Google Ads

Google Ads

Bible Wheel Book

+ Reply to Thread
Page 17 of 54 FirstFirst ... 713141516171819202127 ... LastLast
Results 161 to 170 of 540
  1. #161
    Join Date
    May 2012
    Posts
    17

    where to find my stuff

    Dear Craig.

    The following address will take you to a site that has all of my work regarding DNA and the Hebrew language.

    http://www.bibliotecapleyades.net/ci...x.htm#CONTENTS

    Regards,
    Steve Krakowski

  2. #162
    Join Date
    Jun 2007
    Location
    Yakima, Wa
    Posts
    14,721
    Quote Originally Posted by Krakers View Post
    Dear Craig.

    The following address will take you to a site that has all of my work regarding DNA and the Hebrew language.

    http://www.bibliotecapleyades.net/ci...x.htm#CONTENTS

    Regards,
    Steve Krakowski
    Hi Steve,

    Welcome to our forum!



    The url you posted was not copied correctly. Please try again. I'd like to see the research you have presented.

    All the best,

    Richard
    • Skepticism is the antiseptic of the mind.
    • Remember why we debate. We have nothing to lose but the errors we hold. Who but a stubborn fool would hold to errors once they have been exposed?

    Check out my blog site

  3. #163
    Join Date
    May 2012
    Posts
    17

    where to find my stuff

    Thanks for the welcome Richard.

    The link that I put in message #159 (my original post) seems to work ok.

    http://www.bibliotecapleyades.net/ci...ltgeneticcode/


    regards,
    Krakers
    Last edited by Krakers; 05-05-2012 at 12:16 PM. Reason: website reentered

  4. #164
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Testing of Krakers Amino Acid Alphabet

    In Krakers article, Kraker makes the following matches between Amino Acid and Hebrew letters

    1. Kaph = Phenylalanine
    2. Pe = Leucine
    3. Gimel = Isoleucine
    4. Shin = Methionine
    5. Beth = Valine
    6. Zain = Serine
    7. Daleth = Proline
    8. Teth = Threonine
    9. Tau = Alanine
    10. He = Tyrosine
    11. Aleph = Stop 1
    12. Nun = Histidine
    13. Tzaddi = Glutamine
    14. Cheth = Asparagine
    15. Ayin = Lysine
    16. Yod = Aspartic Acid
    17. Samekh = Glutamic Acid
    18. Vau = Cysteine
    19. Mem = Stop 2
    20. Resh = Tryptophan
    21. Lamed = Arginine
    22. Qoph = Glycine

    A way to test this would be to take a stretch of non-coding DNA and translate it into Hebrew using this alphabet. Then see if any Hebrew words emerge.
    we could make this task easier by doing a preliminary search for the most common words in the Hebrew language.

    Here are the 500 most frequent words in the Old Testament

    http://www.kreuzer-siegfried.de/hilf...r-500-engl.pdf

    So here is the experiment.

    1. Take a stretch of noncoding DNA from the Human Genome

    2. Translate it into Hebrew using Krakers alphabet

    3. Search this string for specific words that occur with highest frequency in the Hebrew Language


    This should be straight forward enough. If these Hebrew words emerge with the expected frequency then we are probably onto something.

    We could formulate this as a hypothesis, such that -

    "The frequency of appearance of common Hebrew words in DNA will be significantly higher than the frequency of appearance of uncommon Hebrew words, where word length is a constant."

    In the following posts we will be testing Krakers alphabet by obtaining a representative strtch of non-coding human DNA, translating it into Hebrew, then searching it for 100 very common Hebrew words, then for 100 uncommon Hebrew . (Common and uncommon words will be matched on word length) - and then comparing the frequency of occurrence of both. If the hypothesis is correct, then there will be a significant difference.
    Last edited by Craig.Paardekooper; 05-07-2012 at 03:56 PM.

  5. #165
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Step 1 : Getting a piece of human DNA

    Here is a DNA sequence that I am going to use for testing the hypothesis. The complete human genome can be found online here -

    ftp://ftp.ensembl.org/pub/release-67...o_sapiens/dna/

    I chose the shortest file to download, since some of these files are very big.

    These are zip files, so once you have downloaded one, you will need to unzip it.

    The files are .gz files, so you will need a software tool that can unzip these files. The free software tool is Power Archiver 2011, which you can download here -

    http://www.powerarchiver.com/download-powerarchiver/

    Once you have installed Power Archiver, then you will be able to extract the file.

    Once extraction is complete, you can view the extracted file by right-clicking on it and choosing "Open with notepad"

    Anyway, here is a sample of human DNA that I will start working with for now -

    >MT dna:chromosome chromosome:GRCh37:MT:1:16569:1
    GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT TTGGTATTTT
    CGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGC ACCCTATGTC
    GCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTAC GTTCAATATT
    ACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGA CATAATAATA
    ACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAA ATTTCCACCA
    AACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA AACCCCAAAA
    ACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGG CGGTATGCAC
    TTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCA TACTACTAAT
    CTCATCAATACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGC TAACCCCATA
    CCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTA CCTCCTCAAA
    GCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAAT AGGTTTGGTC
    CTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGT TCCAGTGAGT
    TCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGC AATGCAGCTC
    AAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCT TTAGCAATAA
    ACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGC CAGCCACCGC
    GGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTA GATCACCCCC
    TCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACA CAAAATAGAC
    TACGAAAGTGGCTTTAACATATCTGAACACACAATAGCTAAGACCCAAAC TGGGATTAGA
    TACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTG CTCGCCAGAA
    CACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATC CCTCTAGAGG
    AGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTC AGCCTATATA
    CCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTAC CCACGTAAAG
    ACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTT TCTACCCCAG
    AAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCA GTAAACTAAG
    AGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGT CACCCTCCTC
    AAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGA GGAGACAAGT
    CGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTA GCTTAACACA
    AAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGA GCTAAACCTA
    GCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTT ACCCAAATAA
    AGTATAGGCGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAA GGGAAAGATG
    AAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCT GCATAATGAA
    TTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAAC CAGACGAGCT
    ACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCAAAATAGTGGG AAGATTTATA
    GGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGAT AGAATCTTAG
    TTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTA ACTGTTAGTC
    CAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGT AAAAAATTTA
    ACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGC TCAACACCCA
    CTACCTAAAAAATCCCAAACATATAACTGAACTCCTCACACCCAATTGGA CCAATCTATC
    ACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAAACATTCTCCT CCGCATAAGC
    CTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCCCAATATCTACA ATCAACCAAC
    AAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGA AAGGTTAAAA
    AAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACAT CACCTCTAGC
    ATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCC GCGGTACCCT
    AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTAT GAATGGCTCC
    ACGAGGGTTCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCG TGAAGAGGCG
    GGCATAACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTAAT GCAAACAGTA
    CCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATTAAAAATTTCG GTTGGGGCGA
    CCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAG TCAAAGCGAA
    CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCT AGGGATAACA
    GCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGA TGTTGGATCA
    GGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATT AAAGTCCTAC
    GTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACNTTC AAATTCCTCC
    CTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCC CCGTAAATGA
    TATCATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTG TTAAGATGGC
    AGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAAT TCCTCTTCTT
    AACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAAT CGCAATGGCA
    TTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAA AGGCCCCAAC
    GTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACT CTTCACCAAA
    GAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCC GACCTTAGCT
    CTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCT GGTCAACCTC
    AACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTC AATCCTCTGA
    TCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGC AGTAGCCCAA
    ACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACT AATAAGTGGC
    TCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACT CCTGCCATCA
    TGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCG AACCCCCTTC
    GACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATA CGCCGCAGGC
    CCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAA CACCCTCACC
    ACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTA CACAACATAT
    TTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAAC AGCATACCCC
    CGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACC ACTCACCCTA
    GCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCC CCCTCAAACC
    TAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGA GCTTAAACCC
    CCTTATTTCTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAAT TCTCCGTGCC
    ACCTATCACACCCCATCCTAAAGTAAGGTCAGCTAAATAAGCTATCGGGC CCATACCCCG
    AAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCC GTCATCTACT
    CTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTT TTTACCTGAG
    TAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAA ATAAACCCTC
    GTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCC ATAATCCTTC
    TAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACC AATACTACCA
    ATCAATACTCATCATTAATAATCATAATAGCTATAGCAATAAAACTAGGA ATAGCCCCCT
    TTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGC CTGCTTCTTC
    TCACATGACAAAAACTAGCCCCCATCTCAATCATATACCAAATCTCTCCC TCACTAAACG
    TAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGA GGTGGATTAA
    ACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATA GGATGAATAA
    TAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATT TATATTATCC
    TAACTACTACCGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACC CTACTACTAT
    CTCGCACCTGAAACAAGCTAACATGACTAACACCCTTAATTCCATCCACC CTCCTCTCCC
    TAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATC GAAGAATTCA
    CAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTC CTTAACCTCT
    ACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATA TCTAACAACG
    TAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCC ACACTCATCG
    CCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTA TAGAAATTTA
    GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACT TAATTTCTGT
    AACAGCTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCA GCCACTTTAA
    TTAAGCTAAGCCCTTACTAGACCAATGGGACTTAAACCCACAAACACTTA GTTAACAGCT
    AAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAA AAGGCGGGAG
    AAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGA AAATCACCTC
    GGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAAT GCTTCACTCA
    GCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCT ACAAACCACA
    AAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTA GGCACAGCTC
    TAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGT AACGACCACA
    TCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATA GTAATACCCA
    TCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCC CCCGATATGG
    CGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTC CTACTCCTGC
    TCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTAC CCTCCCTTAG
    CAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCC TTACACCTAG
    CAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATC AATATAAAAC
    CCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTA ATCACAGCAG
    TCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTA CTAACAGACC
    GCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATT CTATACCAAC
    ACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCA GGCTTCGGAA
    TAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGA TACATAGGTA
    TGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCA CACCATATAT
    TTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACC ATAATCATCG
    CTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGA AGCAATATGA
    AATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACC GTAGGTGGCC
    TGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGAC ACGTACTACG
    TTGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATC ATAGGAGGCT
    TCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTAC GCCAAAATCC
    ATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACAC TTTCTCGGCC
    TATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACA TGAAACATCC
    TATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATT TTCATGATTT
    GAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCC ATAAACCTGG
    AGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTA TACATAAAAT
    CTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAA CCCCATGGCC
    TCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTC AAAGTTAAAT
    TATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTC TACAAGACGC
    TACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCA TAATCATTTT
    CCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAA AACTAACTAA
    TACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGC CCGCCATCAT
    CCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACG AGGTCAACGA
    TCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACG AGTACACCGA
    CTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAG AACCAGGCGA
    CCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCC CCATTCGTAT
    AATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAG GCTTAAAAAC
    AGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGAC CGGGGGTATA
    CTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCA TCGTCCTAGA
    ATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAGC ACCCCCTCTA
    CCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTT AAAGATTAAG
    AGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTAT GGCCCACCAT
    AATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATAT TAAACACAAA
    CTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACA AACCCTGAGA
    ACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCT AGGCCTACCC
    GCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAA ATATCTCATC
    AACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAA ACAAATGATA
    ACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTT AATCATTTTT
    ATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAAC CACCCAACTA
    TCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTAT AGGCTTTCGC
    TCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTAC ACCCCTTATC
    CCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGC CCTGGCCGTA
    CGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGG AAGCGCCACC
    CTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAAT TCTAATTCTA
    CTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCAC ACTTCTAGTA
    AGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTAT CATATAGTAA
    AACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACC TCCGGCCTAG
    CCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTA ACCAACACAC
    TAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAA GGCCACCACA
    CACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACC TCAGAAGTTT
    TTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCT ACCCCCCAAT
    TAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAA GTCCCACTCC
    TAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCAC CATAGTCTAA
    TAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTA CTGGGTCTCT
    ATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATT TCCGACGGCA
    TCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTC ATTATTGGCT
    CAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACA TCCAAACATC
    ACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTT TGACTATTTC
    TGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGT ACCGTTAACT
    TCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCC TTAATTTTAA
    TAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTA CCACAACTCA
    ACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATA TCCCCCGCCC
    GCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTA TTTGATCTAG
    AAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTG CCACTAATAG
    TTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTAT GAGTGACTAC
    AAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAAACGAAT GATTTCGACT
    CATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAAT ATTATACTAG
    CATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATA TCCTCCCTAC
    TATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATA ACCCTCAACA
    CCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCC GCCTGCGAAG
    CAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTA GACTACGTAC
    ATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATAT TACTACCACT
    GACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACA GCCTAATTAT
    TAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTA GCTGTTCCCC
    AACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCT GACTCCTACC
    CCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCAC GAAAAAAACT
    CTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCA CAGCCACAGA
    ACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGG CTATCATCAC
    CCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTAT TCTACACCCT
    AGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCC TAGGCTCACT
    AAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAG CCAACAACTT
    AATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACG GACTCCACTT
    ATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTAC TTGCCGCAGT
    ACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCA ACCCCCTGAC
    AAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTA TAACAAGCTC
    CATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAA TCAGCCACAT
    AGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCG GCGCAGTCAT
    TCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAA ACTCAAACTA
    CGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTC TACTCCCACT
    AATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCC CCACTATTAA
    CCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATA TCACTCTCCT
    ACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATAT TTACCACAAC
    ACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCA CACGAGAAAA
    CACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACC CCGACATCAT
    TACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTG AATCTGACAA
    CAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAA CTCATGCCCC
    CATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCA TTGGTCTTAG
    GCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACAC TACTATAACC
    ACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAA CCCTAACAAA
    AAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTAT TATCAGTCTC
    TTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAA CTGACACTGA
    GCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTT CTCCATAATA
    TTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACT GTGATATATA
    AACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCT AATTACCATA
    CTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGA GGGCGTAGGA
    ATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGAGCAGATGCCAA CACAGCAGCC
    ATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGC CTTAGCATGA
    TTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAA CGCTAATCCA
    AGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGC CCAATTAGGT
    CTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGC CCTACTCCAC
    TCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCC CCTAGCAGAA
    AATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCAC TCTGTTCGCA
    GCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTC CACTTCAAGT
    CAACTAGGACTCATAATAGTTACAATCGGCATCAACCAACCACACCTAGC ATTCCTGCAC
    ATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTC CATCATCCAC
    AACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAAC CATACCTCTC
    ACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTT CCTCACAGGT
    TTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAA CGCCTGAGCC
    CTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCTATAGCACTCG AATAATTCTT
    CTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGA AAATAACCCC
    ACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGG ATTTCTCATT
    ACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTA CCTAAAACTC
    ACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAA CTACCTAACC
    AACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACAT ACTCGGATTC
    TACCCTAGCATCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAG CCAAAACCTG
    CCCCTACTCCTCCTAGACCTAACCTGACTAGAAAAGCTATTACCTAAAAC AATTTCACAG
    CACCAAATCTCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAA ACTTTACTTC
    CTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACC TATTCCCCCG
    AGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAA CTACTACTAA
    TCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAA TCAACCCTGA
    CCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCA CAACCACCAC
    CCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACC CCACTAAAAC
    ACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAA TAGCCATCGC
    TGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAA CTATTAAACC
    CATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGC TAACAATCAA
    TACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACC CCATTACTAA
    ACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTA CAACCACGAC
    CAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGA CCCCAATACG
    CAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCC CCACCCCATC
    CAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGA TCCTCCAAAT
    CACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCG CCTTTTCATC
    AATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACC TTCACGCCAA
    TGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCC TATATTACGG
    ATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTG CAACTATAGC
    AACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAG GGGCCACAGT
    AATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTC AATGAATCTG
    AGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTC ACTTCATCTT
    GCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACG AAACGGGATC
    AAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACC CTTACTACAC
    AATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACAT TAACACTATT
    CTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCT TAAACACCCC
    TCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCC GATCCGTCCC
    TAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAG CAATAATCCC
    CATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCC AATCACTTTA
    TTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAAC CAGTAAGCTA
    CCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAA TCCTAATCCT
    AATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTC CTTGTAGTAT
    AAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGG ACAAATCAGA
    GAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTT AAACTATTCT
    CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCA CCCATCAACA
    ACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGG TACCATAAAT
    ACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTC CCCATGCTTA
    CAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTC CAAAGCCACC
    CCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAG TACATAAAGC
    CATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGG ATGACCCCCC
    TCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCA CAAGAGTGCT
    ACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTG TATCCGACAT
    CTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCT TAAATAAGAC
    ATCACGATG

  6. #166
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Step 2 : Translate Sample into Hebrew

    Step 2 is to translate the nucleotide sequence into Hebrew using Krakers alphabet

    1. Kaph = Phenylalanine
    2. Pe = Leucine
    3. Gimel = Isoleucine
    4. Shin = Methionine
    5. Beth = Valine
    6. Zain = Serine
    7. Daleth = Proline
    8. Teth = Threonine
    9. Tau = Alanine
    10. He = Tyrosine
    11. Aleph = Stop 1
    12. Nun = Histidine
    13. Tzaddi = Glutamine
    14. Cheth = Asparagine
    15. Ayin = Lysine
    16. Yod = Aspartic Acid
    17. Samekh = Glutamic Acid
    18. Vau = Cysteine
    19. Mem = Stop 2
    20. Resh = Tryptophan
    21. Lamed = Arginine
    22. Qoph = Glycine

    First I will convert the DNA sample into an aminoacid sequence
    Then I will convert the amino acid sequence into Hebrew Letters
    Then I will start searching for the most common Hebrew words.

    (PS. It is also possible to use the BLAST program to search the entire Human Genome for a particular sequence. The BLAST program can be found here -
    http://www.ensembl.org/Homo_sapiens/blastview)
    Last edited by Craig.Paardekooper; 05-10-2012 at 01:50 PM.

  7. #167
    Join Date
    Jun 2007
    Location
    Yakima, Wa
    Posts
    14,721
    Quote Originally Posted by Craig.Paardekooper View Post
    Step 2 is to translate the nucleotide sequence into Hebrew using Krakers alphabet

    1. Kaph = Phenylalanine
    2. Pe = Leucine
    3. Gimel = Isoleucine
    4. Shin = Methionine
    5. Beth = Valine
    6. Zain = Serine
    7. Daleth = Proline
    8. Teth = Threonine
    9. Tau = Alanine
    10. He = Tyrosine
    11. Aleph = Stop 1
    12. Nun = Histidine
    13. Tzaddi = Glutamine
    14. Cheth = Asparagine
    15. Ayin = Lysine
    16. Yod = Aspartic Acid
    17. Samekh = Glutamic Acid
    18. Vau = Cysteine
    19. Mem = Stop 2
    20. Resh = Tryptophan
    21. Lamed = Arginine
    22. Qoph = Glycine

    First I will convert the DNA sample into an aminoacid sequence
    Then I will convert the amino acid sequence into Hebrew Letters
    Then I will start searching for the most common Hebrew words.

    (PS. It is also possible to use the BLAST program to search the entire Human Genome for a particular sequence. The BLAST program can be found here -
    http://www.ensembl.org/Homo_sapiens/blastview)
    Fascinating project Craig. If I can find a little time I might jump in on it. But I've got a lot on my plate right now.
    • Skepticism is the antiseptic of the mind.
    • Remember why we debate. We have nothing to lose but the errors we hold. Who but a stubborn fool would hold to errors once they have been exposed?

    Check out my blog site

  8. #168
    Join Date
    Apr 2011
    Location
    Daytona
    Posts
    1,855

    DNA Genetics


    I loved the bottom line:

    Imagine my shock and surprise when I discovered that these two diverse approaches to divination, one Eastern and one Western, demonstrated an enormous similarity of content; symbolic, imagistic, and conceptual - WHEN GROUPED AND ARRANGED AS THE NUCLEIC ACIDS AND AMINO ACIDS ARE GROUPED AND ARRANGED IN THE GENETIC CODE.

    I couldn't shake the idea that these two symbol systems may be vehicles for the transport of two halves of what may be a textual virus - set to infect the body politic of Earth at a time when that knowledge is needed. Perhaps somewhere in the vast genetic library that is the human genome there is a clear message, in the Hebrew or a precursor language, from "The Creator(s)."

    If "The Creator(s)" have a sense of humor similar to ours, maybe they would get a kick out of the idea of letting us know, at a future time when we are technologically advanced enough, just who we are and how we came to be.
    Makes me wonder if He was RIBBING US all along!
    Dux allows: "It is the glory of God to conceal a thing: but the honour of kings is to search out the matter". Pr25:2

  9. #169
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Conversion of DNA sample into Aminoacid sequence

    I divided the sample up into codons. A typical essay contains 280 words per page. The nucleotides form 5707 codons or triplets, each presumably corresponding to a single Hebrew letter. If we take the average word length as 5 letters, then our sample would only amount to about 1100 words =about 4 x A4 sides of text (typical student essay)

    To convert this nucleotide string into the aminoacids, I have written a simple program that stores each codon in an array. Then it loops through the array and uses the Genetic Code to translate that codon into an amino acid.

    The result is

    Asp His Arg Ser Ile Thr Leu Leu Thr Thr His Gly Ser Ser Pro Cys Leu Val Phe Val Trp Gly Val Cys Thr Arg Stop1 His Cys Glu Thr Leu Glu Pro Glu Pro Tyr Val Ser Ile Cys Leu Stop2 Phe Leu Pro His Pro Ile Ile Tyr Arg Thr Tyr Ser Ile Thr Gly Glu His Thr Tyr Stop1 Ser Val Leu Ile Asn Stop1 Cys Leu Stop1 His Asn Asn Gln Leu Asn Val Cys Thr Ala Thr Phe His Thr Asp Ile Ile Thr Lys Phe Pro Pro Pro Pro Leu Pro Arg Phe Trp Pro Gln His Leu Asn Thr Ser Leu Pro Pro Gln Thr Lys Asn Pro Asn Thr Ser Leu Thr Arg Phe Gln Ile Leu Ser Phe Arg Tyr Ala Phe Asn Ser His Pro Pro Thr Asn Thr Leu Phe Ser Pro Pro Thr Pro Thr Thr Asn His Gln Tyr Asn Pro Arg Pro Ser Tyr Pro Ala His Thr His Arg Cys Thr Pro Pro Arg Thr Asn Gln Thr Pro Lys Thr Pro Pro Thr Val Tyr Val Ala Pro Pro Gln Gln Tyr Thr Glu Asn Val Stop1 Thr Gly Ser His His Pro Ile Asn Lys Gly Leu Val Ser Leu Ser Ile Ser Ser Stop1 Stop1 Asp Tyr Thr Cys Lys His Pro Arg Gln Stop2 Ser Pro Ser Lys Ser Pro Arg Ser Lys Gly Thr Ser Ile Lys His Ala Asn Ala Ala Lys Arg Leu Ala Stop1 Pro His Pro His Gly Lys Gln Gln Stop2 Leu Thr Stop1 Gln Stop1 Glu Ser Leu Thr Lys Leu Tyr Stop1 Pro Gln Gly Trp Ser Ile Ser Cys Ala Thr Gly His Thr Ile Asn Pro Ser Gln Stop1 Lys Pro Ala Stop1 Arg Val Phe Asp His Pro Pro Gln Stop1 Ser Stop1 Asn Ser Pro Glu Leu Stop1 Lys Thr Pro Val Asp Lys Ile Asp Arg Lys Trp Leu Stop1 His Ile Stop2 Thr His Asn Ser Stop1 Asp Pro Asn Gly Leu Tyr Pro Thr Met Leu Ser Pro Lys Pro Gln Gln Leu Asn Gln Gln Asn Leu Ala Arg Thr Thr Ser His Ser Leu Lys Leu Lys Gly Pro Gly Gly Ala Ser Tyr Leu Stop1 Arg Pro Val Leu Stop1 Ser Ile Asn Pro Asp Gln Pro His His Leu Leu Leu Pro Ile Pro Pro Ser Ser Ala Asn Pro Asp Glu Gly Tyr Lys Val Ser Ala Ser Pro Arg Lys Arg Stop1 Val Lys Val Stop1 Pro Met Arg Trp Gln Glu Met Gly Tyr Ile Leu Pro Gln Asn Tyr Asp Ser Pro Tyr Glu Thr Stop1 Gly Ser Lys Val Asp Leu Ala Lys Leu Ser Arg Val Leu Ser Stop2 Thr Gly Pro Stop2 Ser Ala Tyr Thr Pro Pro His Pro Pro Ser Ile Leu Gln Arg Thr Phe Asn Stop1 Asn Pro Tyr Ala Phe Ile Stop1 Glu Thr Ser Stop1 His Gly Lys Cys Thr Gly Lys Cys Thr Trp Thr Asn Gln Ser Val Leu Thr Lys His Pro Thr Tyr Thr Stop1 Glu Ile Ser Thr Stop1 Leu Asp Arg Ser Ala Lys Pro Pro Gln Thr His Ser Thr Leu Leu Pro Asp Asn Leu Ser Gln Thr Ile Pro Lys Stop1 Tyr Arg Arg Stop1 Lys Leu Lys Pro Gly Ala Ile Asp Ile Val Pro Gln Glu Arg Lys Asn Tyr Asn Gln Ala Stop1 Tyr Ser Lys Asp Stop1 Pro Leu Tyr Leu Ala Stop1 Stop2 Stop1 Leu Glu Ile Thr Leu Gln Gly Glu Pro Lys Leu Arg Pro Pro Lys Arg Arg Ala Leu Arg Thr Ala Lys Arg Ala His Pro Ser Met Stop1 Gln Asn Ser Gly Asp Leu Gly Arg Gly Asp Lys Pro Thr Glu Pro Gly Asp Ser Trp Leu Ser Lys Arg Ile Leu Ser Thr Leu Asn Leu Pro Thr Glu Pro Ser Lys Ser Pro Cys Lys Phe Leu Leu Val Lys Arg Asn Ser Ser Leu Asp Thr Arg Lys Lys Pro Cys Arg Glu Ser Lys Ile Thr Pro Ile Val Gly Leu Lys Ala Ala Thr Asn Stop1 Glu Ser Val Gln Ser Thr Pro Tyr Leu Lys Asn Pro Lys His Ile Thr Glu Leu Leu Thr Pro Asn Trp Gln Ser Ile Pro Ile Glu Glu Leu Met Leu Val Stop1 Val Thr Stop2 Lys His Ser Pro Ala Stop1 Leu Arg Gln Ile Lys Thr Leu Asn Stop2 Gln Leu Thr Ala Gln Tyr Leu Ile Asn Gln Ser His Tyr Tyr Pro His Cys Gln Pro Asn Thr Gly Met Leu Ile Arg Arg Leu Lys Ser Lys Arg Asn Ser Ala Asn Leu Thr Pro Pro Val Tyr Gln Lys His Pro Leu Ile Thr Ser Ile Arg Gly Thr Ala Cys Pro Val Thr His Val Stop1 Arg Ala Val Pro Thr Val Gln Arg Stop1 His Asn His Leu Phe Leu Lys Stop1 Gly Pro Val Asn Gly Ser Glu Gly Ser Ala Val Ser Tyr Phe Stop1 Pro Val Lys Leu Thr Cys Pro Lys Arg Gly Ile Thr Gln Gln Asp Glu Lys Thr Leu Trp Ser Phe Asn Leu Leu Ala Asn Ser Leu Thr Asn Pro Gln Val Leu Asn Tyr Gln Thr Cys Ile Lys Asn Phe Leu Gly Arg Ser Glu Gln Asn Pro Thr Ser Glu Gln Tyr Met Leu Arg Leu His Gln Lys Ala Leu Leu Tyr Ser Ile Asp Pro Ile Thr Stop2 Pro Thr Glu Gln Val Thr Arg Asp Asn Arg Asn Pro Ile Leu Glu Ser Ile Ser Thr Ile Gly Phe Thr Thr Ser Val Gly Ser Thr Ser Arg Trp Cys Ser Arg Tyr Stop1 Arg Phe Val Cys Ser Thr Ile Ser Pro Val Ile Stop2 Val Gln Thr Gly Val Ile Gln Val Gly Phe Tyr Leu Lys Phe Leu Cys Thr Lys Gly Gln Glu Lys Stop1 Gly Leu Leu His Lys Ala Pro Ser Arg Lys Stop2 Ser Ser Gln Leu Ser Ile Ile Pro Thr Pro Thr Gln Glu Gln Gly Leu Lys Met Arg Ala Arg Stop1 Ser His Lys Thr Stop1 Asn Phe Thr Val Arg Gly Ser Ser Ser Ser Thr Thr Tyr Pro Trp Pro Thr Ser Tyr Ser Ser Leu Tyr Pro Phe Stop1 Ala Met Ala Pro Asn Ala Tyr Arg Thr Lys Asn Ser Arg Leu Tyr Thr Thr Thr Gln Ala Pro Val Val Gly Pro Tyr Gly Leu Leu Gln Pro Phe Ala Asp Ala Ile Lys Leu His Gln Ser Pro Stop1 Asn Pro Pro His Leu Pro Ser Pro Ser Thr Ser Pro Pro Thr Leu Ala His His Arg Ser Ser Thr Met Asn Pro Pro Pro His Thr Gln Pro Pro Ser Thr Asn Leu Gly Leu Leu Phe Ile Leu Ala Thr Ser Ser Leu Ala Val Tyr Asn Pro Leu Gln Gly Glu His Gln Thr Gln Thr Thr Pro Stop2 Ser Ala His Cys Glu Val Ala Gln Asn Leu Ile Stop2 Ser His Pro Ser His His Ser Thr Ile Asn Ile Thr Stop1 Val Ser Phe Asn Leu Ser Thr Leu Ile Thr Thr Gln Glu His Leu Stop2 Leu Pro Ala Ile Asp Pro Trp Pro Stop1 Tyr Asp Leu Ser Pro His Stop1 Gln Arg Pro Thr Thr Pro Phe Pro Cys Arg Arg Gly Val Arg Thr Ser Leu Arg Leu Gln His Arg Ile Pro Gln Pro Phe Ala Leu Phe Phe Ile Ala Glu Tyr Thr Asn Ile Ile Ile Ile His Pro His Leu Gln Ser Ser Stop1 Glu Gln His Met Thr His Ser Pro Leu Asn Ser Thr Thr Tyr Cys His Gln Asp Pro Thr Ser Asn Leu Pro Val Leu Met Asn Ser Asn His Thr Arg Phe Arg Tyr Asp Gln Leu Ile His Leu Leu Stop2 Lys Asn Phe Leu Thr His Pro His Tyr Leu Tyr Asp Met Ser Pro Tyr Pro Leu Gln Ser Pro Ala Phe Pro Gln Thr Arg Asn Met Ser Asp Lys Arg Val Thr Leu Ile Glu Stop1 Ile Ile Gly Leu Asn Pro Tyr Phe Stop1 Asp Tyr Glu Asn Arg Thr His Pro Stop2 Glu Ser Lys Ser Pro Cys Pro Ile Thr Pro His Pro Lys Val Arg Ser Ala Lys Stop1 Ala Ile Gly His Thr Pro Asn Val Gly Tyr Thr Leu Pro Val Leu Ile Asn Pro Leu Ala Gln Pro His Leu Leu Pro Ser Leu Gln Ala His Ser Ser Gln Arg Stop1 Ala Arg Thr Asp Phe Thr Stop2 Arg Pro Arg Asn Lys His Ala Ser Phe Tyr Ser Ser Ser Asn Gln Lys Stop1 Thr Leu Ser Thr Glu Ala Ala Ile Lys Tyr Phe Leu Thr Gln Ala Thr Ala Ser Asn Pro Stop1 Stop1 Leu Ser Ser Ser Thr Ile Tyr Ser Pro Asp Asn Glu Pro Stop1 Asn Thr Thr Ser Ile Leu Ile Ile Asn Asn His Asn Ser Tyr Ser Asn Lys Thr Arg Stop1 Pro Pro His Phe Stop2 Val Pro Glu Val Thr Gln Gly Thr Pro Leu Thr Ser Gly Ala Ser Ser His Asp Lys Asn Stop1 Pro Pro Ser Gln Ser Tyr Thr Lys Ser Leu Ser Leu Asn Lys Pro Ser Pro His Ser Leu Asn Leu Ile His His Ser Arg Gln Leu Val Asp Stop1 Gln Thr Gln Leu Arg Lys Ile Leu Ala Tyr Ser Ser Ile Thr His Ile Met Asn Stop1 Gln Phe Tyr Arg Thr Thr Leu Thr Stop1 Pro Phe Leu Ile Stop1 Leu Tyr Ile Ile Asn Tyr Tyr Arg Ile Pro Thr Thr Gln Leu Lys Leu Gln His His Asp Tyr Tyr Tyr Arg Thr Stop2 Asn Lys Leu Thr Stop2 Leu Thr Pro Leu Ile Pro Ser Thr Pro Leu Stop1 Glu Ala Cys Pro Arg Stop1 Pro Ala Phe Cys Pro Asn Gly Pro Leu Glu Glu Phe Lys Lys Gln Stop1 Pro His His Pro His His His Ser His His His Pro Leu Thr Ser Phe Tyr Leu Arg Leu Ile Tyr Ser Thr Ser Ile Thr Leu Leu Pro Ile Stop1 Gln Stop1 Lys Stop1 Asn Asp Ser Leu Asn Ile Gln Asn Pro Pro His Ser Ser Thr Leu Ile Pro Tyr His Ala Thr Pro Thr Tyr Leu Pro Phe Tyr Thr Asn Asn Leu Arg Asn Leu Leu Asn Thr Asp Gln Glu Pro Ser Lys Pro Ser Val Ser Cys Asn Thr Ile Ser Asn Ser Stop1 Gly Leu Gln Asn Pro Thr Leu His Gln Leu Asn Ala Asn Ala Thr Leu Stop1 Ala Lys Pro Leu Leu Asp Gln Trp Asp Leu Asn Pro Gln Thr Leu Leu Thr Ala Ala Pro Stop1 Ser Thr Gly Phe Asn Leu Leu Leu Pro Pro Pro Gly Lys Gly Gly Lys Pro Arg Gln Val Stop2 Ser Cys Phe Phe Glu Phe Ala Ile Gln Tyr Lys Ser Pro Glu Leu Val Lys Arg Gly Leu Thr Pro Val Phe Arg Phe Thr Val Gln Leu His Ser His Phe Thr Ser Pro Pro Leu Met Phe Ala Asp Arg Stop2 Leu Phe Ser Lys Pro Lys Thr Leu Glu His Tyr Thr Tyr Tyr Ser Ala His Glu Leu Glu Ser Gly Thr Ala Lys Pro Pro Tyr Ser Ser Arg Ala Gly Pro Ala Arg Gln Pro Ser Arg Thr Thr Thr Tyr Asn Val Ile Val Thr Ala His Ala Phe Val Ile Ile Phe Phe Ile Asn Thr Ser Stop1 Ser Glu Ala Leu Ala Thr Asp Stop1 Phe Pro Stop1 Stop1 Ser Val Pro Asp Met Val Ser Pro His Lys Gln His Lys Leu Leu Thr Leu Thr Ser Leu Ser Tyr Ser Cys Ala Ser Ala Ile Val Glu Ala Gly Ala Gly Thr Gly Stop2 Thr Val Tyr Ser Leu Gln Gly Thr Thr Pro Thr Leu Glu Pro Pro Stop1 Thr Stop1 Pro Ser Ser Leu His Leu Arg Cys Leu Leu Tyr Leu Arg Gly His Gln Phe His His Asn Asn Tyr Ile Stop1 Asn Pro Ala Ile Thr Gln Tyr Gln Thr Pro Leu Phe Val Stop2 Ser Val Leu His Ser Ser Tyr Phe Ser Tyr Leu Ser Gln Ser Stop1 Leu Leu Ala Ser Leu Tyr Leu Thr Asp Gln Pro Gln His His Leu Leu Arg Pro Arg Arg Arg Arg Arg Pro His Tyr Thr Asn Leu Phe Stop2 Phe Phe Gly His Pro Glu Val Tyr Ile Leu Ile Leu Pro Leu Arg Stop1 Ser Pro Ile Leu Stop1 Leu Thr Thr Pro Glu Lys Lys Asn His Leu Tyr Ile Gly Gly Leu Ser Tyr Asp Ile Asn Trp Leu Pro Arg Val Tyr Arg Val Ser Thr Ile Tyr Thr Val Gly Ile Asp Val Asp Thr Arg Ala Tyr Phe Thr Ser Ala Thr Asn His Leu Ser Pro Pro Ala Ser Lys Tyr Leu Ala Asp Ser Pro His Ser Thr Ser Asn Met Met Ile Cys Cys Ser Ala Leu Ser Pro Arg Ile His Leu Ser Phe His Stop1 Val Ala Thr Gly Ile Val Leu Ala Asn Ser Ser Leu Asp Ile Val Leu His Asp Val Leu Leu Stop1 Pro Thr Ser Thr Met Ser Tyr Gln Stop1 Glu Leu Tyr Leu Pro Ile Gly Gly His Ser Leu Ile Ser Pro Ile Leu Arg Leu His Pro Arg Pro Asn Leu Pro Lys Ser Phe Thr Ile Ile Phe Ile Gly Val Asn Leu Thr Phe Phe Pro Gln His Ser Arg Tyr Pro Glu Cys Pro Asp Val Thr Arg Thr Thr Pro Met His Thr Pro Stop2 Asn Ile Ile Ile Cys Arg Leu Ile His Phe Ser Asn Ser Ser Asn Ile Asn Asn Ser Stop2 Phe Glu Ala Phe Ala Ser Lys Arg Lys Val Leu Ile Val Glu Glu Pro Ser Lys Pro Ser Asp Tyr Met Asp Ala Pro His Pro Thr Thr His Ser Lys Asn Pro Tyr Ile Lys Stop1 Thr Lys Lys Glu Gly Ile Glu Pro Pro Lys Ala Gly Phe Lys Pro Pro Met Ala His Asp Phe Phe Lys Lys Val Leu Glu Lys Pro Phe His Asn Phe Val Ser Stop1 Tyr Arg Leu Asn Pro Ile Tyr Leu Asn Gly Thr Cys Ser Ala Ser Arg Tyr Lys Thr Thr Ser Pro Ile Ile Glu Glu Leu Ile Thr Phe His Asp His Ala Leu Asn His Phe Leu Ser Ala Ser Stop1 Ser Cys Met Pro Phe Ser Stop1 His Ser Gln Gln Leu Thr Tyr Stop1 His Leu Arg Arg Ser Gly Asn Arg Asn Arg Leu Asn Tyr Pro Pro Pro Ser Leu Val Leu Ile Ala Leu Pro Ser Leu Arg Ile Leu Tyr Ile Thr Asp Gly Gln Arg Pro Pro Leu Pro Ser Asn Gln Leu Ala Thr Asn Gly Thr Glu Pro Thr Tyr Thr Leu Arg Arg Thr Asn Leu Gln Leu Leu His Thr Ser Pro Ile Ile Pro Asn Gln Ala Leu Arg Leu Leu Asp Val Asp Asn Arg Val Val Leu Pro Ile Glu Ala His Ser Tyr Stop1 Leu His His Lys Thr Ser Cys Thr His Glu Leu Ser Pro His Stop1 Leu Lys Arg Cys Asn Ser Arg Thr Ser Lys Pro Asn His Phe His Arg Tyr Thr Arg Gly Tyr Tyr Gly Gln Cys Ser Glu Ile Cys Gly Ala Asn His Ser Phe Met Pro Arg Pro Arg Stop1 Phe Pro Stop1 Lys Ser Leu Lys Stop1 Gly Pro Tyr Leu Pro Tyr Ser Pro Leu Pro Pro Leu Glu Pro Thr Val Lys Leu Thr Stop1 His Stop1 Pro Phe Lys Lys Asp Stop1 Glu Pro Thr Pro Leu Tyr Ser Glu Met Pro Gln Leu Asn Thr Thr Val Ala His His Leu Pro Pro Tyr Ser Leu His Tyr Ser Ser Ser Pro Asn Stop1 Lys Tyr Asn Thr Leu Pro Pro Thr Ser Leu Thr Lys Ala His Lys Asn Lys Lys Leu Stop1 Asn Pro Glu Pro Lys Stop2 Thr Lys Ile Cys Ser Leu His Ser Leu Pro Pro Gln Ser Gly Leu Pro Arg Ser Thr Asp His Ser Ile Ser Pro Ser Ile Asp Pro His Leu Gln Ile Ser Asn Asn Arg Leu Ile Thr Thr Gln Gln Stop2 Leu Ile Lys Leu Thr Ser Thr Asn Asp Pro Tyr Thr Thr Leu Lys Asp Glu Pro Asp Leu Leu Tyr Stop1 Tyr Pro Ile Ile Phe Cys His Asn Stop1 Pro Pro Arg Thr Pro Ala Ser Leu Ile Tyr Thr Asn Pro Asn Ser Ile Asn Leu Ala Met Ala Ile Pro Leu Stop2 Ala Gly Thr Val Ile Arg Leu Ser Leu Arg Leu Lys Met Pro Stop1 Pro Thr Ser Tyr His Lys Ala His Leu Pro Leu Ile His Thr Ser Tyr Tyr Arg Asn His Gln Pro Thr His Ser Thr Asn Ser Trp Pro Arg Leu Thr Ala Asn Ile Thr Ala Gly His Leu Leu Met His Leu Ile Lys Arg His Stop1 Gln Tyr Gln Pro Leu Thr Phe Pro Leu His Leu Ser Ser Ser Gln Leu Ile Leu Asp Tyr Pro Arg Asn Arg Cys Arg Leu Asn Pro Ser Leu Arg Phe His Phe Stop1 Ser Leu Tyr Leu His Asp Asn Thr Stop1 Stop2 Pro Thr Asn His Met Pro His Ile Val Thr Gln Pro Met Thr Pro Asn Arg Gly Pro Leu Ser Pro Pro Asn Asp Pro Ala Stop1 Met Stop2 Phe His Phe His Ser Ile Thr Leu Leu Ile Leu Gly Leu Leu Gln His Stop1 Pro Tyr Thr Asn Asp Gly Ala Met Stop1 His Glu Lys Ala His Thr Gly His His Thr Thr Cys Pro Lys Arg Pro Ser Ile Arg Asp Asn Pro Ile Tyr Tyr Gln Lys Phe Phe Phe Ala Gly Phe Phe Stop2 Ala Phe Tyr His Ser Ser Leu Ala Pro Pro Pro Stop1 Glu Gly Thr Gly Pro Gln Gln Ala Ser Pro Arg Stop1 Ile Pro Stop1 Val Pro Leu Lys His Ile Arg Ile Thr Arg Ile Arg Ser Ile Asn His Leu Ser Ser Ile Val Stop1 Glu Asn Asn Arg Asn Gln Ile Ile Gln Ala Leu Leu Ile Thr Ile Leu Gly Ser Ile Leu Pro Ser Tyr Lys Pro Gln Ser Thr Ser Ser Leu Pro Ser Pro Ser Asp Gly Leu Arg Leu Asn Ile Phe Cys Ser His Arg Leu Pro Arg Thr Ser Arg Leu Leu Ala Thr Phe Leu Thr Ile Cys Phe Ile Arg Gln Leu Ile Phe His Phe Thr Gln Thr Thr Leu Ala Ser Lys Pro Pro Pro Asp Thr Gly Ile Leu Stop1 Met Trp Stop2 Leu Phe Val Cys Leu His Leu Leu Met Arg Val Leu Leu Phe Stop1 Tyr Lys Stop1 Pro Leu Thr Gln Leu Thr Ser Phe Asp Asn Ile Gln Lys Arg Val Ile Asn Phe Ala Asn Phe Stop1 Ser Thr Pro Ser Stop1 Pro Tyr Tyr Stop1 Stop1 Leu Leu His Phe Asp Pro Gln Leu Arg Leu His Arg Lys Ile His Pro Leu Arg Val Arg Leu Arg Pro Tyr Pro Pro Pro Val Pro Phe Ser Ile Lys Phe Phe Leu Val Ala Ile Thr Phe Leu Leu Stop2 Ser Lys Leu Pro Ser Phe Tyr Pro Tyr His Glu Pro Tyr Lys Gln Leu Thr Pro Leu Ile Tyr Val Ile Pro Leu Ile Asn His His Pro Ser Pro Lys Ser Gly Leu Ser Asp Tyr Lys Gly Leu Asp Stop2 Thr Glu Leu Val Tyr Ser Leu Asn Lys Thr Asn Phe Arg His Stop1 Ile Met Ile Ile Ile Phe Thr Lys Cys Pro Ser Phe Thr Stop1 Ile Ile Leu Ile Tyr His Leu Thr Ser Arg Asn Thr Ser Ile Ser Leu Thr Pro His Pro Pro Tyr Cys Leu Glu Gly Ile Ile Leu Ser Leu Phe Ile Ile Ala Thr Leu Ile Pro Gln Pro Thr Pro Ser Stop1 Pro Ile Leu Cys Leu Leu Pro Tyr Stop1 Ser Leu Ala Cys Glu Ser Gly Gly Pro Ser Pro Thr Ser Leu Asn Leu Gln His Ile Trp Pro Thr Thr Tyr Asn Leu Asn Leu Leu Gln Cys Stop1 Asn Stop1 Ser Ser Gln Gln Leu Tyr Leu Pro Asp Met Thr Phe Gln Lys Thr His Asn Leu Asn Gln His Asn His Pro Ala Stop1 Leu Ser Ile Ile Pro Leu Leu Phe Phe Asn Gln Ile Asn Asn Asn Leu Phe Leu Phe Pro Pro Phe Pro Pro Thr Pro Stop1 Gln Pro Pro Ser Stop1 Tyr Stop1 Leu Pro Leu Leu Pro His Asn His Gly Lys Pro Thr Pro Leu Ile Gln Stop2 Thr Thr Ile Glu Lys Asn Tyr Leu Ser Ile Leu Ile Ser Leu Gln Ile Ser Leu Ile Ile Thr Phe Ser His Arg Stop1 Ser Tyr Phe Ile Ser Ser Ser Lys Pro His Leu Ser Pro Pro Trp Ile Ile Pro Met Arg Gln Pro Ala Arg Thr Pro Glu Arg Arg His Ile Leu Pro Ser Thr Pro Val Gly Ser Leu Pro Leu Leu Ile Ala Leu Ile Tyr Thr His Asn Thr Arg Leu Thr Thr Phe Tyr Tyr Ser Leu Ser Leu Pro Lys Asn Tyr Gln Thr Pro Glu Asn Asn Asn Met Thr Ser Leu His Asn Ser Phe Tyr Ser Lys Asp Thr Ser Leu Asp Ser Thr Stop2 Leu Pro Lys Ala His Val Glu Ala Pro Ile Ala Gly Ser Ile Val Cys Arg Ser Ser Stop1 Asn Stop1 Ala Ala Met Val Stop1 Tyr Ala Ser His Ser Phe Ser Pro Leu Lys Thr His Ser Leu Pro Leu Pro Cys Thr Ile Pro Met Arg His Asn Stop1 Gln Ala Ile Cys Leu Arg Gln Thr Asp Leu Lys Ser Leu Ile Ala Tyr Ser Ser Gln Pro His Pro Ser Stop1 Stop1 Gln Pro Phe Ser Ser Lys Pro Pro Glu Ala Ser Pro Ala Val Ser His Asn Arg Pro Arg Ala Tyr Ile Leu Ile Thr Ile Leu Pro Ser Thr Gln Thr Glu Arg Thr His Ser Arg Ile Ile Ile Leu Ser Gln Gly Leu Gln Thr Thr Pro Thr Stop1 Leu Phe Asp Asp Phe Stop1 Gln Ala Ser Leu Thr Ser Pro Tyr Pro Thr Ile Pro Thr Gly Arg Thr Leu Cys Ala Ser Asn His Val Leu Leu Ile Lys Ser Leu Ser Leu Thr Gly Leu Asn Ile Leu Val Thr Ala Leu Tyr Ser Leu Tyr Ile Tyr His Asn Asn Gly Ala His Ser Pro Thr Thr Leu Thr Thr Stop1 Asn Pro His Ser Arg Glu His Pro His Val His Thr Pro Ile Pro His Ser Pro Pro Ile Pro Gln Pro Thr Ser Thr Gly Phe Ser Ser Cys Lys Tyr Ser Leu Thr Lys Thr Ser Asp Cys Ile Stop2 Gln Glu Ala Tyr Asp Pro Leu Phe Thr Glu Lys Ala His Lys Asn Cys Stop1 His Ala His Val Stop1 Gln His Gly Phe Leu Asn Phe Stop1 Arg Ile Thr Ala Ile Leu Val Leu Pro Gln Lys Phe Trp Cys Asn Ser Lys Stop1 Lys Stop1 Stop1 Pro Cys Thr Thr Ile Thr Pro Asn Pro Asp Phe Pro Asn Ser Pro His Pro Tyr His Pro Arg Stop1 Leu Thr Lys Asn Ser Tyr Pro His Tyr Val Lys Ser Ile Val Ala Ser Thr Phe Tyr Gln Ser Ser Pro Gln Gln Tyr Ser Cys Ala Stop1 Thr Lys Lys Leu Leu Ser Arg Stop2 His Stop2 His Asn Pro Asn Asn Pro Ala Leu Pro Lys Leu Gln Thr Arg Leu Leu Pro Stop1 Phe Ile Pro Val Ala Leu Phe Val Thr Trp Ser Ile Ile Glu Phe Ser Val Ile Tyr Thr Gln Thr Gln Thr Leu Ile Ser Ser Ser Asn Ile Tyr Ser Ser Ser Ile Thr Ile Asn Leu Ser Tyr Arg Stop1 Gln Pro Ile Pro Thr Val His Arg Leu Arg Ala Stop1 Ile Ile Ser Phe Leu Leu Ile Ser Stop2 Stop2 Tyr Ala Arg Ala Asp Ala His Ser Ser Phe Lys Gln Ser Tyr Thr Thr Val Ser Ala Ile Ser Val Ser Ser Ser Leu Ala Stop2 Tyr Pro Thr Leu Gln Leu Met Arg Pro Thr Thr Asn Ser Pro Ser Lys Leu Ile Ser Leu Thr Pro Leu Leu Gly Leu Leu Leu Ala Ala Ala Gly Lys Ser Pro Ile Arg Ser Thr Pro Asp Ser Pro Gln Pro Stop1 Lys Ala Pro Pro Gln Ser Gln Leu Leu His Lys His Tyr Ser Cys Ser Arg Asn Leu Leu Thr His Pro Leu Pro Pro Stop1 Gln Asn Ser Pro Leu Ile Gln Thr Leu Thr Leu Cys Leu Gly Ala Ile Thr Ser Val Arg Gln Ser Ala Pro Leu His Lys Met Thr Ser Lys Lys Ser Stop1 Pro Ser Thr Ser Ser Thr Arg Thr His Asn Ser Tyr Asn Arg His Gln Pro Thr Thr Pro Ser Ser Cys Ile Cys Thr His Ala Phe Phe Lys Ala Ile Leu Phe Met Cys Ser Gly His His Pro Thr Leu Thr Met Asn Lys Ile Phe Glu Lys Stop1 Glu Asp Tyr Ser Lys Ile Pro Leu Phe Asn Leu Pro His His Trp Gln Pro Ser Ile Ser Arg Asn Thr Phe Ser Gln Phe Tyr Ser Lys Asp His Ile Ile Glu Thr Ala Asn Ile Ser Tyr Thr Arg Leu Ser Tyr Leu Leu Leu Ser Ser Leu Pro Pro Stop2 Gln Ala Pro Ile Ala Leu Ile Ile Leu His Pro Asn Arg Ser Thr Ser Leu Pro His Pro Tyr Stop1 His Stop1 Arg Ile Thr Thr Leu Leu Asn Pro Ile Lys Arg Leu Ala Ala Gly Ser Leu Phe Ala Ile Ser His Leu Thr Thr Phe Pro Pro His Pro Pro Ser Lys Gln Gln Ser Pro Ser Leu Lys Leu Ser Pro Arg Cys His Phe Pro Arg Thr Ser Asn Ser Pro Arg Pro Gln Thr Stop1 Asn Lys Leu Lys Ile Lys Ser Pro Leu Cys Thr Phe Tyr Phe Ser Asn Thr Arg Ile Thr Leu Ala Ser His Thr Ala Gln Ser Pro Ile Stop1 Ala Phe Leu Arg Gln Asn Leu Pro Thr Pro Pro Arg Pro Asn Leu Thr Arg Lys Ala Ile Thr Stop1 Asn Phe His His Gln Ile Ser Thr Ser Ile Ile Thr Ser Thr Gln Lys Gly Ile Ile Thr Leu Leu Ser Leu Ser Ser Ser His Ser Ser Stop1 Pro Tyr Ser Stop1 Ser His Asn Ile Pro Pro Gln Ser Gln Leu Gln Tyr Ile His Gln Gln Thr Met Phe Asn Gln Stop1 Thr Thr Ser Thr Pro Ile Ile Ile Gln Ser Pro Arg Thr Asn Arg Ile Leu Pro Ser Thr Leu Pro Ser Pro Ser Stop1 Ile Ile Gln Leu Pro Thr Leu Leu Lys Phe Thr Asn His His His His Thr Leu Ser Pro Thr Ala Pro Ile Leu Pro Pro Ser Leu Thr Thr Lys Thr His Gln Asp Leu Asn Pro Stop2 Pro Pro Cys Leu Arg Ile Leu Leu Stop1 Pro Ser Val Val Tyr Pro Lys Thr Thr Ile Ile Pro Pro Lys Stop1 Ile Lys Lys Tyr Stop1 Thr Tyr Asn Leu Pro Gln Asn Ser Glu Stop1 Stop1 His Thr Arg Pro His Arg Thr Ile Tyr Stop1 Thr Pro Ile Asn Arg Arg Arg Leu Arg Arg Lys Pro His Lys Pro Leu Leu Pro Thr Leu Asn Arg Asn Lys Ala Tyr Ile Ile Ile Leu Ala Arg Thr Asn His Asp Met Ile Stop2 Lys Thr Ile Val Val Phe Gln Leu Gln Glu His Gln Stop2 Pro Ile Gln Asn Stop1 Pro Pro Asn Lys Ile Asn Stop1 Pro Leu Ile His Arg Pro Pro Pro His Asn Ile Ser Ala Stop2 Stop2 Asn Phe Gly Ser Leu Leu Gly Ala Cys Leu Pro Pro Asn Pro Gln Asp Tyr Ser Stop1 Pro Cys Thr Thr His Gln Thr Pro Gln Pro Phe Ser Asn Arg Pro His His Ser Arg Arg Lys Leu Trp Leu Asn His Pro Leu Phe Thr Pro Gly Ala Ser Ile Phe Phe Ile Cys Leu Phe Leu His Ile Gly Arg Gly Ile Leu Arg His Phe Ser Thr Gln Lys Pro Glu Thr Ser Ala Leu Ser Ser Cys Leu Thr Ile Asn Ser Leu His Arg Leu Cys Pro Pro Val Arg Pro Asn Ile Ile Leu Gly Pro Gln Ile Thr Asn Leu Leu Ser Ala Ile Pro Tyr Ile Gly Thr Asp Leu Val Met Asn Leu Glu Ala Thr Gln Stop1 Thr Val Pro Pro Ser His Asp Ser Leu Pro Phe Phe Ile Ala Leu His Tyr Cys Ser Pro Ser Asn Thr Pro Pro Pro Ile Leu Ala Lys Arg Asp Asn Asn Pro Leu Gly Ile Thr Ser His Ser Asp Lys Ile Thr Phe His Leu Leu His Ser Lys Thr Pro Ser Ala Tyr Phe Ser Ser Phe Ser Pro Stop1 Stop2 His Thr Leu Leu Thr Arg Pro Pro Arg Arg Pro Arg Gln Leu Tyr Pro Ser Gln Pro Stop1 Thr Pro Pro His Ile Lys Pro Glu Stop2 Tyr Phe Leu Phe Ala Tyr Thr Ile Leu Ile Arg Pro Thr Asn Stop1 Glu Ala Ser Leu Pro Tyr Tyr Tyr Pro Ser Ser Ser Stop1 Ile Ile His Pro Pro Tyr Ile Gln Thr Thr Lys His Asn Ile Ser Pro Thr Lys Asn His Phe Stop2 Leu Leu Ala Ala Asp Leu Leu Ile Leu Thr Stop2 Ile Gly Gly Gln Ser Lys Leu Leu Leu Pro Ser Leu Asp Lys Stop1 His Pro Tyr Tyr Thr Ser Gln Gln Leu Ile Asn Thr Asn Tyr Leu Pro Asn Stop2 Lys Gln Asn Thr Gln Met Gly Leu Leu Val Val Asn Stop1 Tyr Thr Ser Leu Val Asn Arg Arg Stop2 Lys Pro Phe Ser Lys Gln Ile Arg Lys Ser Leu Stop1 Leu His His Stop1 His Pro Lys Leu Arg Phe Stop1 Phe Thr Ile Leu Phe Phe His Gly Glu Ala Asp Leu Gly Thr Thr Gln Val Leu Thr Pro Ile Asn Pro Leu Cys Ile Ser Tyr Ile Thr Ala Ser His His Glu Tyr Cys Thr Thr Ile Asn Leu Thr Thr Cys Ser Thr Stop1 Lys Pro Asn Pro His Gln Asn Pro Leu His Ala Gln Ala Ser Thr Ala Ile Asn Pro Gln Leu Ser His Ile Asn Cys Asn Gln Ser His Leu Thr His Stop1 Asp Thr Asn Lys Pro Thr His Pro Stop1 Gln Tyr Ile Thr Stop1 Ser Phe Thr Val His Ser Thr Leu Gln Ser Asn Pro Phe Ser Ser Pro Trp Asp Pro Ser Asp Arg Gly Pro Leu Thr Thr Ile Leu Arg Glu Ile Asn Ile Pro Gln Glu Cys Leu Ser Ser Leu Arg Ala His Asn Thr Trp Gly Stop1 Leu Lys Stop2 Thr Ile Arg His Gly Ser Tyr Phe Arg Val Ile Lys Pro Lys Stop1 Pro Thr Arg Ser Pro Asn Lys Ile Thr Met
    Last edited by Craig.Paardekooper; 05-11-2012 at 11:29 AM.

  10. #170
    Join Date
    May 2012
    Posts
    17

    Knave works His pet jokes.

    Quote Originally Posted by duxrow View Post

    I loved the bottom line:



    Makes me wonder if He was RIBBING US all along!


    Bob, it is right that you should wonder. It is fair to say that my approach to this idea is one of "seriously playing" as distinct from "playing seriously". I remember when I first spoke aloud about this idea.
    I was sitting with a bunch of my friends (an eclectic group of artists, engineers, seekers and believers) in our favorite restaurant and we were playing the game of "what's new with you?" When it was my turn I said, "I'm trying to translate DNA into Hebrew." Silence and quizzical looks, then laughter and friendly ribbing and jokes and then... ideas. Lively and productive conversation ensued all concerned with providing the best possible punch-line for the straight-line, "I'm trying to translate DNA into Hebrew."

    Regards,
    Krakers

Thread Information

Users Browsing this Thread

There are currently 2 users browsing this thread. (0 members and 2 guests)

Tags for this Thread

Bookmarks

Posting Permissions

  • You may not post new threads
  • You may post replies
  • You may not post attachments
  • You may edit your posts
  •