569 base pairs can become 1656.9 "years". In some biblical translations 1656 years is the time from the creation of Adam to the Deluge. I wonder if the curious lengths of the life times of the predeluge patriarchs could be interpreted as segments on the mtDNA strand. The idea that human evolution has been influenced by the species surviving certain "bottleneck" events. The Deluge (as historical event) qualifies as a bottleneck event.

Of course, finding the "key" that unlocks the hoped-for relationship between the DNA cyphertext and the Hebrew plaintext is very important. Non-biblical sources may be helpful. The relationship between the Babylonian accounts of the deluge and a comparison of their 10 predeluge kings with the 10 biblical patriarchs is well known and there is even a very nice mathematical argument that demonstrates the isomorphism between Babylonian 432,000 years for the 10 kings and the 1656 years for the 10 patriarchs.

In regard to whole thing of 360 degree circles and nominal "years" etc. the little formula: (17*(Pi^4)) / 360 may be fun to play with since 17*(PI^4) ~ 1656.

Regards,
Krakers

Rose
05-24-2012, 12:53 PM
Hi Craig,


I was wondering if you have heard of a book called The Spiritual Genome by Brad Bartholomew (http://www.spiritualgenome.com/index.html)?

Rose

Craig.Paardekooper
05-27-2012, 09:58 AM
I met with Vernon who came from Wales down to London to attend the Reasons to Believe Conference. Vernon suggested that we go back to the original research on linguistic features in the genetic code, and study the background material in those papers. This will provide hunches as to which avenues to pursue.

Vernon asked me to send him a list of all the papers on "Linguistic features in DNA"

Such a list can be obtained easily from PubMed - an online database that indexes all published papers on genetics. You can find this database here -

http://www.ncbi.nlm.nih.gov/entrez/

I entered the phrase "Linguistic Features of Noncoding DNA" into the search box - which produced this list of papers -


1. Physica A. 1999;273(1-2):1-18.
Scaling features of noncoding DNA.
Stanley HE, Buldyrev SV, Goldberger AL, Havlin S, Peng CK, Simons M.
Source : Department of Physics, Boston University, MA 02215, USA. hes@bu.edu

Abstract

We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.



2.Biosystems. 1997;44(1):17-39.

Isomorphism between cell and human languages: molecular biological, bioinformatic and linguistic implications.
Source : Department of Pharmacology and Toxicology, College of Pharmacy, Rutgers University, Piscataway, NJ 08855, USA.

Abstract

The concept of cell language has been defined in molecular terms. The molecule-based cell language is shown to be isomorphic with the sound- and visual signal-based human language with respect to ten out of the 13 design features of human language characterized by Hockett. Biocybernetics, a general molecular theory of living systems developed over the past two and a half decades, is found to provide a physical theory underlying the phenomenon of cell language. The concept of cell language integrates bioenergetics and bioinformatics on the one hand and reductionistic and holistic experimental data on the other to account for living processes on the molecular level. The isomorphism between cell and human languages suggests that the DNA of higher eucaryotes contains two classes of genes--structural genes corresponding to the lexicon and 'spatiotemporal genes' corresponding to the grammar of cell language. The former is located in coding regions of DNA and the latter is predicted to reside primarily in noncoding regions. The grammar of cell language is identified with the mapping of the nucleotide sequences of DNA onto its 4-dimensional folding patterns that control the spatiotemporal evolution of gene expression. Such a mapping has been referred to as the second genetic code, in contrast to the first genetic code which maps nucleotide triplets onto amino acids. The cell language theory introduces into biology the linguistic principle of 'rule-governed creativity,' leading to the formulation of the concept of 'rule-governed creative molecules' or 'creations.' This concept sheds new light on molecular biology, bioinformatics, protein folding, and developmental biology. In addition, the cell language theory suggests that human language is ultimately founded on cell language.


3. Nucleic Acids Res. 1996 May 1;24(9):1676-81.
Lack of biological significance in the 'linguistic features' of noncoding DNA--a quantitative analysis.
Chatzidimitriou-Dreismann CA, Streffer RM, Larhammar D.

Source : Iwan N. Stranski Institute for Physical and Theoretical Chemistry, Technical University of Berlin, Germany.

Abstract

Recently, the application of two statistical methods (related to Zipf's distribution and Shannon's redundancy), called 'linguistic' tests, to the primary structure of DNA sequences of living organisms has excited considerable interest. Of particular importance is the claim that noncoding DNA sequences in eukaryotes display specific 'linguistic' features, being reminiscent of natural languages. Furthermore, this implies that noncoding regions of DNA may carry some new, thus far unknown, biological information which is revealed by these tests. In this paper these claims are tested quantitatively. With the aid of computer simulations of natural DNA sequences, and by applying the same 'linguistic' tests to both natural and artificial sequences, we investigate in detail the reasons of the appearance of the claimed 'linguistic' features and the associated differences between coding and noncoding DNAs. The presented results show quantitatively that the 'linguistic' tests failed to reveal any new biological information in (noncoding or coding) DNA.


4. Science. 1996 Jan 5;271(5245):14b-5b.
Explaining "linguistic features" of noncoding DNA.

Bonhoeffer S, Herz AV, Boerlijst MC, Nee S, Nowak MA, May RM.

Lack of biological significance in the 'linguistic features' of noncoding DNA--a quantitative analysis.

Chatzidimitriou-Dreismann CA, Streffer RM, Larhammar D.


5. Phys Rev E Stat Phys Plasmas Fluids Relat Interdiscip Topics. 1995 Sep;52(3):2939-50.
Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics.

Mantegna RN, Buldyrev SV, Goldberger AL, Havlin S, Peng CK, Simons M, Stanley HE.

Source: Center for Polymer Studies and Department of Physics, Boston University, Massachusetts 02215, USA.

Abstract

We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.


6. Fractals. 1995 Jun;3(2):269-84.
Statistical and linguistic features of DNA sequences.

Havlin S, Buldyrev SV, Goldberger AL, Mantegna RN, Peng CK, Simons M, Stanley HE.

Source : Center for Polymer Studies and Department of Physics, Boston University, MA 02215, USA.

Abstract

We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.


7. Phys Rev Lett. 1994 Dec 5;73(23):3169-72.
Linguistic features of noncoding DNA sequences.
Mantegna RN, Buldyrev SV, Goldberger AL, Havlin S, Peng CK, Simons M, Stanley HE.

Source : Center for Polymer Studies and Department of Physics, Boston University, Massachusetts 02215, USA.
Abstract

We extend the Zipf approach to analyzing linguistic texts to the statistical study of DNA base pair sequences and find that the noncoding regions are more similar to natural languages than the coding regions. We also adapt the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and demonstrate that noncoding regions in eukaryotes display a smaller entropy and larger redundancy than coding regions, supporting the possibility that noncoding regions of DNA may carry biological information.

Craig.Paardekooper
05-27-2012, 10:11 AM
Here is a link to the pdf for this paper -

http://cps.bu.edu/hes/articles/mbghpss94.pdf


and here is a link to another complete paper by the same researchers

http://havlin.biu.ac.il/PS/hbgmpss254.pdf


also

http://chemlabs.nju.edu.cn/Literature/Zipf/important/Systematic%20analysis%20of%20coding%20and%20noncod ing%20DNA%20sequences%20using%20methods%20of%20sta tistical%20linguistics.pdf

Craig.Paardekooper
05-28-2012, 03:55 AM
Inorder to understand the paper on Linguistic features in noncoding DNA, I must first understand Zipf's Law and how it applies to ordinary languages. Here is a link -

http://en.wikipedia.org/wiki/Zipf's_law

References:

Christopher D. Manning, Hinrich Schütze Foundations of Statistical Natural Language Processing, MIT Press (1999)
http://dpinto.cs.buap.mx/pln/Autumn2010/2000-book-foundations_of_statistical_natural_language_proces sing.pdf

Craig.Paardekooper
05-28-2012, 05:44 AM
http://www.hpl.hp.com/research/idl/papers/ranking/ranking.html

http://www.csl.sri.com/users/neumann/#12a

Belevitch V (18 December 1959). "On the statistical laws of linguistic distributions". Annales de la Société Scientifique de Bruxelles. I 73: 310–326

Craig.Paardekooper
05-29-2012, 05:31 AM
http://www.intmath.com/exponential-logarithmic-functions/7-graphs-log-semilog.php

Craig.Paardekooper
06-08-2012, 10:35 PM
Background

We have seen, from the work of Vernon Jenkins, that Genesis 1v1 seems to contain a mathematical pattern based around 666 and 703, and this same pattern has been discovered by Rakocevic in the genetic code. Genesis 1v1 is therefore possibly a Signature.

Consequently I have decided to search for this Signature in the sequence of nucleotide bases that form the string of DNA. The number of aminoacods approximates to the number of letters in the alphabet, so I will try and determine which codons map onto which letters of the alphabet.


Which codon triplets map on to which letters of the alphabet?

Inorder to answer this question, I have an idea.

Genesis 1 v 1 has 28 letters. Assuming that Genesis 1 v 1 is encoded within the DNA string then the codon that matches Aleph will occur at positions 3, 9, 10, 15, 23 and 26 within a 28 letter string - just as the letter Aleph occurs at those same positions in Genesis 1 v 1

486

So all we have to do is isolate each string that is of length 28 letters. Then see if the same aminoacid occurs at all the positions - 3, 9, 10, 15, 23 and 26.

If we find a match, then that aminoacid would map onto Aleph.

Then we could look to see if a the aminoacid occurring at positions 5, 13 and 20, was the same in these three positions. If it is, then this would be a staggering confirmation. This aminoacid would map onto Iota.

The same could be done for each letter in Genesis 1 v 1

This would be very convincing proof of the presence of Genesis 1 v 1 in the DNA string

Whatsmore, it would simultaneously decode the DNA alphabet.


Method

1. The DNA sequence is copied in FASTA format from the online DNA database, and pasted into TextBox1

2. First the DNA sequence is converted into an array of codon triplets.

3. Then the codon triplets are converted into an aminoacid sequence using the standard genetic code

4. The string of aminoacids is then searched for 28 letter sequences where the same letter occurs at positions 3, 9, 10, 15, 23 and 26.


Computer Code

Here is the computer code that I will use to carry out step 2

Dim Nucleotides As String
Nucleotides = TextBox1.Text.Replace(Environment.NewLine, "")
Nucleotides = Nucleotides.Replace(" ", "")
Nucleotides = UCase(Nucleotides)
Nucleotides = Nucleotides.Trim
TextBox1.Text = Nucleotides
Dim Line As String = ""
Dim r, n As Integer
Dim array1(10000) As String

For r = 0 To Nucleotides.Length - 3 Step 3
array1(n) = Nucleotides.Substring(r, 3)
Next

Here is the computer code that I will use to carry out step 3

Dim AminoAcids As String = ""
Dim Codon As String

For Each Codon In array1
If Codon = "TTT" Or Codon = "TTC" Then
AminoAcids &= "F"
End If

If Codon = "TTA" Or Codon = "TTG" Or Codon = "CTT" Or Codon = "CTC" Or Codon = "CTA" Or Codon = "CTG" Then
AminoAcids &= "L"
End If

If Codon = "ATT" Or Codon = "ATC" Or Codon = "ATA" Then
AminoAcids &= "I"
End If

If Codon = "ATG" Then
AminoAcids &= "M"
End If

If Codon = "GTT" Or Codon = "GTC" Or Codon = "GTA" Or Codon = "GTG" Then
AminoAcids &= "V"
End If

If Codon = "TCT" Or Codon = "TCC" Or Codon = "TCA" Or Codon = "TCG" Or Codon = "AGT" Or Codon = "AGC" Then
AminoAcids &= "S"
End If

If Codon = "CCT" Or Codon = "CCC" Or Codon = "CCA" Or Codon = "CCG" Then
AminoAcids &= "P"
End If

If Codon = "ACT" Or Codon = "ACC" Or Codon = "ACA" Or Codon = "ACG" Then
AminoAcids &= "T"
End If

If Codon = "GCT" Or Codon = "GCC" Or Codon = "GCA" Or Codon = "GCG" Then
AminoAcids &= "A"
End If

If Codon = "TAT" Or Codon = "TAC" Then
AminoAcids &= "Y"
End If

If Codon = "TAA" Or Codon = "TAG" Then
AminoAcids &= "1"
End If

If Codon = "CAT" Or Codon = "CAC" Then
AminoAcids &= "H"
End If

If Codon = "CAA" Or Codon = "CAG" Then
AminoAcids &= "Q"
End If

If Codon = "AAT" Or Codon = "AAC" Then
AminoAcids &= "N"
End If

If Codon = "AAA" Or Codon = "AAG" Then
AminoAcids &= "K"
End If

If Codon = "GAT" Or Codon = "GAC" Then
AminoAcids &= "D"
End If

If Codon = "GAA" Or Codon = "GAG" Then
AminoAcids &= "E"
End If

If Codon = "TGT" Or Codon = "TGC" Then
AminoAcids &= "C"
End If

If Codon = "TGA" Then
AminoAcids &= "2"
End If

If Codon = "TGG" Then
AminoAcids &= "W"
End If

If Codon = "CGT" Or Codon = "CGC" Or Codon = "CGA" Or Codon = "CGG" Or Codon = "AGA" Or Codon = "AGG" Then
AminoAcids &= "R"
End If

If Codon = "GGT" Or Codon = "GGC" Or Codon = "GGA" Or Codon = "GGG" Then
AminoAcids &= "G"
End If
Next

Here is the computer code that I will use to carry out step 4. It is written in vb.net language.

Dim i as integer
Dim Sample as String
Dim A1, A2, A3, A4, A5, A6 as String
Dim SequencesFound as String

For i = 0 to AminoAcids.length - 28

Sample = AminoAcids.Substring(i, 28)
A1 = Sample.substring(2, 1)
A2 = Sample.substring(8, 1)
A3 = Sample.substring(9, 1)
A4 = Sample.substring(14, 1)
A5 = Sample.substring(22, 1)
A6 = Sample.substring(25, 1)

If A1 = A2 and A2 = A3 and A3 = A4 and A4 = A5 and A5 = A6 Then

SequencesFound &= "Position : " & i & vbcrlf & Sample & vbcrlf & vbcrlf

End If

Next

TextBox2.Text = SequencesFound

This method is much better than previous suggested methods since it works without having to first determine the DNA alphabet. All we have to look for is the same codon occurring in all positions of the same letter. Given the wierd way in which Genesis 1 v 1 has manifested in the DNA code ( as demonstrated by both Shcherbak and Rakocevic), it is quite possible that the signature verse will be found within the DNA sequence itself - and this is one direct way of finding out if that is the case.

Of course, if this test works then we will have found the Signature - and we will also have decoded the DNA alphabet. With the alphabet we will be able to read other passages of DNA which will help us to understand the function of DNA and also where we came from.

jce
06-10-2012, 03:59 PM
Background

We have seen, from the work of Vernon Jenkins, that Genesis 1v1 seems to contain a mathematical pattern based around 666 and 703, and this same pattern has been discovered by Rakocevic in the genetic code. Genesis 1v1 is therefore possibly a Signature.

Consequently I have decided to search for this Signature in the sequence of nucleotide bases that form the string of DNA. The number of aminoacods approximates to the number of letters in the alphabet, so I will try and determine which codons map onto which letters of the alphabet.

If we find a match, then that aminoacid would map onto Aleph.

Then we could look to see if a the aminoacid occurring at positions 5, 13 and 20, was the same in these three positions. If it is, then this would be a staggering confirmation. This aminoacid would map onto Iota.

The same could be done for each letter in Genesis 1 v 1

This would be very convincing proof of the presence of Genesis 1 v 1 in the DNA string

Whatsmore, it would simultaneously decode the DNA alphabet.

Of course, if this test works then we will have found the Signature - and we will also have decoded the DNA alphabet. With the alphabet we will be able to read other passages of DNA which will help us to understand the function of DNA and also where we came from.

Hi Craig

What a fascinating endeavor! I started reading this thread at the end and realized that one would need to begin at.. where else but the "beginning"!

I must admit that my limited education prohibits me from commenting on your work, but what intrigues me as a Christian is the possible conclusion which could generate some interest throughout the science community! Of course there may be some who would dismiss it as a meaningless coincidence as they are already predisposed to the idea that Bible has nothing to offer science. Also, regarding the question as to whether or not any more prominent names in this discipline have cited or verified the early stages of this work only leads me to conclude that God reveals His secrets to the humble and hides them from the proud, or more fairly put, they are just not focused on it as you indicated.

One more thought before I finish. I titled this reply "Truth and Reason" because it seems that the Bible is often rejected because of its apparent contradictions or other inconsistencies. Zechariah 4 records an interesting vision where part of the message contains the phrase "not by might nor by power, but by My Spirit saith the Lord of Hosts". Perhaps God will fully accomplish His work on earth, not in a concluding demonstration of His might and power, but by the unifying of Truth and Reason. If your work produces what I suspect that you hope it will, this would be more than a step in that direction, it would seem to be more of a leap!!!

May God continue to inspire you with His marvelous revelations!!!

A brother in Christ.

John

Richard Amiel McGough
06-10-2012, 04:48 PM
Which codon triplets map on to which letters of the alphabet?

Inorder to answer this question, I have an idea.

Genesis 1 v 1 has 28 letters. Assuming that Genesis 1 v 1 is encoded within the DNA string then the codon that matches Aleph will occur at positions 3, 9, 10, 15, 23 and 26 within a 28 letter string - just as the letter Aleph occurs at those same positions in Genesis 1 v 1

486

So all we have to do is isolate each string that is of length 28 letters. Then see if the same aminoacid occurs at all the positions - 3, 9, 10, 15, 23 and 26.

If we find a match, then that aminoacid would map onto Aleph.

Then we could look to see if a the aminoacid occurring at positions 5, 13 and 20, was the same in these three positions. If it is, then this would be a staggering confirmation. This aminoacid would map onto Iota.

The same could be done for each letter in Genesis 1 v 1

This would be very convincing proof of the presence of Genesis 1 v 1 in the DNA string

Whatsmore, it would simultaneously decode the DNA alphabet.


Method

1. The DNA sequence is copied in FASTA format from the online DNA database, and pasted into TextBox1

2. First the DNA sequence is converted into an array of codon triplets.

3. Then the codon triplets are converted into an aminoacid sequence using the standard genetic code

4. The string of aminoacids is then searched for 28 letter sequences where the same letter occurs at positions 3, 9, 10, 15, 23 and 26.


This method is much better than previous suggested methods since it works without having to first determine the DNA alphabet. All we have to look for is the same codon occurring in all positions of the same letter. Given the wierd way in which Genesis 1 v 1 has manifested in the DNA code ( as demonstrated by both Shcherbak and Rakocevic), it is quite possible that the signature verse will be found within the DNA sequence itself - and this is one direct way of finding out if that is the case.

Of course, if this test works then we will have found the Signature - and we will also have decoded the DNA alphabet. With the alphabet we will be able to read other passages of DNA which will help us to understand the function of DNA and also where we came from.
Hi Craig,

I think there is a much simpler method. Are you familiar with Regular Expressions? They enable you to search a string for any pattern of characters. For example, you want to find a string that has the same character (codon) at positions 3, 9, 10, 15, 23 and 26. You don't have to worry about the length of the substring - just search the entire DNA codon string for any such sequence. Then you can check to see if the string you found can be matched to the rest of the text of Genesis 1:1 by simply checking to see if the first and fourth characters are the same (corresponding to Bet), etc.

Also, you can automatically analyze the entire genome if you read it from a file rather than copy/pasting little chunks into a textbox.

It sounds like the first thing to do would be to translate the entire genome into codons, represented by 22 letters. Then you can look for patterns in those letters, like a substring with the same letter at positions 3, 9, 10, 15, 23 and 26.

Have you put any of your test programs online yet? Do you have a link to the genome translated into codons?

All the best,

Richard

Richard Amiel McGough
06-10-2012, 05:31 PM
Hi Craig

What a fascinating endeavor! I started reading this thread at the end and realized that one would need to begin at.. where else but the "beginning"!

Yes, a connection between Genesis and Genetics would be intriguing indeed!

My research confirms the results found by Vernon Jenkins but also enters into territory that he has not explored as far as I know. It concerns the idea of creation as an act of dividing the primal unity. The alphanumeric structure of Genesis 1:1 involves primes that are generated when unity (the number 1) is divided by an integer in base 10. Consider unity divided by 7:

1/7 = 0.142857 142857 142857 142857 142857 ... repeated forever.

If we now multiply by 7 to "restore unity" we get this:

1 = 7 x (1/7) = 0.999999 999999 999999 999999 ... repeated forever.

Similar patterns are found for any number not containing a 2 or 5 (the prime factors of the base 10 = 2 x 5).

So the process of dividing and reuniting unity involves "repdigits" like 99, 999, 9999, 99999, etc. And as it turns out, the primes found in the alphanumeric structure of Genesis 1:1-5 and John 1:1-5 are the very primes that are the facts of small repdigits. Specifically, the alphanumeric structure of the Creation Holograph (http://biblewheel.com/GR/GR_Creation.asp) is based on what I call the Holographic Generating Set (http://biblewheel.com/GR/GR_Creation_Set.asp) (A = 27, B = 37, C = 73) and the sum of those numbers A + B + C = D = 137 (a prime, and also the first approximation to the fine structure constant which governs the interaction between matter and light).

The product of the first two numbers give the third repdigit 999 = 27 x 37 = AB.

The second two numbers are factors in the eighth repdigit = 99999999 = 9999 x 10001 = 9999 x 73 x 137 = 9999 x CD.

Products from the GenSet are closely related to Base 10, and the set is almost closed (differing from multiples of itself by +/- 1):

AB = 999 = 1000 - 1

BC = 2701 = 100A + 1

AD = 3699 = 100B - 1

BB = 1369 = 10D - 1

Using the GenSet, we can express the detailed structures of Genesis 1:1- and John 1:1-5 in many ways:

Gen 1:1 = 2701 = 100A + 1 = BC = T(C) = T(B) + 2AB

John 1:1 = 3627 = 100B - C

Gen 1:1 + AB = 3700 = 100B = John 1:1 + C

So from this, and many other identities, I concluded that the creation passages mimic the mathematical patterns generated when dividing unity. It still makes a lot of sense to me.



I must admit that my limited education prohibits me from commenting on your work, but what intrigues me as a Christian is the possible conclusion which could generate some interest throughout the science community! Of course there may be some who would dismiss it as a meaningless coincidence as they are already predisposed to the idea that Bible has nothing to offer science. Also, regarding the question as to whether or not any more prominent names in this discipline have cited or verified the early stages of this work only leads me to conclude that God reveals His secrets to the humble and hides them from the proud, or more fairly put, they are just not focused on it as you indicated.

It's odd that you speak of people "predisposed to the idea that Bible has nothing to offer science" given that you yourself have stated that "the Bible is not a book of science." And I agree with you on that point. The problem is that the Bible contains mythology that is indistinguishable from the common mythology of the time it was written. So if you interpret, for example, the idea of "stretching the heavens like a tent" as insight into modern cosmology, then you are attributing that idea to the common mythology of the time when the phrase was commonly used by other cultures.

And I don't think it is accurate to suggest that scientists are "proud" - on the contrary, scientists are the most humble in as much as they defer to reality and evidence rather than their own opinion (which is the hallmark of dogmatists).



One more thought before I finish. I titled this reply "Truth and Reason" because it seems that the Bible is often rejected because of its apparent contradictions or other inconsistencies. Zechariah 4 records an interesting vision where part of the message contains the phrase "not by might nor by power, but by My Spirit saith the Lord of Hosts". Perhaps God will fully accomplish His work on earth, not in a concluding demonstration of His might and power, but by the unifying of Truth and Reason. If your work produces what I suspect that you hope it will, this would be more than a step in that direction, it would seem to be more of a leap!!!

May God continue to inspire you with His marvelous revelations!!!

A brother in Christ.

John
I don't see how this kind of evidence could ever support the traditional dogmatic interpretation of the Bible. I accept the evidence of the Bible Wheel, but I do not accept that it implies traditional Christianity is true. It's a very strange paradox, but I have no choice. The problems with the Bible will not allow that implication.

Great chatting, as always,

Richard

Craig.Paardekooper
06-11-2012, 03:48 AM
Hi Richard,

I guess you are right about using regular expressions.

The code I am intending to use at present is -

Dim i as integer
Dim Sample as String
Dim A1, A2, A3, A4, A5, A6 as String
Dim SequencesFound as String

For i = 0 to AminoAcids.length - 28

Sample = AminoAcids.Substring(i, 28)
A1 = Sample.substring(2, 1)
A2 = Sample.substring(8, 1)
A3 = Sample.substring(9, 1)
A4 = Sample.substring(14, 1)
A5 = Sample.substring(22, 1)
A6 = Sample.substring(25, 1)

If A1 = A2 and A2 = A3 and A3 = A4 and A4 = A5 and A5 = A6 Then

SequencesFound &= "Position : " & i & vbcrlf & Sample & vbcrlf & vbcrlf

End If

Next

TextBox2.Text = SequencesFound

I would still have to apply the regular expression to each possible 28 letter string, so would still have to use the For Loop -

For i = 0 to AminoAcids.length - 28
Sample = AminoAcids.Substring(i, 28)
Next

And then I would apply your regular expression to each sample.


Thanks Richard for your input. I will make the relevant refinements.

Craig.Paardekooper
06-11-2012, 04:09 AM
Well, I have to choose a genome to search for the Signature. There are many complete genomes to choose from.

Here is the NCBI index page for complete genomes - http://www.ncbi.nlm.nih.gov/genome

As you can see, I can choose any of the following - Human, microbes, organelles, plants, viruses.

I have decided to use a microbe genome to start with - mainly because these are smaller and so are easier to search.


Choosing a Microbe

BY clicking on the microbes link on the above page you will be directed to a database of all sequenced microbes - here - http://www.ncbi.nlm.nih.gov/genomes/MICROBES/microbial_taxtree.html

Go to the "Collapsing Level" dropdown box - and choose - LIMIT BY PHYLUM

You will then see that all the sequenced microbes fall into 47 phylum.

I am going to choose the microbe phylum :Thermodesulfobacteria. This phylum contains 3 sequences that you can view by clicking the small + sign to the left.

I will choose the sequence Thermodesulfobacterium sp. OPB45, complete genome

This genome has a length of 1634377 bases. That is quite big enough to start with.


So What is a Thermodesulfobacterium ?

These are bacterium that inhabitat aquatic enviroments. They are found in volcanic hot springs, and deep-sea hydrothermal vents.

490

http://www.youtube.com/watch?v=D69hGvCsWgA&feature=results_main&playnext=1&list=PL62DD25A79A0C91BF


Viewing the Microbe Sequence

Here is the complete DNA sequence for this creature - http://www.ncbi.nlm.nih.gov/nuccore/334901311?report=fasta

If you would like the sequence in a txt notepad format then you can download it here -

http://www.craigdemo.co.uk/ThermoSulphoMicrobe.txt

So, all I am going to do is apply the search code to this sequence and see if the Signature appears.


Results

The nucleotide sequence forms 31855 codons that translate into 31855 aminoacids/stop signals
The software was only searching for any 28 letter sequence where the same letter occurred in the position occupied by Aleph in Genesis 1.

It found one instance in the first reading frame - Position : 7049
VQLQIEYFLLGHS1LLCLFRLQLVNLHY

And I found one instance in the third reading frame - Position : 8906
VFL1FLTQLLVGPFLSPE1V1LLL1LQY

In both of these cases, the same amino acid occurs in the same positions as the positions of Aleph in Genesis 1 v 1

Oddly enough, both instances begin and end with the same amino acids, and the amino acid that matches with the positions of Aleph is the same in both cases.

Having said that, the amino acid L occurs more times than the number of Alephs in Genesis 1 v 1, so the result is that no sequence of aminoacids matching Genesis1 v 1 has been found.

I checked all three reading frames in reverse too. In this case there was only one instance in the third reading frame - Position : 2949
IKSFTTYTSSFSFCSDISSILCS11SLK

Here, the aminoacid S occupies the same positions as Aleph, but once again there are more S occurences than there are Alephs in Genesis 1 v 1


Discussion

It may be that I should include spaces between words as a character - so I will rerun the test allowing for this.

I re-ran the test allowing for spaces, and the software did not locate any strings that match Genesis1.

My next test will be to use a different symbol for each of the 64 codons, and see if the same symbols occur in same letter positions.

Actually, there exists a 64 letter alphabet already - unicode - A-Z + a-z + 0-9 = 64, so I'll use these symbols for the code. Actually, this is quite a good idea since it does not assume any redundancy at all, which was always a big assumption when we were trying to use the amino acids as the alphabet.

jce
06-11-2012, 04:45 AM
Yes, a connection between Genesis and Genetics would be intriguing indeed!

My research confirms the results found by Vernon Jenkins but also enters into territory that he has not explored as far as I know. It concerns the idea of creation as an act of dividing the primal unity. The alphanumeric structure of Genesis 1:1 involves primes that are generated when unity (the number 1) is divided by an integer in base 10. Consider unity divided by 7:

1/7 = 0.142857 142857 142857 142857 142857 ... repeated forever.

If we now multiply by 7 to "restore unity" we get this:

1 = 7 x (1/7) = 0.999999 999999 999999 999999 ... repeated forever.

Similar patterns are found for any number not containing a 2 or 5 (the prime factors of the base 10 = 2 x 5).

So the process of dividing and reuniting unity involves "repdigits" like 99, 999, 9999, 99999, etc. And as it turns out, the primes found in the alphanumeric structure of Genesis 1:1-5 and John 1:1-5 are the very primes that are the facts of small repdigits. Specifically, the alphanumeric structure of the Creation Holograph (http://biblewheel.com/GR/GR_Creation.asp) is based on what I call the Holographic Generating Set (http://biblewheel.com/GR/GR_Creation_Set.asp) (A = 27, B = 37, C = 73) and the sum of those numbers A + B + C = D = 137 (a prime, and also the first approximation to the fine structure constant which governs the interaction between matter and light).

The product of the first two numbers give the third repdigit 999 = 27 x 37 = AB.

The second two numbers are factors in the eighth repdigit = 99999999 = 9999 x 10001 = 9999 x 73 x 137 = 9999 x CD.

Products from the GenSet are closely related to Base 10, and the set is almost closed (differing from multiples of itself by +/- 1):

AB = 999 = 1000 - 1

BC = 2701 = 100A + 1

AD = 3699 = 100B - 1

BB = 1369 = 10D - 1

Using the GenSet, we can express the detailed structures of Genesis 1:1- and John 1:1-5 in many ways:

Gen 1:1 = 2701 = 100A + 1 = BC = T(C) = T(B) + 2AB

John 1:1 = 3627 = 100B - C

Gen 1:1 + AB = 3700 = 100B = John 1:1 + C

So from this, and many other identities, I concluded that the creation passages mimic the mathematical patterns generated when dividing unity. It still makes a lot of sense to me.

It is encouraging that your findings confirm theirs, or vise versa.


It's odd that you speak of people "predisposed to the idea that Bible has nothing to offer science" given that you yourself have stated that "the Bible is not a book of science." And I agree with you on that point.

You are correct. It was not my intent to imply that the Bible is a science book, but rather the notion that it supplies ultimate answers such as the "Who" and "what" origin question answered in Genesis 1:1, a starting point rejected by some secular scientists and scholars. Based on that answer however, many have moved forward seeking answers to the more specific questions such as the "when" and "how" of it all.


The problem is that the Bible contains mythology that is indistinguishable from the common mythology of the time it was written. So if you interpret, for example, the idea of "stretching the heavens like a tent" as insight into modern cosmology, then you are attributing that idea to the common mythology of the time when the phrase was commonly used by other cultures.

Analogy or mythology? How can you distinguish between the two? This Book has not been entirely deciphered yet and you speak as one predisposed to its discordance as offering anything relevant.


And I don't think it is accurate to suggest that scientists are "proud" - on the contrary, scientists are the most humble in as much as they defer to reality and evidence rather than their own opinion (which is the hallmark of dogmatists).

It is you who have erroneously lumped them all together, not I. Do you not know even one arrogant and proud researcher who acts and writes in such a way as to demonstrate their superior knowledge at the expense of the unlearned?


I don't see how this kind of evidence could ever support the traditional dogmatic interpretation of the Bible.

Do I sound like one who has a traditional dogmatic approach to the Bible? If so, I have misspoken. I am humbled by its ability to lift me up with inspiration in one passage, and then utterly debase me in another. It is so rich in symbolism and prophesy that it continues to challenge even the most enlightened scholars who are greatly familiar with its content. If I am dogmatic, it is in this way, I am confident in God's extraordinary and supernatural ability to ultimately unify Biblical Truth with Reason. To me, that is a reasonable Biblical dogma.


I accept the evidence of the Bible Wheel, but I do not accept that it implies traditional Christianity is true.

You are simply exercising that a wonderful gift of liberty bestowed upon you by your creator.


It's a very strange paradox, but I have no choice.

Of course you do, it's called "Fatih" or "Trust" if you prefer.



Great chatting, as always,

Richard

Thanks Richard for always making me feel welcome here.

Your friend,

John

Richard Amiel McGough
06-11-2012, 09:07 AM
It is encouraging that your findings confirm theirs, or vise versa.

That is the KEY to knowledge. We don't have much trouble with confirmation in science. But in religion it's one rare bird.



You are correct. It was not my intent to imply that the Bible is a science book, but rather the notion that it supplies ultimate answers such as the "Who" and "what" origin question answered in Genesis 1:1, a starting point rejected by some secular scientists and scholars. Based on that answer however, many have moved forward seeking answers to the more specific questions such as the "when" and "how" of it all.

The Biblical answers to the "who" and "what" questions don't seem like answers at all because of the lack of authentic answers to the "when" and "how" questions.

Mere saying "God did it" doesn't mean much, especially when the same book has misled people for thousands of years concerning the "when" and the "how" of creation.



Analogy or mythology? How can you distinguish between the two? This Book has not been entirely deciphered yet and you speak as one predisposed to its discordance as offering anything relevant.

Good point. I am happy to admit that much of the language is poetic. But on the other hand, it seems hard to deny that the world-view of the Bible writers was the standard ignorant mythological world-view common at the time of composition.



It is you who have erroneously lumped them all together, not I. Do you not know even one arrogant and proud researcher who acts and writes in such a way as to demonstrate their superior knowledge at the expense of the unlearned?

I think we agree that individual scientists and believers can span the spectrum of arrogance. I was just responding to your comment that "God reveals His secrets to the humble and hides them from the proud" which I thought you were applying to scientists as if they were different than others.



Do I sound like one who has a traditional dogmatic approach to the Bible? If so, I have misspoken. I am humbled by its ability to lift me up with inspiration in one passage, and then utterly debase me in another. It is so rich in symbolism and prophesy that it continues to challenge even the most enlightened scholars who are greatly familiar with its content. If I am dogmatic, it is in this way, I am confident in God's extraordinary and supernatural ability to ultimately unify Biblical Truth with Reason. To me, that is a reasonable Biblical dogma.

When I speak of "dogma" I'm talking about the doctrines that you accept because they are taught by your religion. For example, the doctrine that the Bible is the Word of God is a dogma that you have accepted. The doctrine of the Trinity is a dogma. Things like that.

Your desire to see a unity of Biblical Truth with Reason is admirable. But I think it will require a total reworking of your concept of "Biblical Truth." This is what happened to me. I still have all the evidence I ever had for the truth of the Bible, but I just can't believe what the Bible actually says. I could have retained all the concepts I liked - Jesus as God Incarnate, Love, the Alpha Omega, etc. - and then just made up my own interpretation of all the problematic things. But in so doing I'd just be making up my own religion. I've seen it done a thousand times, and think it is ridiculous. So I just dropped it all as obviously not important since if God really is the author of the Bible, he obviously doesn't care what people believe! Else he would have made himself a little more clear.




I accept the evidence of the Bible Wheel, but I do not accept that it implies traditional Christianity is true.
You are simply exercising that a wonderful gift of liberty bestowed upon you by your creator.

That's not true at all. I have no "liberty" to believe things that I don't believe! This reveals the fundamental error of Christianity and all dogmatic religions that claim a person can choose what they believe, and are damned if they don't believe the correct dogma.



Of course you do, it's called "Fatih" or "Trust" if you prefer.

Again, that's not true. Could you "choose" to really believe in Allah? The Tooth Fairy? Santa Clause? Scientology? What makes you think humans are free to believe things they don't believe? That's a contradiction.



Thanks Richard for always making me feel welcome here.

Your friend,

John
Your contributions are truly excellent my friend. :thumb:

Craig.Paardekooper
06-14-2012, 07:34 AM
Rather than assume that the DNA alphabet must follow the same mappings as the codons-to-aminoacids mappings, here I shall simply substitute a single symbol for each of the 64 codons. The symbols I will use are A-Z, a-z, 0-9 , Ampersand and Dollar, a total of 64 symbols.

The frequency of occurrence of each symbol will be calculated.

If we assume that the most common character will be the space between words, then most frequent symbol = space

So this may enable us to divide the DNA string into "words".

Lets see what we get.

A : 771
B : 352
C : 351
D : 166
E : 349
F : 129
G : 184
H : 125
I : 364
J : 165
K : 296
L : 88
M : 135
N : 42
O : 98
P : 27
Q : 277
R : 188
S : 122
T : 12
U : 152
V : 154
W : 153
X : 95
Y : 94
Z : 11
a : 138
b : 101
c : 91
d : 6
e : 108
f : 39
g : 73
h : 10
i : 390
j : 156
k : 447
l : 136
m : 165
n : 72
o : 214
p : 93
q : 391
r : 196
s : 690
t : 319
u : 137
v : 36
w : 199
x : 115
y : 115
z : 122
0 : 172
1 : 111
2 : 11
3 : 8
4 : 16
5 : 19
6 : 262
7 : 202
8 : 92
9 : 39
$ : 137
& : 91

The most commonly occurring symbol is "A". If this symbol represents a space, then the resultant code divides up into "words" like this -

ksI | 7KaCICQL8GQLUWq1w7Is$6 | sxEDZwdI | 6N1 | RQGq&uICxuUCIKxMWqw | asa1GowqisqMIqoMD7w | 8EsuIs | DPqwstVYwoCIIWjqZIpMM$67EQWsia | wu | NO$syqw | eiqMzipKeww6Xs8iDMiEi8u | $C&samCcpeO$qMCIQt$Qx7NiiCaepu | EqiLLtiD3Q$LMxu | swtKsq$yuIECCxwKn | CQ$twiaoqwEf | ECuiEEuo$scOI | aQDsEWpxEosKwqQC6S7EQQ$CCK7EqUWu | gb6ssIK6mtgssp$jq | WixOMwjCe2pK6$uP6pEwUeOE8CIf3SVCEswWJqERCgswCOxwJ$ KswVQqpOwLKIxdOy6 | |

&PY6xuI | QQR6sswCbEO6oOaIi | D7rCCrtQCswKSQEBstwmQcMIiqEsb | wqsCs7uD8CsOtOuiF | twISsxDQpwwEwKsiwGqw0e | RBkI | sVE6sQE7s6teEs6s66Q | lCBG0BBB | qlafBzyz | b6tw6$Uq0q | tazS6KkURiyRt&V7rzrj7tR | Vgk7&IUqD | Btq$lqa0Io0$6tuytU0f78 | s16eksI | ssK1E | CRR6RBtC0IBri77syVr1z77ft&IsK1rjo6CyazE6UUQR17s8 | sr1RFr | sL2URGk | vBQ | y1B07rE7UIj6qy | sUqRQRSshqQ | yBVS0t6$6b | $uqj6qQlwsIrRzDz0Ii0krrq | VQBkto7t | bq | 0wks | BJQ | K | 6a016&6qQ0s6sU | q6tICk6 | 7qBE0s9060t0i0sWL$qttriBXB | wUQ1kstIz0$y8ybtxIiw$QQ | kqtsI$s$D&aCiDD | 1Sz7$1w | Sysia | 0B$s06Jzis8x6w2 | s68i6eB1riB7$g1q7Cist&EyoD$elR | cu0qqwsaosU | 0R6&uakRcUsqR6CKlEkELbEiqsDs6GI$7eE | miwLCsusuiOIKeES&$wuUCODei | Ctu1otsL6Iuys | CeMmCuL$ | Ytuwqsiox&OswEww | ysRCxIu | i | Rsauy$IoeKxe | wsuKUeWy | MzR1m66siC | sCeow7&eqsEf | &mmDuugIKa | |

KrL | im$wFQaIEWFowL | s&tFiIK6XCIEPwtuCIQ3 | OtsLq1sPEwqXyW | Qtxct6swKwqECqazJiWCqXsIs6rKeaeI | qWsJwiCX3sN1kX | TnC4UxKqlqi | L | TnD4Uxs7x&C | wtMOOKxv8TjOMDUB0K7&ub | KtQjEB7bzIKVVtVtBkJQsBFtt | |

kOkVRb | keBk7Jw7IajRjtBz8U7mtHmtbtVb | &$vVE1Iw66Bj | zuV | tkV1Jk6KVDVrBIsYQBJiIKKa06sRy | 6qs | Q1F | jKrDci | B1srb | sI8sqjBXyD7JBc | KqJVKV | 6sbkqkksuotEku | emIJtqiis | QI | yo9CEiiIk | v | TgsJiKKCrIqekrGQKRi | y | imFiIj1Eyileq | ksluBG | kSwIk | 7aB | krqUI | BsmDE | Dui | a1iCQBiBmU0MRzsISgqqkBiska | qmQ | iqjEVD8Bzsuyyt | Qk | Cmx6sr0eRRsUBii0uqisqyqW | i7 | i | q | 6n | cmsijR | irBE7uz7 | VU&IV | g$j | tkE | z7eSi | qvkcqsb76CiBi0&7I07Iy66ijDxsjjmsrUBkkEUqiRkBkqzBBqyrkCEQR0k& | ryfyS8&UtG0l0 | 6s80tqrQ08Vs6Uqw68R77UR0 | 0bEitKSjE16Ilmk | jUU | x8StCj6lKRyqS4I2wtaSktKk6$7u0qRIRitrUCQscksCs | 8FsLDrECUCECsqihkikii&UsPk& | lWi0I | mUiVqazi | Vti7 | RBiSsaClUCkIkSKzE0a0sjUsL9sujzi$ttBkiBiD | s1s0qtUC007rktxXBDB1s | Itqiwqs0jHunRliB8z | tSJ1QiM0Rt7IriC11kyDij610xKEkVUIct0l7Vi7ukx1t1tLCs Is$ | aCIxgEIeKCIaeJCgOIIg$EEcV | e | sbSu6OIEQzCOx$eQQ$IQeys8&qUKqQIqz$8icMoKwKq9qyqWXR6ryTwIcgaedPt$CU | QCausMzq | ukIkqxC | ikscs7 | jiq68 | UUqUQDzqiiq9zQ1eC | zF6kq | kgrtbmB0yQ06qxtziVrE6 | y | FtP&U&8RDCkokDjm7rkiV3DjtCRRF0RaDisDol5$ | iB7Ll0i6ICzsQ07K1My8lyk1rS9sQitDlaBj60w0kCCCiDg76s qUsGo1B7JRRiKSa | 7IsRkkS6His | j76BkzSUkz | Uk1r5oGnaSf76iurtUeCkUtMOy6C0F40k7KDeCiksI0i&t7rrCjrse1tUs6BsB | oUC16xtVisU$U0MSxYJkf6sr | sqqtKEzZ | K&8riwws6s7EzWqry | U | E | 8 | IqE7y77VqijSq&K | BiVB69kKlyz6sszsk7MqwV | 6s1wDlk0jF47i | 15KlUUzys641KoCD | yDN67tK | &9s8ysrji | B | s9BsH&5rmMls | sk | JE&&tR177szzii7K0lR$soDj0XkBHiVBzQyr7sZu0R7siyqzDkjkXs kW1x7QyBry$RGyK0Xk | Kok6 | rBSa | kz6sl$SaaSt | t4k | k8$ | 0s1qfk7I86R0qkIsyslDnzB&kjirH1J7toz6y | jDwXjs7VKlKok6okCCBsu6E1cszSqr | m&kM0777CiV75kit | 0ks9oykzjBbQy | UztsSqBQlkwYqsiBkjEiMzssClijzkk | rys11uqCk176s1mMrisEct1FYe1jc$WRyQiqJ0kSqlit1t1sR6 iD&IqIzrSskjC | sj1k56 | kuY1VqqpkB | r5kki6Wr7k | 0qZ | kEzr | rsazkI | 7sCoQQkrbyL5rtlfssQ | jQ | nitrCCKVstKutezk9ks7bs7qByEkIlFE0iX | sQKstKjXks9kqRys69kroqYOsa | ORkwVRiRRmtEsJRmbmRNQ | 6sDKKiFIiksttRqX0t$6ktaBXsIto7IsIik6sqkfRoqtXsaksJ 7qB | iWkJis8u5qtwrjsK$scts8fYRKxsEs | lKrktksrzUkqBjk&Kqq6q7V | cKVc | R | kqxK$kt5uILKY | x8ERgK&gs6sk7E | q6kb | eYEKqjjIksabigtbsrsqqs | mB6Q | tCBFi | BBysU | B0rBB | RqB | tV8DK9 | | VBBiKttzEkKKMYj7dmI | JiJqiBibtX7MB7UbPLvrjRKq7nrXqJ1iBjBsKrx | Bq&q | EJ2 | iscR | O$qIDrBK7EJBF7ws9htEUkcQ1KQQtNim3CeWCs | DOl | DGmHl5iVotNGq | zSqJBH5JmOqsHox7DG07MmI | PGktFGkvHKsiFWvFExsvpMmGltKjnJBmpxqKkjyxNWCsYGlqHC QpsM | lprGruESk | WElw | CsNCHEFpu&&Cs | lPXiq | Cs | pu | HsuxC7mpmokG7$yCapKCIos$M | k | EnSJGJpvGkGKn | i | lGIG68ESq | itK | nEim | EoVHpCs | pwC7rqKy | wx | lltoxCoNHnnECrjo&nsxFHFn | RFjBHGskgmfo7BEi&irEBDMCsW | lXqkqGqIF | xxW | Eok | | D$rolgo | oeBHiaEBpussqfGWlwMotCHCqpWCHpBG6 | NpQprKFptOioHYoE1EE | C | itmCQWGC | WksJWGCF | kvHzoslmGok | xxqsqsOqEktosi | pM | GtsqCM | ow | CqlCxEFEiI | EinkOtGESEmUEiXsur&nsYBmFnmiRZNnsoCsWQiJ | G7$qqCwi | HGFGrpF | YCsQHpwjowqkCoIioMWS | prp0oES01E | yqalEC | k | RkqjriaiUKBIBL6l9tku | | bbQ | | siBB9 | b | tBks78R | FsJQ | kqiB | s6s&eKRbjV | ssVF | 09s66zxLs9UM | Q | t6KBiBBB0wi | QlsQBRKDItoQDqQ1qKrkNuRiRilJmC | CgUQQK6CIEETyEWWSt8MQstM | cIQIfKaSWLUEWY6c7K | hDD0UEfICgws8S1o7eeEJY$qGCgtKFJYJWMYoK6IWtSeQCC6I | Qcf | eYiS$kQcuS$wsoWcQKaSk | Q | | sqQ | I | QC7slWh0QxeIaIu | XI | ksYr7mijnoro7mls&G | kiHnv&mqlwmqounIHupu | GqClD&wGBEms&owpCCHEGrnHFFoOqfpSDIlDtsYCIitmMWksnQClXDQpGmm0x&jDBmxmCiqGExtMojHmEwxGIGjIDpnEnml&P&HSiu7mHqkrmJoCIHmK | lXF | | xmMYqEGsSKBnrEHGGormF | &mo79xLE | pMEmBDlKtESkZsJpGjs&xCkn | HBFnsSSEDEzEFCCBktEFGlmuRpHntpjKHni1vEDXoKslGWvppY ilwkS1Oks79kF | irE | mosFDiqMokNoXFYBonGkkFoWmFouECtOaDmEGLYBDFHGlmI$kt iGjxsoMlpgkIEpe0qQCWnHo | vDOtD7moa1k | RGRHIj5Eki | Rt | WonGBoxxCHnovHCoGFB | SoEjRkIIMXH | 1ECiIGkmWkHBCI | pEEmpwWYBotWEYlYkoMoouoxqZFGqmGoLLEpMkQuEDsuCI | xskQokE | WGHclKbRDYsI | |

Wa | CYu | EsscUwsaqsjos6kkqRzrsib | Wkt8DkskK$UolusKYqkX | ks&aijD67yKI | rsrm21ssXkst7kstKqnEksiBzrBB | K&QIrm | ks | KQBslFEp6os | k7EBjmjkUB1Ei6tMV$kI | ssF76sI | IBBDUqrB | lqY | B6 | KsRFEVYiq | |

kFB | IiwrttiJDkKBb | 1Bk7EVitKsJ7bQqsqDBIsjkKDBQ | FViEKJYUKtamsVz | 7stueizkRsok6stsqRERyxUilB | |

0sRt$ksbtkBXyQyoYtskqiR0kRcVs&ssBKkI9k$ | YsqKUostOs7 | |

s6ksFRo | BssJrksKs$6sqsoktkIiEitNrktOQ | KqEmsiVQE | E | qXci0scVwKGIsskqKcsFns$sIBY | QWtwwssCksKsqJ6tegIWKstVsqGkxMC6kKG6sse0sesqsax6$s sqE0kiSCsiCslEwMW8CUBQIQQ | qQOsE | QWEDskV | QQStM | O | UCqCkQYq | sbQKC | 0$QGsIXmXCIsKqKBQD$wkEWQ0gLssW | CWQ | QE | 66qKBCsk1eCQ | sQu | Fck7kkQ | WteK8E | T$su | Qe0eCcUQJ0JR | bEECvo$w6ss1estMIIsGIswsK668BKtQQtwsWswotgUaQESi | VG0Kgs6aXKtausGkKsu6V0stc7KsU0tJcCs8$Cs | ssQzqDIIW0c6MKKgGqIssswsOksOiQG60iBpsIBJkKICqQ | kkI06rEqwsUs | &IKWSyfED | ssLRGD0 | CBi0vs8jsK | 6skI | sV | s$6Isa | ssE | 66tI0qsVQB | inECz711rRBQQBXC | C06W | o | |

row | k | BRo6IrE69sR0raj | 6svsV | C0U7MkTitE7Uct | BBt&esI | &taYjSssi | kVE7Iikst1 | ks | B | 6 | iI1Lw7c76srWkt$qIsVEsIkRRY | N | C0IrE6s&rbECSq | k7$sKDus$4sMqwQCkrq0$q | 6ss5K0tK0qBoCzibkC0LkcoQQCDwakbCE7I7RFzjFtU6sQtL$s Rtw | sCC | sBW | s6ssaREsqq0sQkBC0IVs$KiIi&ItIs67it | s6IstsKkCCQfssz | 6j | ut6sEqs66s$tqJ | rEk7saQSkSU8CC | L$seLpCMWaW | Cw9QKIMipWw78 | 6 | 8KuQICCfi | CqCsYtuKMCwM$g9Q8IISEJeCt6 | QmgsI | fCxEwcEiKwzEt6qMEwqsDow7G | OIs$uK6qYW | sW8q | uOM | QqWXiBsUwe$6sUWiwIwqIc66uKxyuEqw | CstOriECsq78s | iCM | ceG6EgwCOiEEsrn6ExYtEC6DMiRiW8TxgsEMECzgMswetwxK6I EYWEiIiwS2s8uibwxOsq | Gs6IutqksPQkqqoK0xtF | iLrM1tKs7kUgIiOJJIPCQJYJKp$ | PxCwsLttxB | |

Wl | Lw6kDprIlJGlssr3 | JI | jpem$eIGloHl8OIBeOM | NsIDs | FqJFK | LxgBHwqkWnotKDkslGtns&osO | WKEcprGGQ | DqDWLIPYqlpsLtuksL | D | GLMK0ottGlaKCrWJBLwkLlIk7ECx7q | KsU | OtGrzVH | lKIkqIksftOi&lsCGFCCB5tsLLJpHqk&rD4ICksHVTNHLBW9K | Fe | BXIJrQlKrEKFHtsEiktWIKDwttDv | IKQKlwLBH$JqLsKWINoqOJI0CDsuLMCx | k6lJCrHJkWNYahMQCCLxy$Msu | sI | gXVyYoggSKY6WCE | EcOMqIXEw66i | 0qEQbaQ0w8ESs$IS&0$Ds$K6BaCs$iX | s6Req | | gvRsGS | cQ | IIdiQKOMGG | CL4&q | CoesKVQScwi | CeK&KUQEGISQO$g06uIf7gOwrRCg6IRIQ | sVWcMwcOUE | HwkCqXC$0gUI | 6e | K6 | Bs | sV8RXJXKsaK | Es$VQQQ | Q | sjEEgKba0wIISkaQs | ECsYIBWOcorCoWL$mWa0Mwco6Ok0Q | Q$IKaMSI6CDQ | U | sgqCaMYQKQQQCSaIQ$US6ws | SwU | ME7F | $6QNIQSsMKg | CoOJo0sJzQWGlw8QYLIRIs | | qQQq0k | Es | 8CBKI | sMGtMCGqsH1kenCIWCtEHD1xMuGrkwOCmD | |

Sl8EfGmcBDsiCqyujowlBG | BGCXHNiEmksisgiNEHOtmoN0JmkBkGjxME | joslBEoYHirE5iMCElnCkx7kqEHs | H | lIGC | CiX | WDFCk&mkmqCmEECsLxswNEkotoxClMkmYe&6 | nEytkQGEEwlFEH4 | &poOr4 | | HoxkOlPk0 | Cs | HxOttwmCHmBCCBWkw8UoGIMDG | GloH | | xEGlDtn4u&&Bokq | G7sOt8u1uGHMEQosmoxHFHoERHsYlXisPEWmGkBFFDnUCkycXm WSSls7E | mGkuu7QElC7PiwlCkUHJBkOIEGrCoMGFE | QHHEHxso7umtGCES | SBo&FiHoojBGBBGrokBG6EiikMYFGkIQ | |

XIBEEC&LGpWxw | BDoDosCtG7iMpHpKxiBFH$mSkGGzE | 2DpEOqGmiovHBHFBGkECq | DX | oSEElCE1DVBCkkPmoIxwC | GKIEmtwvHMisoEGVHm | Cs | GBEEHsluHsCsESBXaW | wq | CkKBBEiKIkqjBBV6 | iR | bt7v | KbstMoXmFkV0tViktJst6HIbmL8qQkq | RExLJDRRzsrrRo | aQks | ktBRyIlRI1UEqryt6B67rB7sqBkItz0jz | QcVt$tuDKP | sk | BtRiB | ih | tm | QkRixkajV7UwVyUI | BKVE | BWDtJsKK | 7tQ0 | |

VmJD9 | J0sVus6ob77kak9 | D6byqnjJtXY | Jm1tNKrRtV6qVJrjqjz78J | rqBzqB | i7L | rXy08BcVDikrX | iJ | | U | kqEBjFF7 | rV | XY7rBiji5JkIK8D6tBoYQDRs | Rbrjiqj | ND16sxIrqV0BmVbyR069ssKqB | |

8DstK | lJBQqB | kqB0sB1oQLL8q7DVm6ktjJBzj7r1b18stKW | MksBn | JFFkkGqBiJoqBsI | iX0&yIjDrBNRiF | Rik6Wzk76Kj6qabIz1JzFK&bruQKUqnBBUJoIkk | j | rRsHr | J1r | UtV1iiBzIVkqR0kBDiQbBiK9DQB | zzBKBVIB0qJRPVWzBBiV | jnIQQBr | utKBtF | | qEBibF1Us7i | Mm7sXECmMCJqfkLF | NpkcSlGlxuiImj7EwCEXqFCprFHMOslHkjmeDHGmGpqFktOsJm HsSkHnGkvHW | |

El | Emo | WE | xElNCvE | G | GIGIMi7O | iI | mV6wupmI1itEkslG | pjVoXiEMXHBGjCHjIm | koKKHqltknYQopXrosSiEk | F | mpMFkvJiIGBmEClGHpwguEW | Bk | iCMxsWwoCjXmokv | kIoCFiI1mIEGIiYI | kBCkBCtIB | QCs | GlBEEmIpPpY6EoqIMHGl5LntWiopNiCtGDFnotpGBiZWiLECst EWGDlB27GFptuiiMCoSntHM | pCqJCsi0PmiGipkuk | jDuMzoIwkqn | ECr1sCbofpekkInaFGsCUjHoGImsPpEEuZu | FmJCrE | | oKnpMG | oEXJ | Q | i6kx | 8FotkBCIHtw78EGoTBic | |

CuEpYkOrFGo | CsIoiekXEC6vtKj | JKQSgJFoGeY$wYIV | |

KOwUQ | DJQMEe | SBQKVQ | ID0OKcYICQ | Q | KaQ$iIR | ysIsCg6HKk$aCIq | CgKsjJow8swkOaKg&MS6UgfQsOKMWxg66faOwi | saSi0O | QKaCI0vEeCRnsswQC6W$eCbIIW0K0$ | I | | 7BSsI | srL8K04EIQEQGGZ$tsEas8CuCCq0iISksrEQw6CM | IsRsL$yWskcOwKYkwwsqR | Ss$6UciqGQci | EsK0bE | CBofmf0$eKkiId$iWq | CeqDgJ | sDsW&sQaqIIcQbEE | EsqQSI | Clcroi | CVSwsE8rWbsgUuSg$qqJSKY6EFJC8YWIYcq0sew | 6Q | IFCIUsiYlKQYwJSWOIIsb4&xM0kJKuI | Cqi | GEe | C | w7oeohIC7pIFHSWkEQFm1CjIkktIoMEECtunQHwtI | iGIiIF | |

wuoFkWGqV | |

GDiGGmq7nElsKFkIB | NikhsFjDpkqj71BmEosGBDmCoiHO7&ksPxXGpmwkao | |

iU | CsOtGqou2OSkuGsC2GiouB | HkttKJyxWGk6xu | Cm | gse | 0pMEwJ | oirYE$xwu | | 0Ds | ooeEHGrCImxoxM | GsspWjHoKsqElo | mqxk1DxCGzCHmoo7wkWEiqlkt | CpVBE | ECKqox | EkB | HuCiGGloseH5Lw | pkI | lmwIRGqNGXGkHGWCEjY | CBB | a | ORri6qIM | JVk | uV6F | Dkssy | RzBkVkrEVDz | qtyBiU | kXrj1lNmQkNHq7 | Vj | irjUJ | Qt | bVQkqyzJyXBmVBiVrym | I | jjjcDRiNo6bqi | Vq | sRKBiJBYBB | y7rQ | UsiRBUUpsFDksB07bEiisRBIBkBBirR | kq0IJF | q | xEQYkVkVQsJ1qbr | kVDa | Ji | XksntE | vRIB | sqBqt | RsDbq$q | sqH7Us | |

k | BEDJI6scrVqqBKI | J | kaHVkqq&sBbBRzqkfi | IJBkJmskGszFBRBs&EQQmibH | 0& | BoslqtQBir1JFbsiJQkByqiB | q807VJksKbqVD6qEQuJB | ysbzQQkRitIiXDiEz7qbsrEnK&7rN | JjbamVbqsVKVRi | csHLrz0sbRmrj | BFjQjLXRk8VIIzmqjLJRi | cJLVjLvKamtkcMIRiKUqXJJsVURQLqUjsBQqiILJXiFnWyBBX | KaqLD77yXujUs7biDIO | Xi | 8IaBqK6LVEqqyR | XiKr | 1RiKjI&biBjJJBiBV47JiKVy70qEImD | BRC | sIWeOIQeQeaI | SCbCgKIgMCILBW | EGtW0aSKKUOQY$kc8yGrEfGSJWg6csV | WCiQ$q6fKUWaWgf0fKMQsIsaW9KK$ | Q$szWKsk9SCKOc | CIeCciR | Qg | JQcaCSJIst$iG08sVSsJQ | LMJSWQXI | rjFYI | JCC8iWKKSkq | ics6wM | i0sIw | i1k | $rq$kQk6ssas$eQk | | cw$ | R | 8R6bIoq | VksIBQ06w6qi6M | ssQsstsqqtc | 1Vri6BCka&CinD | Lznt | b06oqsIVC0qVsMR$qrYzCQl6c0ao | HMjU8jsJ6t$ | s6IDks | 6$sISqsqse | XVissIkUsVU | 0qCICDmVzbVmrRtrUq7jHBFjR | VVQIraEkU | |

VByKt6JJ | ll | XtUXDXaBiHVyiEQkJB6q9 | kJ | Kt | BJymo | btUXBRQBtQE6vaBkIVj8D | ke | KoBBJ | vp | XtUXDXaBiHV0r | | oIF3UzUkJ | KtWJJait | akUbHX | BiQBzqI | saD$VJQqIznkq | kIB | RBEUbukB | kRFjU7biazkqBJr6qzaByKVim$b7DlKvE6OR7 | qJis | JRkjbK8QiVzUzJBHqEKb | KqktFnEz | RB&8kBqERjWRq7qXzmBi | zREytX$qMJsjzKq | OrJE1Us9BBbtEsUtKkt9jqRisjsibr | iByRR | iVm | kJXR | C | CjkVaBis | | rsBIy6U | iBB78XjBiqrRDLks9qKNzs | sVtIlNLejijc8tIK | B | tI | ukFou0rDkq1JtRyy1BJstnjH1Qt9t8Qzt9zQE | mRR6tF67K | J | 96lkJjz0ltBBzy | BmB6 | 7m | sLF | k7smnIB | jUm6JstzbBDwksRq | QQi | HkBEB$t | UqJ | IBsYiBbaJ7 | ktRriL | ktja | byRaDRmisUr | RB7q6kIrRQprBtRMsaE | xB | iUqmIikts6OMqKkTwbsJWaPwKbceSOMeGWcWQeWYwgkiWCiYoa NastgYssKvCcIYFKLQ | qQbKQbIEeMsVY$SK1UsqMWackWWgKXcsQwKeMs78saIKgfmUE$ FK6i0I&CKfKICVgSIySMIFKEWqSgwKewWeEgLcaahO6c8WqQHO6MsgacW Y6KE0uWbCeseKBa0kgObIYws6wNsIcarou | aYKqRKy | K6U | IGk$&wswkKsE | sts6sIYYoSG6IC6seEWt6ws$BIG$lFElFHIOY7iqI | SKR

As you can see, this generates a script with many different single letter words - which is not characteristic of spoken languages like English. However, most of this DNA is Coding DNA rather than non-Coding DNA, and language is probably found only in non-coding DNA. So I will create some software that separates out the coding dna friom the non-coding dna, and then see if this result still holds.

Craig.Paardekooper
06-18-2012, 12:06 PM
Here is the complete sequence for Chromosome 1 of human DNA

http://www.ncbi.nlm.nih.gov/nuccore/224589800?report=fasta

Chromosome 1 is 249,250,621 bases long.

10 million bytes = 6 million bases approximately, so the complete chromosome will have a download size of about 400 megabytes, which is quite big.

I have searched the first 6.5 million bases of Chromosome 1 for any pattern of aminoacids that would match the Genesis1 sequence of letters.

There is no match between aminoacids sequence and Genesis1 letter sequence within the part of Chromosome 1 searched.


If there was a match then in any 28 amino acid string, the positions of the same letters should be occupied by the same aminoacid. I isolated every 28 aminoacid sequence within the first 6.5 million bases, and none of them corresponded to the 28 letters of Genesis1. I repeated this allowing for spaces between words. No match was found.

Craig.Paardekooper
06-19-2012, 11:50 AM
I have obtained the entire Y Chromosome in FASTA format. It has a size of 57.7 megabytes and a length of 60,561,044 bases

I found it here - http://hgdownload.cse.ucsc.edu/goldenPath/hg19/chromosomes/

The software will convert these bases into an array of codon triplets, then convert these triplets into a string of single letter amino acids. It will then search every possible 28 letter string of amino acids, to see if the same aminoacids occur in the positions of same letters in Genesis 1. I will also have to rerun this to allow for a space between the words in Genesis 1.

I am not sure how long the program will have to run - most likely all night. I possibly could decrease this time by using threading. Or I may break up the sequence into 60 shorter sequences, and test each one in turn.

Chromosome Y is the shortest Chromosome, so it is a good place to start.

Richard Amiel McGough
06-19-2012, 12:12 PM
I have obtained the entire Y Chromosome in FASTA format. It has a size of 57.7 megabytes and a length of 60,561,044 bases

The software will convert these bases into an array of codon triplets, then convert these triplets into a string of single letter amino acids. It will then search every possible 28 letter string of amino acids, to see if the same aminoacids occur in the positions of same letters in Genesis 1. I will also have to rerun this to allow for a space between the words in Genesis 1.

I am not sure how long the program will have to run - most likely all night. I possibly could decrease this time by using threading. Or I may break up the sequence into 60 shorter sequences, and test each one in turn.

Chromosome Y is the shortest Chromosome, so it is a good place to start.
What programming language are you using?

You could skip one step and go directly from bases to single letter codons.

And I wouldn't add spaces. There are ancient texts where there are no spaces. They are needed only for interpretation, to make it clear where words end and start. If there is not a codon interpreted as a space, then how can you add them?

Also, you don't need to restrict yourself to 28 letter sequences. Just do a search for any substring anywhere that matches the regular expression specifying the same letter at positions of aleph in Genesis 1:1. This way it doesn't matter which codon corresponds to which letter. On the contrary, if you find a verse that has the same letters in the aleph positions, you can then check to see if it has the same letters in the bet positions and so on and you will be able to determine the letter-codon correlation.

Craig.Paardekooper
06-19-2012, 02:03 PM
What programming language are you using?

You could skip one step and go directly from bases to single letter codons.

And I wouldn't add spaces. There are ancient texts where there are no spaces. They are needed only for interpretation, to make it clear where words end and start. If there is not a codon interpreted as a space, then how can you add them?

Also, you don't need to restrict yourself to 28 letter sequences. Just do a search for any substring anywhere that matches the regular expression specifying the same letter at positions of aleph in Genesis 1:1. This way it doesn't matter which codon corresponds to which letter. On the contrary, if you find a verse that has the same letters in the aleph positions, you can then check to see if it has the same letters in the bet positions and so on and you will be able to determine the letter-codon correlation.

Hi Richard,

I am using visual basic. I am going straight from bases to single letter amino acids. The computer creates an array of codons from the bases, then replaces the three letter codon with a single letter aminoacid.

I will miss out the spaces then. It occurred to me that there are three possible reading frames for DNA, depending on where you start reading from - so I will have to search in each reading frame as well.

Thanks for your suggestions

Craig

Craig.Paardekooper
06-20-2012, 11:33 AM
I searched for all 28 letter sequences where -

the single amino acid occupied all positions as the first letter of Genesis 1 - positions 1 and 7
the different single amino acid occupied all positions as the second letter of Genesis 1 - positions 2, 8 and 22
the different single amino acid occupied all positions as the third letter of Genesis 1 - positions 3, 9, 10, 15, 23, 26

The chances of all these conditions being met is quite small. However, a search of the first 3 million bases of the Y Chromosome found one instance -

Position : 515305
TYLYLSTYLLSIYYLSIIYIIYLIYLLS

However, though promising, you can see that the first letter occurs twice, the second letter occurs 8 times and the third letter occurs 8 times. This exceeds the number of occurrences of these letters in Genesis1, so there are no instances in this part of the Y Chromosome

I will proceed with the next batch of 3 million bases.

Richard Amiel McGough
06-20-2012, 12:14 PM
I searched for all 28 letter sequences where -

the single amino acid occupied all positions as the first letter of Genesis 1 - positions 1 and 7
the different single amino acid occupied all positions as the second letter of Genesis 1 - positions 2, 8 and 22
the different single amino acid occupied all positions as the third letter of Genesis 1 - positions 3, 9, 10, 15, 23, 26

The chances of all these conditions being met is quite small. However, a search of the first 3 million bases of the Y Chromosome found one instance -

Position : 515305
TYLYLSTYLLSIYYLSIIYIIYLIYLLS

However, though promising, you can see that the first letter occurs twice, the second letter occurs 8 times and the third letter occurs 8 times. This exceeds the number of occurrences of these letters in Genesis1, so there are no instances in this part of the Y Chromosome

I will proceed with the next batch of 3 million bases.
Thanks for the report.

But there is an error in your statement that the second letter (resh) should appear in positions 2, 8, and 22. It should be 2, 8, and 27.

Here is what you found, with the Hebrew letters represented below. The hits are marked red, the error large bold:

TYLYLS TYL LSIYY LS IIYII YLI YLLS
BRASYT BRA ALHYM AT HSMYM VAT HARZ

As you can see, your program erred on the second letter (corresponding to resh). It is aligned with "L" which corresponds to Aleph. But position 22 is a Y which corresponds to Resh so it looks like you programmed for positions (2, 8, 22). You need to rerun it with the correct values.

BTW - how long did it take for your program to process those 3 million bases?

I like pattern finding! I was wondering what we would find if we wrote Pi in base 22 and looked for Hebrew words. It might be fun.

Craig.Paardekooper
06-20-2012, 01:48 PM
I reran the code. This time no instances were found. It took 7 minutes to carry out this search.

I should check the two other reading frames as well

Richard Amiel McGough
06-20-2012, 03:15 PM
I reran the code. This time no instances were found. It took 7 minutes to carry out this search.

I should check the two other reading frames as well
That's pretty quick!

Are you still restricting yourself to 28 codon sections? Why not just search for any substring that matches the letter distribution of the first 28 letters?

Craig.Paardekooper
06-21-2012, 02:15 PM
I found no instances in this second batch of 3 million.

Krakers
06-22-2012, 01:01 AM
Dear Craig,

In 1974 astronomers at the Arecibo observatory in Puerto Rico beamed a radio message toward the Great Cluster in the constellation of Hercules. The message consists of 1679 binary digits, i.e. a series of 1's and 0's. A receiving intelligence is to arrange these 1's and 0's into a matrix of 23 columns by 73 rows and then translate the 1's and 0’s into contrasting dark and light squares. The resulting digital picture is then to be interpreted for meaning. Our astronomers hope that if the message is received by non-earthly intelligences those folks will be able to decipher it and conclude that "intelligent life" exists on the third planet of the star from which the radio beam emanated. Consciously or not our astronomers selected numbers to define the size of the information matrix which will reassure any receivers of the message, who are familiar with Kabbalah’s mathematical methodology known as gematria, that we are indeed "intelligent life", since 73 is the numerical value of the Hebrew word chokmah - חכמה meaning "intelligent" (or “wisdom”, or “science”) and 23 is the numerical value of the Hebrew word chyah - חיה meaning "to live, be alive, exist". (Definitions from Ben-Yehuda’s Hebrew-English Dictionary)

http://en.wikipedia.org/wiki/Arecibo_message

Perhaps this method should be examined? Here is an interesting site to that end. http://www.arcfn.com/2010_06_01_archive.html

Regards,
Krakers

Krakers
06-22-2012, 01:30 AM
Dear Craig,

In 1974 astronomers at the Arecibo observatory in Puerto Rico beamed a radio message toward the Great Cluster in the constellation of Hercules. The message consists of 1679 binary digits, i.e. a series of 1's and 0's. A receiving intelligence is to arrange these 1's and 0's into a matrix of 23 columns by 73 rows and then translate the 1's and 0’s into contrasting dark and light squares. The resulting digital picture is then to be interpreted for meaning. Our astronomers hope that if the message is received by non-earthly intelligences those folks will be able to decipher it and conclude that "intelligent life" exists on the third planet of the star from which the radio beam emanated. Consciously or not our astronomers selected numbers to define the size of the information matrix which will reassure any receivers of the message, who are familiar with Kabbalah’s mathematical methodology known as gematria, that we are indeed "intelligent life", since 73 is the numerical value of the Hebrew word chokmah - חכמה meaning "intelligent" (or “wisdom”, or “science”) and 23 is the numerical value of the Hebrew word chyah - חיה meaning "to live, be alive, exist". (Definitions from Ben-Yehuda’s Hebrew-English Dictionary)

http://en.wikipedia.org/wiki/Arecibo_message

Perhaps this technique, applied to the human genome, would be worth examining.
Here is a site that plays with the idea of messages in DNA.

http://www.arcfn.com/2010_06_01_archive.html

Regards,
Krakers

Craig.Paardekooper
06-22-2012, 04:02 AM
No instances found

Craig.Paardekooper
06-22-2012, 04:28 AM
No instances found

Craig.Paardekooper
06-22-2012, 10:09 AM
Position : 1374017 + 24000000
LSFSLFLSFFLCSFFLSFFLCFFSFFSS

This instance is a match for the first distribution of the first three letters in Genesis 1, but does not match the other letters in Genesis 1

Richard Amiel McGough
06-22-2012, 11:27 AM
Position : 1374017 + 24000000
LSFSLFLSFFLCSFFLSFFLCFFSFFSS

This instance is a match for the first distribution of the first three letters in Genesis 1, but does not match the other letters in Genesis 1

LSFSLF LSF FLCSF FL SFFLC FFS FFSS
BRASYT BRA ALHYM AT HSMYM VAT HARZ

This brings up an important question. If the data set is so large as to allow a few random "close" hits, how could we be sure that finding the whole sentence would not be just another random event? Merely calculating probabilities would not be convincing because any specified 28 letter string, no matter how arbitrary, is equally improbable.

It might be fun to use the English alphabet reduced to 22 characters and then check for silly sentences like "Micky Mouse is President." We can reduce the 26 English letters to 22 by treating the letters I and J as equivalent (as they once were). And we can take U, V, W as equivalent. And maybe C and K (or K and Q?). Whatever. It would be a test to see if we can "find anything" in a large enough data set.

Richard Amiel McGough
06-22-2012, 11:43 AM
Dear Craig,

In 1974 astronomers at the Arecibo observatory in Puerto Rico beamed a radio message toward the Great Cluster in the constellation of Hercules. The message consists of 1679 binary digits, i.e. a series of 1's and 0's. A receiving intelligence is to arrange these 1's and 0's into a matrix of 23 columns by 73 rows and then translate the 1's and 0’s into contrasting dark and light squares. The resulting digital picture is then to be interpreted for meaning. Our astronomers hope that if the message is received by non-earthly intelligences those folks will be able to decipher it and conclude that "intelligent life" exists on the third planet of the star from which the radio beam emanated. Consciously or not our astronomers selected numbers to define the size of the information matrix which will reassure any receivers of the message, who are familiar with Kabbalah’s mathematical methodology known as gematria, that we are indeed "intelligent life", since 73 is the numerical value of the Hebrew word chokmah - חכמה meaning "intelligent" (or “wisdom”, or “science”) and 23 is the numerical value of the Hebrew word chyah - חיה meaning "to live, be alive, exist". (Definitions from Ben-Yehuda’s Hebrew-English Dictionary)

http://en.wikipedia.org/wiki/Arecibo_message

Perhaps this method should be examined? Here is an interesting site to that end. http://www.arcfn.com/2010_06_01_archive.html

Regards,
Krakers
Hey there Krakers,

I began learning Hebrew from Ben Yehuda's Hebrew-English Dictionary back in 1991. Look where it led me ... :lol:

I agree that the primary significance of 73 and 23 are wisdom and life. I'm guessing the scientists chose those numbers because they were primes of about the right size. The total length of the message had to be a number that would be the product of the grid dimensions 1679 = 23 x 73. If they used composite numbers, the dimensions of the grid would be much more ambiguous. E.g. 25 x 70 could be put into many different grids: 2 x 875 or 10 x 175 or 7 x 250 or 35 x 25 or ...

But it is a nice "coincidence" that they sent a message into space that proclaims the existence of "WISE LIFE" :sunny:

I'll check out the link about alternate coding and get back to you.

Richard

Craig.Paardekooper
06-22-2012, 01:22 PM
This brings up an important question. If the data set is so large as to allow a few random "close" hits, how could we be sure that finding the whole sentence would not be just another random event? Merely calculating probabilities would not be convincing because any specified 28 letter string, no matter how arbitrary, is equally improbable.


Hi Richard,

Well, my answer to this question is -

1. A co-incidence with the distribution of ALL letters in Genesis 1, not just the first three, is vanishingly small, so a successful complete hit would be very significant

2. If the conversion from aminoacid codon to alphabet were then applied to the entire genetic code, we would expect it to reveal other areas of language, especially immediately adjacent to the Genesis1 bit.

So really, the location of sequences corresponding to the distribution of the first three letters is only a sign post. It "short-lists" potential sequences, which are then quickly examined for the two conditions mentioned above.


Anyway, I have searched all of Chromosome Y and no further instances have been found. This is partly hindered by the large areas of the Y Chromosome that look like this - "NNNNNNNNNNNNNNNNNNNNNNNNNNNN" - "N" signifying an unknown base sequence. The areas of Ns number about 20 million at a rough guess.

Infact here are the exact figures -

Total Length = 6.056104E+07 bases
Unknown = 1.677722E+07 bases
Percentage of unknown sequence = 27.70298%

I used this computer code to get these figures -

Dim TotalLength As Single = TextBox1.Text.Length
Dim Q As Single = 0
Dim CharArray() As Char = TextBox1.Text.ToCharArray()

Dim Letter As Char

For Each Letter In CharArray
If Letter.ToString = "N" Then
Q += 1
End If
Next

TextBox4.Text = "Total Length = " & TotalLength & vbCrLf & _
"Unknown = " & Q & vbCrLf & _
"Percentage = " & Q * 100 / TotalLength & "%"

Richard Amiel McGough
06-22-2012, 01:40 PM
Hi Richard,

Well, my answer to this question is -

1. A co-incidence with the distribution of ALL letters in Genesis 1, not just the first three, is vanishingly small, so a successful complete hit would be very significant

2. If the conversion from aminoacid codon to alphabet were then applied to the entire genetic code, we would expect it to reveal other areas of language, especially immediately adjacent to the Genesis1 bit.

So really, the location of sequences corresponding to the distribution of the first three letters is only a sign post. It "short-lists" potential sequences, which are then quickly examined for the two conditions mentioned above.


Anyway, I have searched all of Chromosome Y up until the 54,000,000th base and no further instances have been found. This is partly hindered by the large areas of the Y Chromosome that look like this - "NNNNNNNNNNNNNNNNNNNNNNNNNNNN" - "N" signifying an unknown base sequence. The areas of Ns number well over 20 million.

Hey there Craig,

I think you missed my point. The probability of any specified string of length 28, such as "Micky Mouse is Lord of the Universe," is identical to any other arbitrary string of length 28. Just because you happen to like Genesis 1:1 doesn't make it special in terms of probability. The a priori probability is identical for all strings of equal length. Think of a deck of cards. The probability of any 5-card hand is identical to every other. Of course, a royal flush makes you feel good, so you would be stunned if one was dealt to you, especially if you were playing in Los Vegas for a 10 million dollar pot. But the probability is the same for each hand.

You would have to find extended codes (per point #2) before you could say anything of any statistical significance.

Craig.Paardekooper
06-22-2012, 01:56 PM
Hi Richard,

As you quite rightly point out, the discovery of a 28 letter sequence matching Genesis, though extremely rare, would only furnish us with a signpost - a "potential" key - for decoding the rest. It's ability to decode the rest would be the big test.

Anyway, I will look at the X Chomosome next. Perhaps the signature for creation will be found there.

Craig.Paardekooper
06-22-2012, 02:41 PM
In 1974 astronomers at the Arecibo observatory in Puerto Rico beamed a radio message toward the Great Cluster in the constellation of Hercules. The message consists of 1679 binary digits, i.e. a series of 1's and 0's. A receiving intelligence is to arrange these 1's and 0's into a matrix of 23 columns by 73 rows and then translate the 1's and 0’s into contrasting dark and light squares. The resulting digital picture is then to be interpreted for meaning. Our astronomers hope that if the message is received by non-earthly intelligences those folks will be able to decipher it and conclude that "intelligent life" exists on the third planet of the star from which the radio beam emanated. Consciously or not our astronomers selected numbers to define the size of the information matrix which will reassure any receivers of the message, who are familiar with Kabbalah’s mathematical methodology known as gematria, that we are indeed "intelligent life", since 73 is the numerical value of the Hebrew word chokmah - חכמה meaning "intelligent" (or “wisdom”, or “science”) and 23 is the numerical value of the Hebrew word chyah - חיה meaning "to live, be alive, exist". (Definitions from Ben-Yehuda’s Hebrew-English Dictionary)

http://en.wikipedia.org/wiki/Arecibo_message

Perhaps this technique, applied to the human genome, would be worth examining.
Here is a site that plays with the idea of messages in DNA.

http://www.arcfn.com/2010_06_01_archive.html


Hi Krakers,

If I understand the gist of your idea - the un-translated bases ACTG may themselves convey a meaning by their relative position. It is an interesting idea. If DNA were meant to be arranged in a particular number of columns, then we should expect that the number of bases in each chromosome would be a multiple of that number of columns.

I remember that Vernon found a similar pattern in Genesis 1 - word values were always a multiple of 37 minus a multiple of 6.

It might be interesting to see what would appear if the amino acid codons were split into 22 columns - would any interesting repeat sequences emerge - particular aminoacid letters occupying each column.

One way to achieve this visually would be to split the DNA into strings each of 22 letters, and arrange the strings ontop of each other. This is quite easy to do in with computer programming.

Dim DNA as String = TextBox1.Text

For n = 0 to DNA.length - 22 step 22

Result &= DNA.Substring(n, 22) & vbcrlf

Next

TextBox2.Text = Result

Perhaps I will test out this idea with some plant DNA and see what happens. Giving each single letter aminoacid a different colour would make any emerging pattern more striking.

Also, it is possible to represent DNA as binary because there are two types of codons - Pyrimidines (codons beginning with T or C) and Purines (codons beginning with A or G). To convert DNA into a sequence of 1s and 0s, I would use this computer code -

Dim DNA as String = TextBox1.Text

For n = 0 to DNA.length - 3 step 3

Letter = DNA.Substring(n, 1)

If Letter = "A" or Letter = "G" Then

Result &= "0"

Else If Letter = "T" or Letter = "C" Then

Result &="1"

End If

Next

TextBox2.Text = Result

Then to represent this as 22 columns I would use this computer code -

Dim BinarySequence as String = Result

For n = 0 to BinarySequence.length - 22 step 22

BinaryRows &= BinarySequence.Substring(n, 22) & vbcrlf

Next

TextBox3.Text = BinaryRows

Richard Amiel McGough
06-22-2012, 02:52 PM
Hi Richard,

As you quite rightly point out, the discovery of a 28 letter sequence matching Genesis, though extremely rare, would only furnish us with a signpost - a "potential" key - for decoding the rest. It's ability to decode the rest would be the big test.

Anyway, I will look at the X Chomosome next. Perhaps the signature for creation will be found there.
I think Genesis 1:1 is a very good place to start. If you found it, it would give you the correlation for the alphabet which would make looking for words in the rest of the genome much easier.

I'm sure the X Chromosome is where the secret of creation lies. It is the woman's, you know! :winking0071:

Craig.Paardekooper
06-23-2012, 02:26 AM
Here is a site that plays with the idea of messages in DNA.

http://www.arcfn.com/2010_06_01_archive.html

Hi Kraker,

Thanks for posting this link. It is very interesting. The article says that the two methods for decoding DNA are -

1. Searching for an amino acid or codon sequence that matches a known phrase
2. Determining codon frequencies and then matching them to the letter frequencies in a known language

These are the same methods that I have been attempting (dabbling with)

I suppose that if it were possible to split the DNA into words along word boundaries then we could match the highest frequency DNA word with the highest frequency spoken word.

Krakers
06-23-2012, 06:34 PM
Dear Craig and Richard,

ftp://www.fourmilab.ch/pub/goldberg/patterns.html

The above site contains Java programs that don't work any more.
They were designed to search selected DNA segments for unknown patterns or pictures.
Perhaps you know how to fix them?

Regards,
Krakers

culi26
06-24-2012, 07:14 AM
letters in genesis?

Craig.Paardekooper
06-26-2012, 05:33 AM
The X Chromosome is alot bigger than the Y Chromosome, so initially when I tried to search it my computer simply ran out of memory. However I took Richards advice, and decided to read it a character at a time from the file

I used this computer code to count the total number of bases in the X Chromosome, and also count the number of bases that are unknown, and express this as a percentage of the total.

'1. OPENS UP THE X CHROMOSOME FILE ON MY HARD DRIVE

Dim FilePath As String
Dim line As String
Dim Result As String
Dim LetterNumber As Long = 0

OpenFileDialog1.ShowDialog()
If OpenFileDialog1.FileName <> "" Then
FilePath = OpenFileDialog1.FileName
End If


' 2. LOOPS THROUGH THE ENTIRE X CHROMOSOME ONE CHARACTER AT A TIME

Dim intSingleChar As Integer
Dim cSingleChar As String

Dim oRead As System.IO.StreamReader
oRead = File.OpenText(FilePath)


Dim Known, unknown As Double
While oRead.Peek <> -1
intSingleChar = oRead.Read()
' Convert the integer value into a character
cSingleChar = Chr(intSingleChar)

If cSingleChar <> "N" Then
Known += 1
Else
unknown += 1
End If

End While

oRead.Close()

TextBox4.Text = "known : " & Known & vbCrLf & "Unknown : " & unknown

The results are for the X Chromosome are
Total : 158,375,978 bases
Unknown : 4170000 bases = 2.63%


The results for the Y Chromosome are

Total : 60,561,044
Unknown : 33,720,000 = 55.67%

So more than half the Y Chromosome is unknown - no wonder I could not find the signature there.


Rather than openning up the entire file I created a software program that reads a character and increments a character index by 1. If that index lies within a specific range then the character is appended to the string that wil appear in the output box. This way, I never store the whole file in a variable (which would cause memory to run out). Rather I only store the chunk of DNA that I need to search.

'1. OPENS UP THE X CHROMOSOME FILE ON MY HARD DRIVE

Dim FilePath As String
Dim line As String
Dim Result As String
Dim LetterNumber As Long = 0

OpenFileDialog1.ShowDialog()
If OpenFileDialog1.FileName <> "" Then
FilePath = OpenFileDialog1.FileName
End If


' 2. LOOPS THROUGH THE ENTIRE X CHROMOSOME ONE CHARACTER AT A TIME

Dim intSingleChar As Integer
Dim cSingleChar As String

Dim oRead As System.IO.StreamReader
oRead = File.OpenText(FilePath)

While oRead.Peek <> -1
intSingleChar = oRead.Read()
cSingleChar = Chr(intSingleChar)
LetterNumber += 1
If LetterNumber >= Val(TextBox5.Text) And LetterNumber <= Val(TextBox3.Text) Then
Result &= cSingleChar
ElseIf LetterNumber > Val(TextBox3.Text) Then
Exit While
End If

End While

oRead.Close()

TextBox1.Text = Result

Genesis 1 v 1 has not been found in the first 3 million bases of the X Chromosome

jce
06-26-2012, 10:16 AM
That is the KEY to knowledge. We don't have much trouble with confirmation in science. But in religion it's one rare bird.

Your desire to see a unity of Biblical Truth with Reason is admirable. But I think it will require a total reworking of your concept of "Biblical Truth." This is what happened to me. I still have all the evidence I ever had for the truth of the Bible, but I just can't believe what the Bible actually says. I could have retained all the concepts I liked - Jesus as God Incarnate, Love, the Alpha Omega, etc. - and then just made up my own interpretation of all the problematic things. But in so doing I'd just be making up my own religion. I've seen it done a thousand times, and think it is ridiculous. So I just dropped it all as obviously not important since if God really is the author of the Bible, he obviously doesn't care what people believe! Else he would have made himself a little more clear.

Perhaps it is science that will need a reworking. From what limited understanding I have gained, the fundamental dynamics of physics at the quantum level pose a problem to our abilities to fully understand or explain it without the invention of un-verifiable concepts such as string theory or parallel universes. Personally, I should like to know more about it myself but sounds like I will have to wait for further revelation like everyone else.


That's not true at all. I have no "liberty" to believe things that I don't believe!

This may be an accurate statement based on the Biblical Truth in Ephesians 2: 8 & 9; "For by grace are you saved through faith, and that not of yourselves, it is the gift of God, not obtainable by the effort of man.


This reveals the fundamental error of Christianity and all dogmatic religions that claim a person can choose what they believe, and are damned if they don't believe the correct dogma.

Or rather... a fundamental truth of Christianity.


Could you "choose" to really believe in Allah? The Tooth Fairy? Santa Clause? Scientology? What makes you think humans are free to believe things they don't believe? That's a contradiction.

Who is Allah? Is that name a reference to the one true God? Does it belong exclusively to Islam? Just asking. The others of course, are the inventions of men and are destined to be exposed as such. Your reply does seem to confirm once again the Truth of Ephesians 2: 8 & 9.


Your contributions are truly excellent my friend. :thumb:

I too am often humbled at the extent of your knowledge.

Your friend,

John

Craig.Paardekooper
06-26-2012, 12:12 PM
Broken Java programs to search DNA for pictures



Dear Craig and Richard,

ftp://www.fourmilab.ch/pub/goldberg/patterns.html

The above site contains Java programs that don't work any more.
They were designed to search selected DNA segments for unknown patterns or pictures.
Perhaps you know how to fix them?


Hi Kraker,

Currently I am still running and refining the software program that searches for Genesis1 in DNA. It still needs alot of development and refining. However, I will reproduce your Java program as soon as possible.

Thanks for bringing this idea to light.

Regards

Craig

Craig.Paardekooper
06-29-2012, 03:08 AM
Hi Richard,

I have created some software code that is able to -

1. read all the DNA sequence for the Y Chromosome into a string variable in a few seconds.
2. Then it divides up the entire sequence into triplet codons in 4 seconds.
3. Then it converts each codon into an amino acid. It can convert 1/20th of the entire sequence in 1 minute.
4. Lastly I will search the resulting aminoacid sequence with a Regular Expression that can identify all sequences where the same amino acid occupies all positions of Alpha but no other positions.

The regular expression will be similar to this -

[A-Z][A-Z]X[A-Z][A-Z][A-Z][A-Z][A-Z]XX[A-Z][A-Z][A-Z][A-Z]X[A-Z][A-Z][A-Z][A-Z][A-Z][A-Z][A-Z]X[A-Z][A-Z]X[A-Z][A-Z]

I will modify this expression so that [A-Z] excludes the aminoacid letter X eg

[A-WY-Z][A-WY-Z]X[A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z]XX[A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z]X[A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z]X[A-WY-Z][A-WY-Z]X[A-WY-Z][A-WY-Z]

I will create 22 different regular expressions. In each case I will substitute a different aminoacid letter for X and exclude that from the rest.


Here is the code for reading the DNA into a String variable

OpenFileDialog1.ShowDialog()
If OpenFileDialog1.FileName <> "" Then
FilePath = OpenFileDialog1.FileName
valueX = File.ReadAllText(FilePath)

Here is the code for dividing the entire sequence into triplet codons -

Dim Line As String = ""
Dim r, n As Integer

For r = 0 To Int(valueX.Length) - 3 Step 3
array1(n) = valueX.ToString.Substring(r, 3)
n += 1
Next

Here is the code for converting the codons into amino acids -

Dim AminoAcids As String = ""
Dim Codon As String


For Each Codon In array1

' If Codon = "" Or Codon Is Nothing Then Exit For

If Codon = "TTT" Or Codon = "TTC" Then
AminoAcids &= "F"
End If


If Codon = "TTA" Or Codon = "TTG" Or Codon = "CTT" Or Codon = "CTC" Or Codon = "CTA" Or Codon = "CTG" Then
AminoAcids &= "L"
End If

If Codon = "ATT" Or Codon = "ATC" Or Codon = "ATA" Then
AminoAcids &= "I"
End If

If Codon = "ATG" Then
AminoAcids &= "M"
End If

If Codon = "GTT" Or Codon = "GTC" Or Codon = "GTA" Or Codon = "GTG" Then
AminoAcids &= "V"
End If

If Codon = "TCT" Or Codon = "TCC" Or Codon = "TCA" Or Codon = "TCG" Or Codon = "AGT" Or Codon = "AGC" Then
AminoAcids &= "S"
End If

If Codon = "CCT" Or Codon = "CCC" Or Codon = "CCA" Or Codon = "CCG" Then
AminoAcids &= "P"
End If

If Codon = "ACT" Or Codon = "ACC" Or Codon = "ACA" Or Codon = "ACG" Then
AminoAcids &= "T"
End If

If Codon = "GCT" Or Codon = "GCC" Or Codon = "GCA" Or Codon = "GCG" Then
AminoAcids &= "A"
End If

If Codon = "TAT" Or Codon = "TAC" Then
AminoAcids &= "Y"
End If

If Codon = "TAA" Or Codon = "TAG" Then
AminoAcids &= "1"
End If

If Codon = "CAT" Or Codon = "CAC" Then
AminoAcids &= "H"
End If

If Codon = "CAA" Or Codon = "CAG" Then
AminoAcids &= "Q"
End If

If Codon = "AAT" Or Codon = "AAC" Then
AminoAcids &= "N"
End If

If Codon = "AAA" Or Codon = "AAG" Then
AminoAcids &= "K"
End If

If Codon = "GAT" Or Codon = "GAC" Then
AminoAcids &= "D"
End If

If Codon = "GAA" Or Codon = "GAG" Then
AminoAcids &= "E"
End If

If Codon = "TGT" Or Codon = "TGC" Then
AminoAcids &= "C"
End If

If Codon = "TGA" Then
AminoAcids &= "2"
End If

If Codon = "TGG" Then
AminoAcids &= "W"
End If

If Codon = "CGT" Or Codon = "CGC" Or Codon = "CGA" Or Codon = "CGG" Or Codon = "AGA" Or Codon = "AGG" Then
AminoAcids &= "R"
End If

If Codon = "GGT" Or Codon = "GGC" Or Codon = "GGA" Or Codon = "GGG" Then
AminoAcids &= "G"
End If


Next

TextBox1.Text = "AminoAcids finished : " & n & vbCrLf & AminoAcids

End If

Here is the code for applying a regular expression to the resulting aminoacid sequence.

Dim myMatches As MatchCollection
Dim myRegex As New Regex(TextBox3.Text)
Dim t As String = valueX
Dim m As Integer = 0

myMatches = myRegex.Matches(t)
' Search for all the words in a string
Dim successfulMatch As Match
For Each successfulMatch In myMatches
m += 1
TextBox1.Text &= m & " : " & successfulMatch.Value & vbCrLf

Next

TextBox1.Text &= "Total = " & m
Regards

Craig

Richard Amiel McGough
06-29-2012, 02:08 PM
Hi Richard,

I have created some software code that is able to -

1. read all the DNA sequence for the Y Chromosome into a string variable in a few seconds.
2. Then it divides up the entire sequence into triplet codons in 4 seconds.
3. Then it converts each codon into an amino acid. It can convert 1/20th of the entire sequence in 1 minute.
4. Lastly I will search the resulting aminoacid sequence with a Regular Expression that can identify all sequences where the same amino acid occupies all positions of Alpha but no other positions.

The regular expression will be similar to this -

[A-Z][A-Z]X[A-Z][A-Z][A-Z][A-Z][A-Z]XX[A-Z][A-Z][A-Z][A-Z]X[A-Z][A-Z][A-Z][A-Z][A-Z][A-Z][A-Z]X[A-Z][A-Z]X[A-Z][A-Z]

I will modify this expression so that [A-Z] excludes the aminoacid letter X eg

[A-WY-Z][A-WY-Z]X[A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z]XX[A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z]X[A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z][A-WY-Z]X[A-WY-Z][A-WY-Z]X[A-WY-Z][A-WY-Z]

I will create 22 different regular expressions. In each case I will substitute a different aminoacid letter for X and exclude that from the rest.


Hey there Craig,

Coding is a lot of fun, ain't it?

It takes a little time to get used to regular expressions because they can be rather complex. I've used them a few times, and know that they are very powerful, but I would have to do a little study to help refine the ones you are using in your code. Unfortunately, I'm swamped with other coding projects right now (as well as running this forum) so I don't have time.

I look forward to reading your reports of what you find.

All the best,

Richard

Craig.Paardekooper
06-29-2012, 04:41 PM
Hi Richard,

Coding is fun ..... and it is rewarding too, especially when we are using it to break the greatest "enigma" code - the very Book of Life itself. Who knows what we will find.......but who can resist the opportunity?

Once the code is in optimal condition, I will create a similar version for the Greek sequence in John 1 and test it on all known DNA sequences.

Richard Amiel McGough
06-30-2012, 09:34 AM
Hi Richard,

Coding is fun ..... and it is rewarding too, especially when we are using it to break the greatest "enigma" code - the very Book of Life itself. Who knows what we will find.......but who can resist the opportunity?

I know exactly what you are talking about. That's how I felt when I was doing all my research on gematria and the Bible Wheel. Every time I'd discover something new it was a big "woohoo"!

:woohoo:



Once the code is in optimal condition, I will create a similar version for the Greek sequence in John 1 and test it on all known DNA sequences.
Greek has 24 characters. How will that work?

Craig.Paardekooper
07-01-2012, 11:26 AM
Every map has a key to show what it's symbols mean. The key lists each symbol. So........what if the Creator implanted such a key to the alphabet in the genetic code? A creator would embed an alphabet by simply listing all the unique letters in that alphabet in alphabetical order.

So, if we searched the DNA sequence and found a continuous sequence of all 20 aminoacids + two stop signs - one next to the other - then this might be the key.

All we would need to do is identify a sequence of 20 aminoacids where each amino acid is unique - in other words where there are no repeats.

It will be interesting to see if such a sequence exists in human DNA. It would certainly be quite odd to find a string of all 20 amino acids in one place. Such a string could hardly exist for any biological function.

In order to locate this embedded alphabet, I will simply use a regular expression for detecting a list of 20 aminoacids where there are no repeats.

Here is the code for identifying 20 letter sequences where there are no repeats.

Dim myMatches As MatchCollection
Dim myRegex As New Regex("(.)(?=.*?\1){1,20}")
Dim t As String = TwentyAminoAcidString
Dim m As Integer = 0

myMatches = myRegex.Matches(t)
' Search for all the words in a string
Dim successfulMatch As Match
For Each successfulMatch In myMatches
m += 1
Next

If m = 0 Then TextBox4.Text &= "Unique Sequence - " & TwentyAminoAcidString & vbCrLf

This key will probably represent the first 20 letters of an alphabet.

Richard Amiel McGough
07-01-2012, 11:48 AM
Every map has a key to show what it's symbols mean. The key lists each symbol. So........what if the Creator implanted such a key to the alphabet in the genetic code? A creator would embed an alphabet by simply listing all the unique letters in that alphabet in alphabetical order.

So, if we searched the DNA sequence and found a continuous sequence of all 20 aminoacids + two stop signs - one next to the other - then this might be the key.

All we would need to do is identify a sequence of 22 aminoacids where each amino acid is unique - in other words where there are no repeats.

It will be interesting to see if such a sequence exists in human DNA. It would certainly be quite odd to find a string of all 20 amino acids in one place. Such a string could hardly exist for any biological function.

In order to locate this embedded alphabet, I will simply use a regular expression for detecting a list of 20 aminoacids where there are no repeats.
Excellent idea Craig! :thumb:

It's very similar to the Arecibo message (http://en.wikipedia.org/wiki/Arecibo_message) where NASA coded the first ten numbers in binary. If there is a message deliberately designed in the DNA it would make sense to look for the primer.

But the whole idea seems pretty unlikely to me because of the nature of DNA - it changes all the time through random mutations and if its purpose is to code for the body, it seems hard to imagine how you could superimpose another message on top of that. You would need an additional degree of freedom since I would think the biological necessities would determine the sequence of codons.

Craig.Paardekooper
07-02-2012, 06:04 AM
But the whole idea seems pretty unlikely to me because of the nature of DNA - it changes all the time through random mutations and if its purpose is to code for the body, it seems hard to imagine how you could superimpose another message on top of that. You would need an additional degree of freedom since I would think the biological necessities would determine the sequence of codons.

Hi Richard,

DNA is remarkably stable in it's information content. Also, noncoding areas are likely to contain the language rather than coding areas, and noncoding areas would not be restricted by biological necessity.

Anyway, I searched a Thermosulpho microbe that had 560357 codons. The software converted these codons into amino acids at a rate of 2000 codons per second - about 120,000 per minute.

The resulting aminoacid sequence was then searched for any string of 20 aminoacids where all of the aminoacids were different. Using regular expressions the software searched these strings at a rate of 1600 per second - about 100,000 per minute.

However, no 20 letter sequence was found containing all 20 amino acids.

During this test, my laptop got very hot, and I am a bit worried about searching the Y or X Chromosomes which are 120 and 360 times bigger respectively. They may cause my laptop circuits to melt.

I also searched yeast - and found no 20 letter sequences containing all the amino acids

Craig.Paardekooper
07-04-2012, 12:06 AM
I am dividing the X chromosome into chunks of 9 million so that my computer does not get over heated. Here are the results for the X Chromosome -

Range 0 to 9 million: reading frame 1

Unique Sequences Found = 4

1. : at 70537 : GRWIN2DQEFATSLVKPH

2. : at 1301724 : GRK2YIEVACTFHPNSQM

3. : at 2769118 : YWIE1CHPKFVSTQNL2M

4. : at 2769119 : WIE1CHPKFVSTQNL2MG

The longest sequence of unique characters consisted of 17 different aminoacids and 2 different stop signals

YWIE1CHPKFVSTQNL2MG , where 1 and 2 are stop signals


Range 9 million to 18 million : Reading Frame 1

Unique Sequences Found = 9

1. : at 111046 : TL1SCVAKRMGFE2PHQD

2. : at 111047 : L1SCVAKRMGFE2PHQDI

3. : at 1181122 : N2IMEKFA1RCQSYDVPL

4. : at 1752580 : FPIAW2TNYSLVKQGRMH

5. : at 1997541 : VIPYHASGCENFL21KTQ

6. : at 2135279 : PLNFS1HQTCERIDYWGV

7. : at 2152792 : V1M2ILSTGWAQFCKDRN

8. : at 2898305 : VGCNYFLKP1SWRTQMIE

9. : at 2898306 : GCNYFLKP1SWRTQMIEV

There is one 19-sequence starting at position 111046 of this range. All the rest are 18-sequences.

Goal is to find a longer sequence - ideally 20 different aminoacids and two stop signals. If there is a KEY - what Richard called a Primer - then I would expect it to -

A) consist of a full alphabet
B) occur as an identical sequence in several places
C) generate meaningful text when applied to DNA

Anyway, I will get on with the search of the next block of the X Chromosome. It has occurred to me that perhaps I should not include the stop codons as symbols, since they may not constitute parts of the hypothetical alphabet. In future runs I will remove these. So all we will be looking for is a sequence of 20 aminoacids where there are no repeats. Also there are 2 additional aminoacids that may need to be included - though they are quite rare.

Anyway I will complete analysis of the next block.


Range 18 million to 27 million : Reading Frame 1

Unique Sequences Found = 14

1. : at 295487 : CF2DS1LYKAVNIQHWGT

2. : at 673338 : KGMPHERNV1LQYTDISW

3. : at 1080003 : V1RAMQNKCI2YSLFTDH

4. : at 1080004 : 1RAMQNKCI2YSLFTDHE

5. : at 1080009 : NKCI2YSLFTDHERQGV1

6. : at 1669952 : SREQDGITYAP2FW1VMN

7. : at 1669953 : REQDGITYAP2FW1VMNK

8. : at 1794937 : IWRQELMGHVCFPT1A2K

9. : at 1794938 : WRQELMGHVCFPT1A2KS

10. : at 1794939 : RQELMGHVCFPT1A2KSN

11. : at 2102154 : PATDCF2N1VKQILHWGY

12. : at 2139625 : T2VSHRAQPKIGEFCNM1

13. : at 2215122 : YLF1SGT2HINACWMDKQ

14. : at 2398833 : LIVAGMKE1DSHYNQFC2

Here we can see our first 20 letter sequence consisting of 18 amino acids and two stop signals. See 8, 9, and 10 above

8. : at 1794937 : IWRQELMGHVCFPT1A2K

9. : at 1794938 : WRQELMGHVCFPT1A2KS

10. : at 1794939 : RQELMGHVCFPT1A2KSN

I am pleased to find this. However, I am rather looking for a string of all the aminoacids. So I will modify the code to detect aminoacids represented by letters only. There are two rare aminoacids - Pyrrolysine UAG/TAG and Selenocysteine UGA/TGA that I will add to the list of 20 common aminoacids - bringing the total number of aminoacids to 22.


Twenty-two amino acids are naturally incorporated into polypeptides and are called proteinogenic or natural amino acids.[10] Of these, 20 are encoded by the universal genetic code. The remaining 2, selenocysteine and pyrrolysine, are incorporated into proteins by unique synthetic mechanisms. Selenocysteine is incorporated when the mRNA being translated includes a SECIS element, which causes the UGA codon to encode selenocysteine instead of a stop codon.[22] Pyrrolysine is used by some methanogenic archaea in enzymes that they use to produce methane. It is coded for with the codon UAG, which is normally a stop codon in other organisms.[23] This UAG codon is followed by a PYLIS downstream sequence.[24] See Wikipedia - http://en.wikipedia.org/wiki/Amino_acid

These additional two aminoacids are coded for by two codons that normally generate a STOP signal - so they replace two stops. I will need to re-analyse the X Chromosome from the beginning to allow for these new aminoacids. Here is the code I will use -

First we get the file and read it in it's entirety into a variable named valueY
Dim valueX, valueY As String
Dim ArrayLength As Long
Dim FileName As String
FileName = OpenFileDialog1.FileName
If FileName <> "" Then
FilePath = OpenFileDialog1.FileName
valueY = UCase(File.ReadAllText(FilePath))

Then we isolate a particular segment of this vast sequence by choosing a substring that starts at index position (in this case position 18000000), and is of length 9000000
valueX = valueY.Substring(18000000, 9000000)

Then we remove all line returns and spaces and any characters that are not A, C, T, or G
valueX = valueX.Replace(vbCr, "")
valueX = valueX.Replace(vbLf, "")
valueX = valueX.Replace(vbCrLf, "")
valueX = valueX.Replace(" ", "")
valueX = valueX.Replace("CHR", "")
valueX = valueX.Replace(">", "")
valueX = valueX.Replace("<", "")
valueX = valueX.Trim

Then we divide up the DNA into triplet sections or codons and store these codons in an array

ArrayLength = Int(valueX.Length / 3)
TextBox1.Text = "ArrayLength : " & ArrayLength

Dim array1(ArrayLength) As String
Dim Line As String = ""
Dim r, n As Integer

n = 0

For r = 0 To Int(valueX.Length) - 3 Step 3
array1(n) = valueX.ToString.Substring(r, 3)
n += 1

Next

TextBox1.Text &= vbCrLf & "Number of Codons = " & n

'Reverse Nucleotide Sequence
' Nucleotides = Microsoft.VisualBasic.StrReverse(Nucleotides)


Then the codon triplets are converted into an aminoacid sequence using the standard genetic code

Dim AminoAcids As String = ""
Dim Codon As String
Dim IncompleteCodons As Long = 0
Dim OtherInstances As String = ""
Dim Instances As Long = 0
Dim r1 As Long = 0
For Each Codon In array1
r1 += 1
TextBox2.Text = "Codons converted to AA" & vbCrLf & AminoAcids.Length & vbCrLf
If Codon = "" Or Codon Is Nothing Then Exit For

Select Case Codon
Case "TTT", "TTC"
AminoAcids &= "F"
Case "TTA", "TTG", "CTT", "CTC", "CTA", "CTG"
AminoAcids &= "L"
Case "ATT", "ATC", "ATA"
AminoAcids &= "I"
Case "ATG"
AminoAcids &= "M"
Case "GTT", "GTC", "GTA", "GTG"
AminoAcids &= "V"
Case "TCT", "TCC", "TCA", "TCG", "AGT", "AGC"
AminoAcids &= "S"
Case "CCT", "CCC", "CCA", "CCG"
AminoAcids &= "P"
Case "ACT", "ACC", "ACA", "ACG"
AminoAcids &= "T"
Case "GCT", "GCC", "GCA", "GCG"
AminoAcids &= "A"
Case "TAT", "TAC"
AminoAcids &= "Y"
Case "TAG"
AminoAcids &= "O"
Case "TAA"
AminoAcids &= "1"
Case "CAT", "CAC"
AminoAcids &= "H"
Case "CAA", "CAG"
AminoAcids &= "Q"
Case "AAT", "AAC"
AminoAcids &= "N"
Case "AAA", "AAG"
AminoAcids &= "K"
Case "GAT", "GAC"
AminoAcids &= "D"
Case "GAA", "GAG"
AminoAcids &= "E"
Case "TGT", "TGC"
AminoAcids &= "C"
Case "TGA"
AminoAcids &= "U"
Case "TGG"
AminoAcids &= "W"
Case "CGT", "CGC", "CGA", "CGG", "AGA", "AGG"
AminoAcids &= "R"
Case "GGT", "GGC", "GGA", "GGG"
AminoAcids &= "G"
Case Else
If Codon.IndexOf("N") > -1 Then
AminoAcids &= "@"
ElseIf Codon.IndexOf(" ") > -1 Then
IncompleteCodons += 1
Else
OtherInstances &= Codon & vbCrLf
Instances += 1
End If

End Select


Next


Dim i As Integer = 0
TextBox1.Text &= vbCrLf & "Number of Aminoacids : " & AminoAcids.Length & vbCrLf & "Number of loops : " & r1 - 1 & vbCrLf & "Incomplete Codons : " & IncompleteCodons & vbCrLf & "Instances : " & Instances & vbCrLf & OtherInstances & AminoAcids

Beep()

Then we search the resulting string of aminoacids by taking every 18 letter string and seeing if there are repeats in that string. To see if there are repeats I submit the sample string to an AreThereRepeats function that returns FALSE if there are no repeats.

Dim Sample As String = ""
Dim TwentyUniqueLetterSequence As String = ""
Dim p As Integer = 0

For i = 0 To AminoAcids.Length - 18
Sample = AminoAcids.Substring(i, 18)
If AreThereRepeats(Sample) = False Then
p += 1
TwentyUniqueLetterSequence &= p & ". : " & "at " & i & " : " & Sample & vbCrLf & vbCrLf

End If
TextBox4.Text = i & vbCrLf & TwentyUniqueLetterSequence
Next

Finally the results are displayed

TextBox4.Text = "Total number of sequences searched = " & AminoAcids.Length - 18 & vbCrLf & vbCrLf & "Unique Sequences Found = " & p & vbCrLf & TwentyUniqueLetterSequence
End If

Here is the AreThereRepeats() Function -
Function AreThereRepeats(ByVal TwentyAminoAcidString) As Boolean
Dim myMatches As MatchCollection
Dim myRegex As New Regex("(.)(?=.*?\1){1,20}")
Dim t As String = TwentyAminoAcidString
Dim m As Integer = 0


myMatches = myRegex.Matches(t)
' Search for all the words in a string
Dim successfulMatch As Match
For Each successfulMatch In myMatches
m += 1
Next
If m = 0 Then
Return False
Else
Return True
End If

End Function

To analyse 9 million bases it takes about 2 hours.

I will compile this code into a tool that I can deploy, so it will be available to anyone who wishes to do searches on any other genomes, or chromosomes. It will also enable me to run searches on multiple computers simultaneously - which will triple the rate at which I can detect viable sequences.

PS. This code only produces the results for 1 reading frame. There are infact three reading frames depending upon where you start reading your segment of DNA from. Each reading frame produces a completely different set of codons, and so a completely different set of aminoacids. So I will have to repeat the search three times for any one section of DNA. That's no problem with multiple computers working simultaneously.

I have included the two additional aminoacids, though, if I really wanted to be conservative I could just carry on the search for strings of 20 aminoacids, and just remove all stop codons from the sequence. If I did this, then I would simply be looking for a sequence of the standard twenty aminoacids.

Lets see what we can find.

Craig.Paardekooper
07-04-2012, 10:37 PM
Range 0 to 9 million bases : Reading Frame 1 : 22 aminoacids + 1 stop

Number refers to position in the aminoacid sequence not the base sequence.

1. : at 70537 : GRWINUDQEFATSLVKPH

2. : at 1301724 : GRKUYIEVACTFHPNSQM

3. : at 1588913 : OP1TEDCHQFNURLGVSK

4. : at 2320446 : W1UVGSLFNPTRADCOKE

5. : at 2673909 : QNTFYOPHVAMESLKCG1

6. : at 2769118 : YWIE1CHPKFVSTQNLUM

7. : at 2769119 : WIE1CHPKFVSTQNLUMG

Maximum sequence found = 18 aminoacids + 1 stop - see 6 and 7 above


Range 9 million to 18 million bases: Reading frame1 : 22 aminoacids + 1 stop

1. : at 65673 : DURYAM1FTLVCHPNOIK

2. : at 111046 : TLOSCVAKRMGFEUPHQD

3. : at 111047 : LOSCVAKRMGFEUPHQDI

4. : at 293609 : FLD1CMQIPAOGYHTKWU

5. : at 390084 : CLYSTOHIVGPQ1MFAEU

6. : at 390085 : LYSTOHIVGPQ1MFAEUN

7. : at 630850 : U1WFMRCOQPKSLGAYIV

8. : at 807486 : GYMSEUVALPOQ1HKFCI

9. : at 807487 : YMSEUVALPOQ1HKFCIT

10. : at 1181122 : NUIMEKFA1RCQSYDVPL

11. : at 1752580 : FPIAWUTNYSLVKQGRMH

12. : at 1997541 : VIPYHASGCENFLU1KTQ

13. : at 2135279 : PLNFS1HQTCERIDYWGV

14. : at 2152792 : V1MUILSTGWAQFCKDRN

15. : at 2898305 : VGCNYFLKP1SWRTQMIE

16. : at 2898306 : GCNYFLKP1SWRTQMIEV

The longest sequences here are 19 aminoacids long


Range 18 million to 27 million bases : Reading frame 1 : 22 amino acids + stop

1. : at 295487 : CFUDSOLYKAVNIQHWGT

2. : at 673338 : KGMPHERNVOLQYTDISW

3. : at 782704 : ALIRCEHNQ1MOYVFUWG

4. : at 782707 : RCEHNQ1MOYVFUWGILP

5. : at 782708 : CEHNQ1MOYVFUWGILPS

6. : at 1080003 : VORAMQNKCIUYSLFTDH

7. : at 1080004 : ORAMQNKCIUYSLFTDHE

8. : at 1080009 : NKCIUYSLFTDHERQGVO

9. : at 1621405 : PIWAQCF1LKVROMGYUN

10. : at 1669952 : SREQDGITYAPUFW1VMN

11. : at 1669953 : REQDGITYAPUFW1VMNK

12. : at 1794937 : IWRQELMGHVCFPT1AUK

13. : at 1794938 : WRQELMGHVCFPT1AUKS

14. : at 1794939 : RQELMGHVCFPT1AUKSN

15. : at 2102154 : PATDCFUNOVKQILHWGY

16. : at 2139625 : TUVSHRAQPKIGEFCNM1

17. : at 2215122 : YLF1SGTUHINACWMDKQ

18. : at 2398833 : LIVAGMKEODSHYNQFCU

The longest sequence here is 20 characters -

12. : at 1794937 : IWRQELMGHVCFPT1AUK

13. : at 1794938 : WRQELMGHVCFPT1AUKS

14. : at 1794939 : RQELMGHVCFPT1AUKSN


Range 27 million to 36 million bases : Reading Frame 1

13. : at 2933659 : TFHANGOE1SILUKWPYC

12. : at 1662854 : MNG1CKEPRIFUYQVDTA

11. : at 1318152 : ENUALGWVMTCKRSQPIF

10. : at 850354 : LVHDMPQT1RGNAFKEIC

9. : at 828958 : TMQP1KEUYHVFCRNODG

8. : at 653561 : LYV1EAFOTIPKCSQDUG

7. : at 653560 : HLYV1EAFOTIPKCSQDU

6. : at 653559 : UHLYV1EAFOTIPKCSQD

5. : at 517119 : UPFWVMRIHQCLGEKYNS

4. : at 233767 : IHPCWENOAVSMULQRKY

3. : at 233766 : FIHPCWENOAVSMULQRK

2. : at 198063 : IEYSHL1NUPFOQWDKGR

1. : at 198062 : RIEYSHL1NUPFOQWDKG

Longest sequence = 20 aminoacids


Range 36 million to 45 million bases : Reading Frame 1

1. : at 154414 : YRHLASODFNI1MUEGQK

2. : at 275989 : TCSEWUYDVNIPHFKLOG

3. : at 642878 : QAYGWC1KIFVELMRSPT

4. : at 642879 : AYGWC1KIFVELMRSPTQ

5. : at 1096751 : 1DFYNTKQAEURILWGSV

6. : at 1971622 : GSVAITFUCO1KQNWRLE

7. : at 2145041 : TOIK1UEDLMYVNWGPSR

8. : at 2472132 : HYOWEAUNMLIVQGKTSC

9. : at 2472133 : YOWEAUNMLIVQGKTSC1

10. : at 2508843 : EWGQDUVFILKAPTYMS1

11. : at 2644918 : CLUEIYFKH1DSRPGMVT

12. : at 2739505 : STMPCAOHILUNQVFERK

13. : at 2739506 : TMPCAOHILUNQVFERK1

14. : at 2790933 : OKDEVCUYM1ITLNSGWH


Range 45 million to 54 million : Reading Frame 1

1. : at 540040 : YGPDNAWHTLCSKRIU1V

2. : at 540041 : GPDNAWHTLCSKRIU1VE

3. : at 1145383 : VAFP1CTNYISLDROUGW

4. : at 1160883 : FISLAUPCREMYDGO1WK

5. : at 1160885 : SLAUPCREMYDGO1WKIT

6. : at 2439749 : MUYTKGCVFD1LHQSNPI


Range 54 million to 63 million :

1. : at 828574 : SMTFHAKNCQ1IRYUWDV

2. : at 828575 : MTFHAKNCQ1IRYUWDVS

3. : at 1090705 : WAYSKQCVEGNLOH1MPT

4. : at 1090706 : AYSKQCVEGNLOH1MPTR

5. : at 1205417 : SNYKRCLVTGAEMOFUPH

Craig.Paardekooper
07-07-2012, 01:41 AM
So far the best result I have obtained is 19 different consecutive aminoacids with a stop signal. The largest genomes are more likely to contain the full alphabet. Currently the largest genome is in a plant or tree - its genome is about 50 times larger than the human genome. It would be interesting to see if this plant holds the key.

I have amended the computer code now, so that it searches all three reading frames. It translates the codons in the first reading frame into the corresponding 22 amino acids, then searches for a string of 22 different consecutive amino acids. On completion it translates the second reading frame into the corresponding amino acids, then searches for a string of 22 different consecutive amino acids. Finally it does the same for the third reading frame.

I am running it on a slower computer that is less likely to get overheated. It will take about 200 hours to complete the entire Y Chromosome and 600 hours (approx 1 month) to complete the entire X Chromosome - with the computer running 24 hours. I have delegated one computer completely for this task, and this task only. This means that I can get on with investigating other ideas on my other computers.

Craig.Paardekooper
07-11-2012, 04:52 AM
Description
Here is a software program that I created. It reads any DNA sequence and divides it up into codon triplets. These are then converted to an aminoacid sequence. It then searches the sequence for a string of different consecutive aminoacids.

The codons are overlapping eg ACCTGATTAGCT would produce ACC + CCT + CTG + TGA + GAT + ATT + TTA + TAG + AGC + GCT


Instructions

1. The Input file should be in .txt or .fa format.
2. The input file should consist of a sequence of As, Cs, T, and Gs

3. You must stipulate the start and length of the DNA segment that you want to search - otherwise it will default to a start index of 0 and a length of the entire DNA sequence (which might take months to process). Try smaller segments of length 1000000 to start with.

4. You must set the length of the alphabet string that you are searching for. Do not go lower than 10 or you will produce too much output. Try 15 - 22.


Download

There are two software programs. The first is for non-overlapping codons. The second is for overlapping codons -

A. http://www.craigdemo.co.uk/DNAsetup.zip

B. http://www.craigdemo.co.uk/OverlappingCodonSetup.zip

Extract from zip then in the dialog that appears click NEXT - EVERYONE - NEXT - NEXT.

Note : If you do not have the dotNet 4.0 framework installed on your computer already, you may need to install that also. Contact me if you need help. craig_pkooper@yahoo.com

luke1978
07-11-2012, 05:20 AM
Hi Craig,

Do you think there is any correlation between the signature you are looking for and the 22 letters used in the hebrew alphabet?

Keep up the good work. I have a copy of 373 proof set in stone and a printout of Peter Bluer's work with DNA in the genetic code.

I still cannot get my head around the boulay hypothesis?

http://jean-yves.boulay.pagesperso-orange.fr/rap/eng/pagenucleon1.html

Doesn't the symmetry fall apart without swapping a proton and neutron or something like that?

regards

Luke

Craig.Paardekooper
07-11-2012, 07:19 AM
Hi Luke,

The signature I am looking for is a string of 22 different aminoacid letters, all occuring consecutively. This MAY correspond to the 22 letters of the alphabet, hence providing an inbuilt KEY for translating non-coding DNA into spoken language. Once a string of 22 different aminoacids is found, then it's value as a key will be judged solely upon it's ability to translate DNA into meaningful language. I would also expect a genuine key to occur in multiple places.

An effort to find this key is currently underway. 3 days ago I set in motion a software program that is slowly proceeding through the X Chromosome in search of potential keys. It will take an estimated 200 hours to complete analysis.

I have not looked at Boulay's theory yet. Though I am persuaded by Shcherbak's and Rakocevic's. Research is advancing all the time, and you might like to search Pubmed to see what advances have been made.

Isolating Coding from Noncoding Areas

I have worked out a way of identifying WORDS within NonCoding DNA. However, to implement this, I first need to isolate the non-coding DNA areas from the coding areas.

Here is the computer code that I will use to isolate the non-coding DNA -

1. Create an array of all the non-overlapping codons within a sequence

2. Create the variables that we will use
Dim IndexA as Long = 0
Dim IndexB As Long = 0
Dim n as long = 0
Dim Start as Integer = 0
Dim NonCodingDNA as String = ""
Dim CodingDNA as String = ""

3. Next we loop through the array detecting ATG (Start codons) and TAA, TAG, TGA (Stop codons)

For Each codon in CodonArray
If codon = "ATG" then
IndexA = n
Start = 1
NonCodingDNA &= DNA.Substring(IndexB, IndexA - IndexB)
End If

If (codon = "TAA" or codon = "TAG" or codon = "TGA") and Start = 1 then
If n - IndexA > 100 Then
IndexB = n
Start = 0
CodingDNA &= DNA.Substring(IndexA, IndexB - IndexA)
End If
End If

n += 1
Next
This code will isolate all noncoding areas and coding areas based on the criteria that a coding sequence -
1. starts with ATG
2. ends with TAA, TAG or TGA
3. is atleast 100 codons long

Once I have separated out the non-coding areas, then I can convert the codons in these areas into single letter aminoacids.
This should speed up the search for the 22 letter alphabet, since I can concentrate the search on non-coding areas.

Now, what I could also look for are actual words made out of aminoacid letters.

For example, if we took a string of letters such as THECHURCHWASFULLONSUNDAY, then potential 6 letter words would be THECHU, HECHUR, ECHURC, CHURCH etc.

So I can create a list of all possible 6 letter words by looping through the aminoacid letters, incrementing the start position by 1, and length fixed at 6.

So how will we know that any of these words represents a real word such as CHURCH, or is just nonsense such as HECHUR? Well we could see if the frequency of occurrence of a word stands out from the frequency of occurrence of other words.

We would expect real words to have a higher frequency than nonsense.

So I will have to create a separate program that can store all 6 letter words, for example, and then record the frequency of each.

Once we have identified such a "word", then we will have to match it to a spoken word that occurs with similar frequency. It will be a bit like a cross word puzzle. The more "words" we have, the more their letters will overlap, and help in solving the puzzle.

Anyhow, the discovery of an alphabet key would be much faster than this word search, so that is what I am engaged in at present.

luke1978
07-12-2012, 12:31 AM
Hi Luke,

The signature I am looking for is a string of 22 different aminoacid letters, all occuring consecutively. This MAY correspond to the 22 letters of the alphabet, hence providing an inbuilt KEY for translating non-coding DNA into spoken language. Once a string of 22 different aminoacids is found, then it's value as a key will be judged solely upon it's ability to translate DNA into meaningful language. I would also expect a genuine key to occur in multiple places.

An effort to find this key is currently underway. 3 days ago I set in motion a software program that is slowly proceeding through the X Chromosome in search of potential keys. It will take an estimated 200 hours to complete analysis.

I have not looked at Boulay's theory yet. Though I am persuaded by Shcherbak's and Rakocevic's. Research is advancing all the time, and you might like to search Pubmed to see what advances have been made.

Isolating Coding from Noncoding Areas

I have worked out a way of identifying WORDS within NonCoding DNA. However, to implement this, I first need to isolate the non-coding DNA areas from the coding areas.

Here is the computer code that I will use to isolate the non-coding DNA -

1. Create an array of all the non-overlapping codons within a sequence

2. Create the variables that we will use
Dim IndexA as Long = 0
Dim IndexB As Long = 0
Dim n as long = 0
Dim Start as Integer = 0
Dim NonCodingDNA as String = ""
Dim CodingDNA as String = ""

3. Next we loop through the array detecting ATG (Start codons) and TAA, TAG, TGA (Stop codons)

For Each codon in CodonArray
If codon = "ATG" then
IndexA = n
Start = 1
NonCodingDNA &= DNA.Substring(IndexB, IndexA - IndexB)
End If

If (codon = "TAA" or codon = "TAG" or codon = "TGA") and Start = 1 then
If n - IndexA > 100 Then
IndexB = n
Start = 0
CodingDNA &= DNA.Substring(IndexA, IndexB - IndexA)
End If
End If

n += 1
Next
This code will isolate all noncoding areas and coding areas based on the criteria that a coding sequence -
1. starts with ATG
2. ends with TAA, TAG or TGA
3. is atleast 100 codons long

Once I have separated out the non-coding areas, then I can convert the codons in these areas into single letter aminoacids.
This should speed up the search for the 22 letter alphabet, since I can concentrate the search on non-coding areas.

Now, what I could also look for are actual words made out of aminoacid letters.

For example, if we took a string of letters such as THECHURCHWASFULLONSUNDAY, then potential 6 letter words would be THECHU, HECHUR, ECHURC, CHURCH etc.

So I can create a list of all possible 6 letter words by looping through the aminoacid letters, incrementing the start position by 1, and length fixed at 6.

So how will we know that any of these words represents a real word such as CHURCH, or is just nonsense such as HECHUR? Well we could see if the frequency of occurrence of a word stands out from the frequency of occurrence of other words.

We would expect real words to have a higher frequency than nonsense.

So I will have to create a separate program that can store all 6 letter words, for example, and then record the frequency of each.

Once we have identified such a "word", then we will have to match it to a spoken word that occurs with similar frequency. It will be a bit like a cross word puzzle. The more "words" we have, the more their letters will overlap, and help in solving the puzzle.

Anyhow, the discovery of an alphabet key would be much faster than this word search, so that is what I am engaged in at present.

Hi Craig,

My programming knowledge is limited to C++, VB(Haven't done the previous in years) and batch files!

However I can see the logic in what you are doing and I understand that coding to a certain degree. What language is that?

I was thinking about your project and maybe the first and last letters of the hebrew alphabet will correspond to the Start and Stop codons(Is there 3 different stop codons? - Last letter may work for all 3)

So if you find a whole string of 22(Start,Stop and 20 Amino acids) that may be a key?

Maybe you just need to find 20 Amino acids and can assume the places of the first and last letter?

I am probably not fully understanding your project but I hope these ideas are helpful. You will give CERN a run for their money! - Very exciting work you are doing and if the code is there I think you are God's man to find it. Keep us all updated.

Thanks for your work. I'm glad someone is looking.

regards

Luke

Craig.Paardekooper
07-12-2012, 03:58 AM
Hi Luke

There are 20 amino acids and three stop signals generated from the 64 codons via the genetic code. However sometimes, two additional aminoacids are generated instead of two of the stop signals, bringing the total to 22 amino acids and one stop.


Twenty-two amino acids are naturally incorporated into polypeptides and are called proteinogenic or natural amino acids.[10] Of these, 20 are encoded by the universal genetic code. The remaining 2, selenocysteine and pyrrolysine, are incorporated into proteins by unique synthetic mechanisms. Selenocysteine is incorporated when the mRNA being translated includes a SECIS element, which causes the UGA codon to encode selenocysteine instead of a stop codon.[22] Pyrrolysine is used by some methanogenic archaea in enzymes that they use to produce methane. It is coded for with the codon UAG, which is normally a stop codon in other organisms.[23] This UAG codon is followed by a PYLIS downstream sequence.[24]

Craig.Paardekooper
07-12-2012, 04:57 AM
While the software is busy searching DNA for an alphabet key, I thought it would be interesting to convert DNA into binary code, (ie a list of 1s and 0s).

Kraker suggested that the binary format might reveal some interesting patterns when converted into a picture made of pixels where a dark pixel stands for 0 and a light pixel stands for 1.

Anyway, I thought I would give this a shot and see what appears.

DNA has a natural binary structure because there are 4 nucleotides - A, C, T, G.

C always binds with G, and A always binds with T, so DNA could be thought of as having only two pairs which could be replaced by a 1 or a 0

So the nucleotides G and C will be replaced by 1 and the nucleotides A and T will be replaced by 0.

Here is the software that I will use to do this

luke1978
07-12-2012, 05:54 PM
While the software is busy searching DNA for an alphabet key, I thought it would be interesting to convert DNA into binary code, (ie a list of 1s and 0s).

Kraker suggested that the binary format might reveal some interesting patterns when converted into a picture made of pixels where a dark pixel stands for 0 and a light pixel stands for 1.

Anyway, I thought I would give this a shot and see what appears.

DNA has a natural binary structure because there are 4 nucleotides - A, C, T, G.

C always binds with G, and A always binds with T, so DNA could be thought of as having only two pairs which could be replaced by a 1 or a 0

So the nucleotides G and C will be replaced by 1 and the nucleotides A and T will be replaced by 0.

Here is the software that I will use to do this

Hi Craig,

Do all humans have the same DNA?

As an example does an Asian person have slightly different DNA then a Caucasian person?

I'm asking this question as I'm wondering if there are slight variations in DNA how do you come up with a standard to use?

I believe the Mitochondrial DNA is all the same?(37 Genes)

I am following your work with interest.

Craig.Paardekooper
07-13-2012, 02:54 PM
Hi Luke,

I found some samples of human mitochondrial dna here - http://www.mtdb.igp.uu.se/

Though all of these samples are only 16568 bases long. So it was easy to analyse them for an alphabet sequence.

Here are the results for overlapping codons

1. : Reading Frame = 0 : at 6883 : PHTRGEKSAQNIYMU

2. : Reading Frame = 0 : at 7369 : HI1KNTPLWGESVUD

3. : Reading Frame = 0 : at 8354 : FLYTQSVUEKNMCAP

Here are the results for non-overlapping codons

1. : Reading Frame = 2 : at 1117 : QWHS1CLPNEKFOAI

2. : Reading Frame = 2 : at 1118 : WHS1CLPNEKFOAIY

So this sample of mitochondrial dna does not contain an alphabet primer - atleast not one of 22 letters. The longest sequence was only 16 aminoacids long, and this sequence occurs only once.

Craig.Paardekooper
07-16-2012, 11:39 AM
Here is a link to a simple program that I created for isolating coding areas of DNA from non-coding areas -

http://www.craigdemo.co.uk/CodingRegionsSetup.zip

The software isolates all coding regions that start with ATG and end with TAA, TGA or TAG

Because there are three possible reading frames, depending upon where you start reading a codon from, you can access the other reading frames by entering either 0, 1 or 2 in the reading frame box. The default is 0.

To run the software simply choose a text file containing the DNA sequence
This software works best with microbes - because microbes have a simple DNA structure that follows the START-STOP coding pattern. It also works will with cDNA and mRNA of higher organisms, since these do not contain introns.

Vertebrate DNA has a more complicated structure - and requires the identification of SPLICING SITES in addition to the STARTS and STOPS. I will develop the software to work better with higher vertebrates.

Craig.Paardekooper
07-17-2012, 06:08 AM
Here is a procedure that I am going to develop, for identifying possible WORDS within DNA

1. Get a sample of mRNA or cDNA ideally because these have a simple START STOP pattern
2. Identify and extract the non-coding regions
3. Convert non-coding DNA into aminoacids
4. Use a loop to extract all 5 letter sequences where all letters are different
5. Count frequency of each 5 letter sequence

If a 5 letter sequence occurs with high frequency then it may be a WORD, such as "Elohim"

The Results

I took the Mitochondrial DNA for Jews which is 16566 bases long, and measured the frequency of every possible 5-letter sequence. Here are the results -
1SSSO 2 Position = 126
EKPSL 2 Position = 631
FIAPT 2 Position = 744
FYSKD 2 Position = 877
HPSPH 2 Position = 1173
HRTIP 2 Position = 1213
ILVQL 2 Position = 1466
ISTIN 2 Position = 1586
ITLLT 2 Position = 1613
KLKIK 2 Position = 1746
LGLLT 2 Position = 2005
LITIL 2 Position = 2078
LITTQ 2 Position = 2081
LLGLL 2 Position = 2112
LLPHS 2 Position = 2147
LNYNI 2 Position = 2216
LTSTS 2 Position = 2441
NNYIT 2 Position = 2701
NPLVN 2 Position = 2721
NTNYL 2 Position = 2830
OKNPP 2 Position = 2908
PHSSP 2 Position = 3091
PLVNL 2 Position = 3217
PNTNY 2 Position = 3262
PSSTP 2 Position = 3456
PTPLI 2 Position = 3493
RILVQ 2 Position = 3833
SNLNY 2 Position = 4280
SSSTP 2 Position = 4457
SSTPP 2 Position = 4463
TILIL 2 Position = 4700
TPSOP 2 Position = 4888
TTQLS 2 Position = 5029

There are no 5 letter sequences occurs more than 2 times, which is a bit surprising considering that the DNA is 16566 bases long.

Here are the results for 6 letter sequences
NPLVNL 2 Position = 2720
PNTNYL 2 Position = 3261
PSSTPP 2 Position = 3455
RILVQL 2 Position = 3832

There are no 7, 8 or 9 letter sequences that occur more than once

So
IF the aminoacids do map onto the letters of an alphabet,
and IF Mitochondrial DNA contains language areas, THEN the language has a distinct absence of 7, 8 and 9 letter words - which is not characteristic of Hebrew.

Then I split up the DNA into coding and noncoding areas based on the start and stop codons.

The Coding areas of the DNA contained the following 5 letter sequences that occurred more than once -

FYSKD 2 Position = 423
HRTIP 2 Position = 596
ILVQL 2 Position = 733
LGLLT 2 Position = 1021
NNYIT 2 Position = 1434
NPLVN 2 Position = 1447
NTNYL 2 Position = 1503
PLVNL 2 Position = 1706
PNTNY 2 Position = 1732
PTPLI 2 Position = 1850
RILVQ 2 Position = 2015
SSSTP 2 Position = 2369
TPSOP 2 Position = 2597

The noncoding areas contained the following 5 letter sequences occuring more than once -

HPSPH 2 Position = 590
LLGLL 2 Position = 1032
LLPHS 2 Position = 1052
PHSSP 2 Position = 1450
TTQLS 2 Position = 2342

So, in the noncoding areas only 5 "5-letter-words" appear more than once. I do not think that there is a language here.

Repeating the Procedure with Yeast

Yeast has 227020 bases. I divided up the yeast DNA into non-coding and coding areas based on the Start and Stop codons. Then I extracted every 5 letter sequence and recorded the frequency of each one. Here are the results -

Coding Area: The following 5 letter sequences occur more than 5 times -
ARRTT 8 Position = 3028
FARRT 10 Position = 8078
LLLLL 12 Position = 22355
RFARR 7 Position = 33601
RTTRF 7 Position = 35949
SLLLL 6 Position = 38301
TRFAR 9 Position = 42503
TTRFA 9 Position = 43029

Non Coding Areas: There are no 5 letter seqences occuring more than 4 times.
CSUCS 3 Position = 2717
FPLLL 3 Position = 5147
LFLLL 3 Position = 10771
LLFLL 3 Position = 11408
LLLFL 3 Position = 11519
LLLLL 4 Position = 11545
LLLLQ 3 Position = 11551
LLLSL 3 Position = 11575
LRLLF 3 Position = 12264
QLLLL 4 Position = 15724
STSFL 3 Position = 20208
SUCSU 3 Position = 20273
UCSUC 3 Position = 21943

So the noncoding areas of yeast have fewer "5-letter-words" than the coding areas!

I am going to check over the computer code that I used to get these results, to make sure it is working properly, then I will make the software available as a download. The software will simply enable you to count the frequency of each "word" of a chosen length in any sample of DNA. If the DNA contains a language, then the "word" frequencies should indicate this.

Craig.Paardekooper
07-20-2012, 08:00 AM
Rather than trying to discover an aminoacid alphabet by analysig DNA, it would be much easier to see if the aminoacids fall naturally into a sequence. We can arrange the amino acids according to -

1. their mass
2. the order inwhich their codons appear when you cycle through the genetic code.

Shcherbak discovered that if all the aminoacids are arranged in a circle, then there is a perfect balance of masses - see here - www.craigdemo.co.uk/circleoflife.pdf. He thought that it was very odd that all the aminoacids should sum in this way - almost as if they were conceived in one go. Shcherbak's pattern may hold the key to finding the aminoacid alphabet.

What is interesting is that all the aminoacids are together and form this perfect balance. The order of the aminoacids in the circle is determined solely by cycling through the bases, in the order T C A G.

Cycling through the bases in the order TCAG generates the 64 codons in a particular order - consequently it generates the aminoacids in a particular order - an aminoacid alphabet

There are only 4 x 3 x 2 x 1 ways of choosing the order in which you cycle through the bases, so there can be only 24 different possible orders of the codons produced - which would give us 24 different aminoacid alphabets.

It is then quite simple to test each alphabet to see which one generates the most meaningful translation.

So I will create a program that cycles through the bases in each of the 24 possible ways, each time generating the codons in a particular order. This will give me the 20 aminoacids in a particular order each time. So I will end up with 24 aminoacid alphabets - and can then test each one to see if it produces meaningful words.

Craig.Paardekooper
07-21-2012, 08:56 AM
The the scientists who carried out the experiments to show that there is a language structure in DNA, did not convert the DNA into aminoacids first - rather they simply searched for words in the raw DNA sequence, consisting of A,C,T and G.

So I will do this too. If the letters of the language are codons rather than individual nucleotides, then we should find that high frequency words reflect this by being a multiple of three nucleotides long.


Results

Here are the results 5-letter sequences in Non coding areas of Jewish Mitochondrial DNA

Total number of 5 letter words = 7703

Total Number of Different Words = 881

Average Frequency of Words = 8.74347332576617


Here are the results for 5-letter sequences in the coding areas of Jewish Mitochondrial DNA

Total number of 5 letter words = 7706

Total Number of Different Words = 896

Average Frequency of Words = 8.60044642857143


As you can see, there are a similar number of unique words appearing in both coding and noncoding areas, which might suggest that non-coding areas contain just as much information as coding areas.

What might be interesting would be to see what words are unique to coding areas but not found in noncoding areas, and vica versa?

Also, what would be the results for sequences of length 4 to 12 bases long?

Also what are the most frequently occurring words. Perez found that the frequency of all three letter words follows a mathematical pattern. Perhaps similar patterns will be found for larger sequences?

Craig.Paardekooper
07-21-2012, 01:37 PM
So far I have searched 72 million bases of the X Chromosome (which is about half) in search of a sequence of all 20 standard aminoacids . I have analysed both overlapping codons and nonoverlapping codons in all three forward frames, and have not found a single instance yet of the complete sequence of 20 aminoacids. the search continues

Craig.Paardekooper
07-23-2012, 09:09 AM
There is a 30 letter sequence that occurs 68 times in the DNA of Archaea

Here is the sequence - GTTGAAATCAGACTAATGTAGGATTGAAAG

The number on the right is the position of the start of the sequence in the entire genome

Total = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 85039
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665146
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665215
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665283
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665351
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665418
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665488
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665556
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665624
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665692
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665760
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665827
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665896
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665963
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666031
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666099
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666167
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666235
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666302
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666371
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666439
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666507
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666576
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666642
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666715
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666784
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666852
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666921
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666990
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667057
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667126
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667196
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667263
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667332
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667400
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667469
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667538
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667606
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667675
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667742
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667813
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667882
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667950
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668018
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668086
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668154
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668226
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668295
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668363
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668431
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668499
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668567
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668635
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668703
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668771
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668839
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668908
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668977
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669046
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669114
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669182
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669250
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669318
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669386
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669455
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669523
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669599
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669668

When I measured the difference between the beginning of one sequence and the beginning of the next - this is what I got -

GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 85039 - difference = 85039
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665146 - difference = 580107
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665215 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665283 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665351 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665418 - difference = 67
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665488 - difference = 70
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665556 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665624 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665692 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665760 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665827 - difference = 67
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665896 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 665963 - difference = 67
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666031 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666099 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666167 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666235 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666302 - difference = 67
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666371 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666439 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666507 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666576 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666642 - difference = 66
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666715 - difference = 73
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666784 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666852 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666921 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 666990 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667057 - difference = 67
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667126 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667196 - difference = 70
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667263 - difference = 67
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667332 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667400 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667469 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667538 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667606 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667675 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667742 - difference = 67
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667813 - difference = 71
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667882 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 667950 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668018 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668086 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668154 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668226 - difference = 72
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668295 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668363 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668431 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668499 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668567 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668635 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668703 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668771 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668839 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668908 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 668977 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669046 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669114 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669182 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669250 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669318 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669386 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669455 - difference = 69
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669523 - difference = 68
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669599 - difference = 76
GTTGAAATCAGACTAATGTAGGATTGAAAG - 0 - 669668 - difference = 69

So this 30 letter sequence repeats itself 68 times, and each time is separated by 68 bases !

GCGCTATTCTTTTACTTCTCGCAATGCGGTAATCAATGGTTGAAATCAGA CTAATGTAGGATTGAAAGAAGCGCTTGGCTGCTTACTGCGTGGCTCAGTA CTGCGCGTTGAAATCAGACTAATGTAGGATTGAAAGGAGGTGGTTAGAGA CATCTTGAATAAAATGATGGGCAAGTTGAAATCAGACTAATGTAGGATTG AAAGCTTATTGACTTCTTCAATTCTCCCTTTTAGATATAGATGTTGAAAT CAGACTAATGTAGGATTGAAAGGCATAACAGAGTGCGCCCTCCGTGCCTC CCGTTCCGTGTTGAAATCAGACTAATGTAGGATTGAAAGATGGGGGAACT GGCTCGAACTCGCTGATTTCTTCGAAGAGTTGAAATCAGACTAATGTAGG ATTGAAAGCAAATTAGCAAGGGCTACAACGATACCATCATACGGAGTTGA AATCAGACTAATGTAGGATTGAAAGATCAACATCGGTCCGGGACAATATC AGTTCAAGGCGAGGTTGAAATCAGACTAATGTAGGATTGAAAGCTATGAG TACTGTAAAAGGAATTTAAATTTAAAATAGGGTTGAAATCAGACTAATGT AGGATTGAAAGTTCTAATGCCGTGAAGTATGCTCTTTTTGCTTCGGGAGG TTGAAATCAGACTAATGTAGGATTGAAAGGATTGTGGCGGTGATTTGGTG GACTTAGGCAACAATGAGTTGAAATCAGACTAATGTAGGATTGAAAGTAC TTCAGACAATACAATATCCCAATCGAACAACACAGTTGAAATCAGACTAA TGTAGGATTGAAAGACGGTGAACGTTGATCATCCTTTGATTGTCTTGCTG GTTGTTGAAATCAGACTAATGTAGGATTGAAAGTGTCCATCAAAAGGCCT AACGGAGGATGAGGTTCAAGAGTTGAAATCAGACTAATGTAGGATTGAAA GTTCCCACTTGATGATACCCTGACCTTCATTCTTTTCGAGTTGAAATCAG ACTAATGTAGGATTGAAAGTTGTGGTATAATTAATAGTTCTCATCTGCCA TTTTTTATGTTGAAATCAGACTAATGTAGGATTGAAAGGCTCGCAAGGAA ATGCTGAACGGAAATAGGCACACCGTTGAAATCAGACTAATGTAGGATTG AAAGACTCTTTCACCTCCTAACAGCTTTTTTCTATATACTGTCACTGGTT GAAATCAGACTAATGTAGGATTGAAAGTCTATACCACCTCAAAAAATGTT TAAGGAAGCAGAATCTGTTGAAATCAGACTAATGTAGGATTGAAAGTTTG GGGTAACTGGCTTGAGCTTGCAGACTTCTTAGAGGTTGAAATCAGACTAA TGTAGGATTGAAAGGCGAGCATGAACGGGAACTGCACGAATCCGCGGGCT CCCGTTGAAATCAGACTAATGTAGGATTGAAAGATAGCTGCAAAAATCTT TTGCATCCCTGCAAGTCCCCTTGTTGAAATCAGACTAATGTAGGATTGAA AGGCAAATAATCTATAAACTGTCTCGCTAAGTCGAAAGCGTTGAAATCAG ACTAATGTAGGATTGAAAGCTCGAGTTCCCTGCTCATCCTGCTATATCTC TCAAAAATGTTGAAATCAGACTAATGTAGGATTGAAAGAGGATTACAGCC GGAATCCTCAGCCAGCCGACGAAGTAGAGTTGAAATCAGACTAATGTAGG ATTGAAAGAGATTGCCCCCCTCAGCATGGCGGGGGACATTCGCGAGTTGA AATCAGACTAATGTAGGATTGAAAGTATTGTCAACCTTTTAATTCGCTCT TTCAATGCCCTAAAGTTGAAATCAGACTAATGTAGGATTGAAAGTAGAGG AATGGGAAATTCTGGGGAAGGATGACGAAAAAGTTGAAATCAGACTAATG TAGGATTGAAAGCTAAGAAGGCTTATAGTTGAGCACAGACACTTGGATTT AGTTGAAATCAGACTAATGTAGGATTGAAAGTAGGGGGGAGGTAGATGAG GATTGAAAGAGGGAATCTCAGTTGAAATCAGACTAATGTAGGATTGAAAG GAGAAGAGCTGACGTTCACTGAAGAGGACGGAAACAACGTTGAAATCAGA CTAATGTAGGATTGAAAGCTGGGGTAACTTTCCGAAGTTCAAATGCAGGC ATGAACTGTTGAAATCAGACTAATGTAGGATTGAAAGGATTCTAAGTTAA AATAGATGGGTTGAATAAAAAAAGGTTGAAATCAGACTAATGTAGGATTG AAAGGGACATGGGGCAATAAGCAGCCATTCAGCCCAGAGCCATCTGTTGA AATCAGACTAATGTAGGATTGAAAGATAGAGTTCTATGTTGTAGTATGTT CCTGCAGAGAGATCGTTGAAATCAGACTAATGTAGGATTGAAAGCATGCT CTTGCTGAGCCATAGCCAAGCCCATGAAGCGGGTTGAAATCAGACTAATG TAGGATTGAAAGACGTAGATTTGACATTCTCAGCGGGCGCAACGAGGCAG GTTGAAATCAGACTAATGTAGGATTGAAAGTTACATATATCTACAAAAGC TGCACAATCTGCAGCATCGTTGAAATCAGACTAATGTAGGATTGAAAGAA TAAGAGCGGGCGAGTATGGCGACATGAGCGAGGCAAGTTGAAATCAGACT AATGTAGGATTGAAAGCTTCGAATGGGATAAGGGCTTAGAGGATTTGGCC GAATGGGAGTTGAAATCAGACTAATGTAGGATTGAAAGCATGCTGAAAAC TACATTGTCTTCAAGGGCGTTTCTTATGTTGAAATCAGACTAATGTAGGA TTGAAAGAATCCTGTGACAGTGCAACGTATTACTTTACTATTCATGTTGA AATCAGACTAATGTAGGATTGAAAGGACTCTGTGTGTGAGGTGGTGGTAG AGATGGAGCAAAAGTTGAAATCAGACTAATGTAGGATTGAAAGTTTTGAG AAAATAAGACGTATAAACCTTTGTAACAATGGTTGAAATCAGACTAATGT AGGATTGAAAGAAATTCCTCGGACGGGATAAGTTCAGCAAAGTTATCGCG TTGAAATCAGACTAATGTAGGATTGAAAGGTTTGATGTGCGAATGTGGAT ACTCGAAGAGGTATGTTGTTGAAATCAGACTAATGTAGGATTGAAAGTTG AACCATATCTCGTTCTGAGGGAAACTCATCTGAACGTTGAAATCAGACTA ATGTAGGATTGAAAGGTTCCAGCCTGTGATAATAAAAAGCACCACAGCAC CGAGTTGAAATCAGACTAATGTAGGATTGAAAGACATAAATCATTATCCT GTCGAAGTTTCAGATTATTTGGTTGAAATCAGACTAATGTAGGATTGAAA GGATATACCATCAACTGAATTACCTGAATTGCCATTAACAGTTGAAATCA GACTAATGTAGGATTGAAAGGTTGCGTATGCGCCCAGATATGGTACGAAC TGTTCAAAAGTTGAAATCAGACTAATGTAGGATTGAAAGCGCTGGGACGA TAATCAGACTTGTAAACGCTGATGCTACGTTGAAATCAGACTAATGTAGG ATTGAAAGCGCTGATACAGCTTCAGCGGAGTCATACGCTTAATCCTGTTG AAATCAGACTAATGTAGGATTGAAAGTTCTATTTCTCGTCCGATATCCCT ACTGTAGTGTCTTAGTTGAAATCAGACTAATGTAGGATTGAAAGAATTTA TTGGGCCGATGGCAACACGCCCAGCTGAGCTTGTTGAAATCAGACTAATG TAGGATTGAAAGTTTTGTCCCGCTGAGCACGTGCACGCTGCGAATGATTG GTTGAAATCAGACTAATGTAGGATTGAAAGTTCATTCTCTCTTTCAATCT CAGCAATCTTACTCATTAGTTGAAATCAGACTAATGTAGGATTGAAAGTA CTTGCGGAGCTACTACGACAAATACGCCAAACTGCTCGTTGAAATCAGAC TAATGTAGGATTGAAAGGTAGGGATTTCTTTAATCCAGGTTTCGTCAATT GCTGCGTTGAAATCAGACTAATGTAGGATTGAAAGACATCTGAATCTTCG AATACCTCAATGCTGTATATGCTCGCTGTGCGTTGAAATCAGACTAATGT AGGATTGAAAGAGTACCCTTTCAAGCACAATCACGGCGATATCGTCTGCA GTTGAAATCAGACTAATGTAGGATTGAAAGCTTTGTACCTCAGCATAGCT CCCACAACACCGAGCAGCCCGGGTTGAAATCAGACTAATGTAAGATTGAG AAACGTACTGTAGTGGAGTTTAGAAGGATCAAAAAATTCTCATCATTATT AACAAAAATATCGCTATTCTTAATAAGTATTTGTTATCAAAAAATCAGCC AATGCCCAAAAGGGTCTCAACAGGAATTCCCGGATTCGATGAACTTTGCG GGGGTGGGCTGCCGCAAGGAGGTACGTATCTTGTTGTAGGAGCTGCAGAA TCTGGAAAAACTGTTTTTTCTATGCAGTATCTGGTAAATGGGGCGAGGAT GTTTGGGGAAGCAGGAATATTCATCACC


GCGCTATTCTTTTACTTCTCGCAATGCGGTAATCAATG
GTTGAAATCAGACTAATGTAGGATTGAAAGAAGCGCTTGGCTGCTTACTG CGTGGCTCAGTACTGCGC
GTTGAAATCAGACTAATGTAGGATTGAAAGGAGGTGGTTAGAGACATCTT GAATAAAATGATGGGCAA
GTTGAAATCAGACTAATGTAGGATTGAAAGCTTATTGACTTCTTCAATTC TCCCTTTTAGATATAGAT
GTTGAAATCAGACTAATGTAGGATTGAAAGGCATAACAGAGTGCGCCCTC CGTGCCTCCCGTTCCGT
GTTGAAATCAGACTAATGTAGGATTGAAAGATGGGGGAACTGGCTCGAAC TCGCTGATTTCTTCGAAGA
GTTGAAATCAGACTAATGTAGGATTGAAAGCAAATTAGCAAGGGCTACAA CGATACCATCATACGGA
GTTGAAATCAGACTAATGTAGGATTGAAAGATCAACATCGGTCCGGGACA ATATCAGTTCAAGGCGAG
GTTGAAATCAGACTAATGTAGGATTGAAAGCTATGAGTACTGTAAAAGGA ATTTAAATTTAAAATAGG
GTTGAAATCAGACTAATGTAGGATTGAAAGTTCTAATGCCGTGAAGTATG CTCTTTTTGCTTCGGGAG
GTTGAAATCAGACTAATGTAGGATTGAAAGGATTGTGGCGGTGATTTGGT GGACTTAGGCAACAATGA
GTTGAAATCAGACTAATGTAGGATTGAAAGTACTTCAGACAATACAATAT CCCAATCGAACAACACA
GTTGAAATCAGACTAATGTAGGATTGAAAGACGGTGAACGTTGATCATCC TTTGATTGTCTTGCTGGTT
GTTGAAATCAGACTAATGTAGGATTGAAAGTGTCCATCAAAAGGCCTAAC GGAGGATGAGGTTCAAGA
GTTGAAATCAGACTAATGTAGGATTGAAAGTTCCCACTTGATGATACCCT GACCTTCATTCTTTTCGA
GTTGAAATCAGACTAATGTAGGATTGAAAGTTGTGGTATAATTAATAGTT CTCATCTGCCATTTTTTAT
GTTGAAATCAGACTAATGTAGGATTGAAAGGCTCGCAAGGAAATGCTGAA CGGAAATAGGCACACC
GTTGAAATCAGACTAATGTAGGATTGAAAGACTCTTTCACCTCCTAACAG CTTTTTTCTATATACTGTCACTG
GTTGAAATCAGACTAATGTAGGATTGAAAGTCTATACCACCTCAAAAAAT GTTTAAGGAAGCAGAATCT
GTTGAAATCAGACTAATGTAGGATTGAAAGTTTGGGGTAACTGGCTTGAG CTTGCAGACTTCTTAGAG
GTTGAAATCAGACTAATGTAGGATTGAAAGGCGAGCATGAACGGGAACTG CACGAATCCGCGGGCTCCC
GTTGAAATCAGACTAATGTAGGATTGAAAGATAGCTGCAAAAATCTTTTG CATCCCTGCAAGTCCCCTT
GTTGAAATCAGACTAATGTAGGATTGAAAGGCAAATAATCTATAAACTGT CTCGCTAAGTCGAAAGC
GTTGAAATCAGACTAATGTAGGATTGAAAGCTCGAGTTCCCTGCTCATCC TGCTATATCTCTCAAAAAT
GTTGAAATCAGACTAATGTAGGATTGAAAGAGGATTACAGCCGGAATCCT CAGCCAGCCGACGAAGTAGA
GTTGAAATCAGACTAATGTAGGATTGAAAGAGATTGCCCCCCTCAGCATG GCGGGGGACATTCGCGA
GTTGAAATCAGACTAATGTAGGATTGAAAGTATTGTCAACCTTTTAATTC GCTCTTTCAATGCCCTAAA
GTTGAAATCAGACTAATGTAGGATTGAAAGTAGAGGAATGGGAAATTCTG GGGAAGGATGACGAAAAA
GTTGAAATCAGACTAATGTAGGATTGAAAGCTAAGAAGGCTTATAGTTGA GCACAGACACTTGGATTTA
GTTGAAATCAGACTAATGTAGGATTGAAAGTAGGGGGGAGGTAGATGAGG ATTGAAAGAGGGAATCTCA
GTTGAAATCAGACTAATGTAGGATTGAAAGGAGAAGAGCTGACGTTCACT GAAGAGGACGGAAACAAC
GTTGAAATCAGACTAATGTAGGATTGAAAGCTGGGGTAACTTTCCGAAGT TCAAATGCAGGCATGAACT
GTTGAAATCAGACTAATGTAGGATTGAAAGGATTCTAAGTTAAAATAGAT GGGTTGAATAAAAAAAG
GTTGAAATCAGACTAATGTAGGATTGAAAGGGACATGGGGCAATAAGCAG CCATTCAGCCCAGAGCCATCT
GTTGAAATCAGACTAATGTAGGATTGAAAGATAGAGTTCTATGTTGTAGT ATGTTCCTGCAGAGAGATC
GTTGAAATCAGACTAATGTAGGATTGAAAGCATGCTCTTGCTGAGCCATA GCCAAGCCCATGAAGCGG
GTTGAAATCAGACTAATGTAGGATTGAAAGACGTAGATTTGACATTCTCA GCGGGCGCAACGAGGCAG
GTTGAAATCAGACTAATGTAGGATTGAAAGTTACATATATCTACAAAAGC TGCACAATCTGCAGCATC
GTTGAAATCAGACTAATGTAGGATTGAAAGAATAAGAGCGGGCGAGTATG GCGACATGAGCGAGGCAA
GTTGAAATCAGACTAATGTAGGATTGAAAGCTTCGAATGGGATAAGGGCT TAGAGGATTTGGCCGAATGGGA
GTTGAAATCAGACTAATGTAGGATTGAAAGCATGCTGAAAACTACATTGT CTTCAAGGGCGTTTCTTAT
GTTGAAATCAGACTAATGTAGGATTGAAAGAATCCTGTGACAGTGCAACG TATTACTTTACTATTCAT
GTTGAAATCAGACTAATGTAGGATTGAAAGGACTCTGTGTGTGAGGTGGT GGTAGAGATGGAGCAAAA
GTTGAAATCAGACTAATGTAGGATTGAAAGTTTTGAGAAAATAAGACGTA TAAACCTTTGTAACAATG
GTTGAAATCAGACTAATGTAGGATTGAAAGAAATTCCTCGGACGGGATAA GTTCAGCAAAGTTATCGC
GTTGAAATCAGACTAATGTAGGATTGAAAGGTTTGATGTGCGAATGTGGA TACTCGAAGAGGTATGTT
GTTGAAATCAGACTAATGTAGGATTGAAAGTTGAACCATATCTCGTTCTG AGGGAAACTCATCTGAAC
GTTGAAATCAGACTAATGTAGGATTGAAAGGTTCCAGCCTGTGATAATAA AAAGCACCACAGCACCGA
GTTGAAATCAGACTAATGTAGGATTGAAAGACATAAATCATTATCCTGTC GAAGTTTCAGATTATTTG
GTTGAAATCAGACTAATGTAGGATTGAAAGGATATACCATCAACTGAATT ACCTGAATTGCCATTAACA
GTTGAAATCAGACTAATGTAGGATTGAAAGGTTGCGTATGCGCCCAGATA TGGTACGAACTGTTCAAAA
GTTGAAATCAGACTAATGTAGGATTGAAAGCGCTGGGACGATAATCAGAC TTGTAAACGCTGATGCTAC
GTTGAAATCAGACTAATGTAGGATTGAAAGCGCTGATACAGCTTCAGCGG AGTCATACGCTTAATCCT
GTTGAAATCAGACTAATGTAGGATTGAAAGTTCTATTTCTCGTCCGATAT CCCTACTGTAGTGTCTTA
GTTGAAATCAGACTAATGTAGGATTGAAAGAATTTATTGGGCCGATGGCA ACACGCCCAGCTGAGCTT
GTTGAAATCAGACTAATGTAGGATTGAAAGTTTTGTCCCGCTGAGCACGT GCACGCTGCGAATGATTG
GTTGAAATCAGACTAATGTAGGATTGAAAGTTCATTCTCTCTTTCAATCT CAGCAATCTTACTCATTA
GTTGAAATCAGACTAATGTAGGATTGAAAGTACTTGCGGAGCTACTACGA CAAATACGCCAAACTGCTC
GTTGAAATCAGACTAATGTAGGATTGAAAGGTAGGGATTTCTTTAATCCA GGTTTCGTCAATTGCTGC
GTTGAAATCAGACTAATGTAGGATTGAAAGACATCTGAATCTTCGAATAC CTCAATGCTGTATATGCTCGCTGTGC
GTTGAAATCAGACTAATGTAGGATTGAAAGAGTACCCTTTCAAGCACAAT CACGGCGATATCGTCTGCA
GTTGAAATCAGACTAATGTAGGATTGAAAGCTTTGTACCTCAGCATAGCT CCCACAACACCGAGCAGCCCGG
GTTGAAATCAGACTAATGTAAGATTGAGAAACGTACTGTAGTGGAGTTTA GAAGGATCAAAAAATTCTCATCATTATTAACAAAAATATCGCTATTCTTA ATAAGTATTTGTTATCAAAAAATCAGCCAATGCCCAAAAGGGTCTCAACA GGAATTCCCGGATTCGATGAACTTTGCGGGGGTGGGCTGCCGCAAGGAGG TACGTATCTTGTTGTAGGAGCTGCAGAATCTGGAAAAACTGTTTTTTCTA TGCAGTATCTGGTAAATGGGGCGAGGATGTTTGGGGAAGCAGGAATATTC ATCACC

These findings have been confirmed here - http://crispr.u-psud.fr/crispr/crispr.php?checked%5B%5D=NC_015320_3

There is another area in this Archaea where an almost identical pattern occurs. The word differs by only one letter, and the spacing between words is about 68 bases.
The word occurs 20 times.

GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 83682 - difference = 83682
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 83749 - difference = 67
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 83824 - difference = 75
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 83892 - difference = 68
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 83960 - difference = 68
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84027 - difference = 67
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84094 - difference = 67
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84161 - difference = 67
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84229 - difference = 68
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84295 - difference = 66
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84363 - difference = 68
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84429 - difference = 66
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84497 - difference = 68
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84565 - difference = 68
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84631 - difference = 66
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84699 - difference = 68
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84768 - difference = 69
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84836 - difference = 68
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84903 - difference = 67
GTTGAAATCAGACTATTGTAGGATTGAAAG - 2 - 84971 - difference = 68

Craig.Paardekooper
07-23-2012, 11:31 AM
Here is a pattern that I found in Elusimicrobium Minutum Archaea.

The longest repeating sequence is 36 bases long (6 x 6)
Each of the repeats is separated from the previous one by 66 bases
There are 13 repeats altogether

There are 12 spacers between these 13 repeats.

Total length of the 12 spacers = 13 x 30 - 1
Total length of the 13 repeats = 13 x 6 x 6
Total length of whole sequence = 13 x 66 - 1

ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC


Total = 13
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266139 - difference = 266139
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266204 - difference = 65
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266270 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266336 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266402 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266468 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266534 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266600 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266666 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266732 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266798 - difference = 66
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266930 - difference = 132
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC - 0 - 266996 - difference = 66


You might compare this to Termite Bacterium. Here the sequence length is 36 or 6 x 6, and the sequence repeats 21 times, with 66 bases between each repetition.

Total length of the 20 spacers = 3 x 7 x 30
Total length of the 21 repeats = 3 x 7 x 6 x 6
Total length of whole sequence = 3 x 7 x 66


GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 21


Total = 21
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 343558 - difference = 343558
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 343624 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 343755 - difference = 131
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 343821 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 343888 - difference = 67
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 343954 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344020 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344086 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344152 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344218 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344284 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344350 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344416 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344482 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344548 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344614 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344680 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344746 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344812 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344878 - difference = 66
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT - 0 - 344944 - difference = 66

GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATATAATAGCGATAGC AGTGATATTCTTGATG
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCAATATTTTCAAGC CCAGTGCTGTCTCCAAGTTTAGTTTCCTTCCTCTCTCAGATGTGCTATAA TATTACCATTAGCATCTAATCCAAATGATTT
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATACCGTATGCTTCTA TAGTGTTTAATCTACA
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATTGTATTCAGCTTCA ATGGCGATTTTTGGTTC
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATTTACGAACCGATTA AACAAACATGGGACGC
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCCAGAGATACGACG AACGTCACGGATTGAA
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCATTATATCAGCGA TTGAGAGCATAAAACC
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATTTGATTCGCTGAGA GCCTTTACGGCCTGTG
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCAAAGTAAATACCA TACGGGAACCACGTAG
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATGTACTAAAGGGTGC TACTACAGTAAAGCCC
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCAATTGTACGGAAT ATATTAACTTTCTTAC
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATGTAAGGTGCATAGC GTACTCCGGTAGCTGG
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATTGGATATCATATTA CCTGCATACGCTGATA
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATTAACCAAAGCAGGC ATATCGTATACATTGG
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATACATTGTTAAAAAA TATAGAGAGAATTACG
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCAGGGATTATTACG TCCTCGCCTGCTTTTA
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATGCAAAGTAACTTAA TCTAAACATTTTTACA
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATATGACGAATATAAA ACTATGGCTGATATAG
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATGAATTCAAGTACGA CGATATCAGAGATGGT
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCATGCAAAGCACTT TTATCACACTTACGTA
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAAT

Termite Bacterium also displays longer sequences -

Here the sequence is 2 x 19 bases long, and repeats 6 times
The total length of the 5 spacers = 19 x 66

GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCA - 0 - 343624 - difference = 343624
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCA - 0 - 344020 - difference = 396
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCA - 0 - 344152 - difference = 132
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCA - 0 - 344284 - difference = 132
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCA - 0 - 344614 - difference = 330
GTTATAGTTTCCTTCCTCTCTCAGATGTGCTATAATCA - 0 - 344878 - difference = 264

Once again the interludes are multiples of 66.

And here we have a sequence of 2 x 20 bases, occurring 2 x 2 times, and each one separated by a multiple of 22

GTTTGGTTTTTATGTGTTAGTAGTTTGGTTTTTATGTGTT - 0 - 3559 - difference = 3559
GTTTGGTTTTTATGTGTTAGTAGTTTGGTTTTTATGTGTT - 0 - 3581 - difference = 22
GTTTGGTTTTTATGTGTTAGTAGTTTGGTTTTTATGTGTT - 0 - 3625 - difference = 22 x 2
GTTTGGTTTTTATGTGTTAGTAGTTTGGTTTTTATGTGTT - 0 - 3647 - difference = 22

And here we have a sequence of 43 bases

GTAGTTTGGTTTTTATGTGTTAGTAGTTTGGTTTTTATGTGTT - 0 - 3556 - difference = 3556
GTAGTTTGGTTTTTATGTGTTAGTAGTTTGGTTTTTATGTGTT - 0 - 3578 - difference = 22
GTAGTTTGGTTTTTATGTGTTAGTAGTTTGGTTTTTATGTGTT - 0 - 3644 - difference = 66

Repeats can be thought of as cycles when the repeat occurs at regular intervals. A cycle of 66 reminds me of Richards Biblewheel with 66 books divided into 3 cycles of 22 books each. In the Termite Bacterium we have 66 bases in each cycle = 22 codons.

It is interesting to find cycles within DNA, since they probably have a nested structure, with super-cycles encompassing smaller ones. Perhaps a grand scheme will emerge. Vernon found that when the values of the words in Genesis 1 v 1 are laid out as blocks of height 37 units, then each word turns out to be a multiple of 37 - a multiple of 6.

In the same way, if repeats define the cyclic nature of DNA, then laying out DNA in accordance with the cycle length may reveal some striking patterns. One way to detect this would be to create a program that automatically high-lights all repeats within a sequence. This would have to be done using a rich-textbox that allows font manipulation. Once the repeats are highlighted, then a slider could adjust the width (in base numbers) of the DNA display to see when repeats aligned or were in synchrony.

It would be interesting to see what part prime numbers play in these repeats. I understand that there are some ready-made online programs that I can use to help with this task - BLAST is one of them. I will read up on them and post a link to the resources.

What lies between the repeats is also of interest. It is here that I would expect smaller cycles to exist.

Approaching the topic on a statistical level, it would be interesting to find out which numbers stand out as the most common lengths of repeats, and most common lengths between repeats. The different lengths could be displayed on a graph - with the highest peaks indicating the most common.

Craig.Paardekooper
07-23-2012, 12:10 PM
I think that this is an interesting repeating pattern - found in common yeast. The word length is 20 bases and the word occurs 8 times - every time separated by a multiple of 21 bases

GACCACTCGATTCGCGCGCA - 0 - 129413 - difference = 129413
GACCACTCGATTCGCGCGCA - 0 - 129455 - difference = 42
GACCACTCGATTCGCGCGCA - 0 - 129476 - difference = 21
GACCACTCGATTCGCGCGCA - 0 - 129497 - difference = 21
GACCACTCGATTCGCGCGCA - 0 - 129518 - difference = 21
GACCACTCGATTCGCGCGCA - 0 - 129539 - difference = 21
GACCACTCGATTCGCGCGCA - 0 - 129623 - difference = 84
GACCACTCGATTCGCGCGCA - 0 - 129644 - difference = 21

This sequence also occurs

TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129402 - difference = 129402
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129465 - difference = 63
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129486 - difference = 21
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129507 - difference = 21
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129612 - difference = 105
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129633 - difference = 21

Each sequence is also separated by a multiple of 21 bases

This sequence also occurs

TTCGCGCGCAGGACCACTCGATTCGCGCGCAGGACCACTCGATTCGCGCG CA - 0 - 129465 - difference = 129465
TTCGCGCGCAGGACCACTCGATTCGCGCGCAGGACCACTCGATTCGCGCG CA - 0 - 129486 - difference = 21
TTCGCGCGCAGGACCACTCGATTCGCGCGCAGGACCACTCGATTCGCGCG CA - 0 - 129612 - difference = 126

Once again each sequence is separated by a multiple of 21

Richard Amiel McGough
07-23-2012, 12:34 PM
I think that this is an interesting repeating pattern - found in common yeast. The word length is 20 bases and the word occurs 8 times - every time separated by a multiple of 21 bases

GACCACTCGATTCGCGCGCA - 0 - 129413 - difference = 129413
GACCACTCGATTCGCGCGCA - 0 - 129455 - difference = 42
GACCACTCGATTCGCGCGCA - 0 - 129476 - difference = 21
GACCACTCGATTCGCGCGCA - 0 - 129497 - difference = 21
GACCACTCGATTCGCGCGCA - 0 - 129518 - difference = 21
GACCACTCGATTCGCGCGCA - 0 - 129539 - difference = 21
GACCACTCGATTCGCGCGCA - 0 - 129623 - difference = 84
GACCACTCGATTCGCGCGCA - 0 - 129644 - difference = 21

This sequence also occurs

TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129402 - difference = 129402
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129465 - difference = 63
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129486 - difference = 21
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129507 - difference = 21
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129612 - difference = 105
TTCGCGCGCAGGACCACTCGATTCGCGCGCA - 0 - 129633 - difference = 21

Each sequence is also separated by a multiple of 21 bases

This sequence also occurs

TTCGCGCGCAGGACCACTCGATTCGCGCGCAGGACCACTCGATTCGCGCG CA - 0 - 129465 - difference = 129465
TTCGCGCGCAGGACCACTCGATTCGCGCGCAGGACCACTCGATTCGCGCG CA - 0 - 129486 - difference = 21
TTCGCGCGCAGGACCACTCGATTCGCGCGCAGGACCACTCGATTCGCGCG CA - 0 - 129612 - difference = 126

Once again each sequence is separated by a multiple of 21
That is very curious. Any idea what it might mean? Is there anything in common amongst the sequences of length 21n that divide the repeated sequences?

Craig.Paardekooper
07-23-2012, 03:30 PM
Here is the full sequence, so you can see what lies between each sequence -

GACCACTCGATTCGCGCGCAGGACCACTCGGTTCGCGCGCAAGACCACTC GATTCGCGCGCAGGACCACTCGATTCGCGCGCAGGACCACTCGATTCGCG CGCAGGACCACTCGATTCGCGCGCAAGACCACTCGATTCGCGCGCAAGAC CACCTGATTCGCGCGCAGGACCACCTGATTCGCGCGCAGGACCATCCGGT TCGCGCGCAGGACCACTCGATTCGCGCGCAG

Craig.Paardekooper
07-25-2012, 07:14 AM
Here are the results for Thermococcus Archaea

The sequence has 29 letters and repeats itself 39 times
The distance between the beginning of each sequence is approx 66 letters.


Total = 39
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 100515 - difference = 100515
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 100582 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 100648 - difference = 66
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 100716 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 100782 - difference = 66
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 100850 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 100917 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 100982 - difference = 65
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101049 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101113 - difference = 64
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101180 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101245 - difference = 65
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101312 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101380 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101447 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101513 - difference = 66
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101578 - difference = 65
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101646 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101713 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101781 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101849 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101915 - difference = 66
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 101980 - difference = 65
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102047 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102114 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102182 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102248 - difference = 66
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102314 - difference = 66
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102381 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102444 - difference = 63
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102512 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102578 - difference = 66
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102648 - difference = 70
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102715 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102782 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102849 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102917 - difference = 68
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 102984 - difference = 67
TTTCAATTCTCCCAGAGTCTTATTGCAAC - 0 - 103050 - difference = 66

Another sequence is 30 letters long, and repeats 37 times. The space between the beginning of each sequence varies between 66 - 69 letters

Total = 37
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347446 - difference = 347446
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347510 - difference = 64
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347579 - difference = 69
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347648 - difference = 69
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347716 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347783 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347849 - difference = 66
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347915 - difference = 66
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 347983 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348050 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348117 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348185 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348252 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348319 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348387 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348454 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348523 - difference = 69
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348589 - difference = 66
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348657 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348724 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348791 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348857 - difference = 66
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348923 - difference = 66
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 348989 - difference = 66
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349057 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349125 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349192 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349259 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349326 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349393 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349461 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349528 - difference = 67
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349596 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349662 - difference = 66
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349730 - difference = 68
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349800 - difference = 70
GTTGCAATAAGACTCTAGGAGAATTGAAAC - 0 - 349867 - difference = 67

Here is a 16 letter sequence = 4 x 4 that repeats 14 times
The distance between the beginning of one sequence and the next is 16 = 4 x 4

Total = 11
TAAGGAGGTGATATAG - 0 - 909684 - difference = 909684
TAAGGAGGTGATATAG - 0 - 909700 - difference = 16
TAAGGAGGTGATATAG - 0 - 909716 - difference = 16
TAAGGAGGTGATATAG - 0 - 909732 - difference = 16
TAAGGAGGTGATATAG - 0 - 909748 - difference = 16
TAAGGAGGTGATATAG - 0 - 909764 - difference = 16
TAAGGAGGTGATATAG - 0 - 909780 - difference = 16
TAAGGAGGTGATATAG - 0 - 909796 - difference = 16
TAAGGAGGTGATATAG - 0 - 909812 - difference = 16
TAAGGAGGTGATATAG - 0 - 909828 - difference = 16
TAAGGAGGTGATATAG - 0 - 909844 - difference = 16
TAAGGAGGTGATATAG - 0 - 909860 - difference = 16
TAAGGAGGTGATATAG - 0 - 909876 - difference = 16
TAAGGAGGTGATATAG - 0 - 909892 - difference = 16


If we take off the last letter, then it becomes a 64 letter sequence = 4 x 4 x 4
Each sequence itself consists of 4 distinct parts TAAGGAGGTGATATAG each of 4 x 4
And each sequence begins 4 x 4 after the beginning of the previous one.

Here is the actual DNA sequence so you can see what is going on -

TAAGGAGGTGATATAGTAAGGAGGTGATATAGTAAGGAGGTGATATAGTA AGGAGGTGATATAGTAAGGAGGTGATATAGTAAGGAGGTGATATAGTAAG GAGGTGATATAGTAAGGAGGTGATATAGTAAGGAGGTGATATAGTAAGGA GGTGATATAGTAAGGAGGTGATATAGTAAGGAGGTGATATAGTAAGGAGG TGATATAGTAAGGAGGTGATATAG