Google Ads

Google Ads

Bible Wheel Book

+ Reply to Thread
Page 28 of 66 FirstFirst ... 1824252627282930313238 ... LastLast
Results 271 to 280 of 654
  1. #271
    Join Date
    Jul 2008
    London UK

    Interesting Stats for Archaea Elusimicrobium Minutum

    Here is the output so far for the Archaea Elusimicrobium Minutum

    I analysed all repeats that are 15 letters long and that occur with a frequency between 6 and 56 times.

    Then I measured the length of each cycle (from the beginning of one repeat to the beginning of the next, and called this DIFF)

    Finally I examined each cycle length to see if it was a multiple of 13, 21, 31, 37, 66 or 73

    The results are quite interesting


    AACATGTCCTACAGG POSIT: 586528 DIFF : 84 = 21 x 4
    AACATGTCCTACAGG POSIT: 754574 DIFF : 84 = 21 x 4
    AACATGTCCTACAGG POSIT: 754658 DIFF : 84 = 21 x 4

    ACAAGCGTACAATAT POSIT: 515625 DIFF : -239033
    ACAAGCGTACAATAT POSIT: 588868 DIFF : 84 = 21 x 4
    ACAAGCGTACAATAT POSIT: 754599 DIFF : 84 = 21 x 4

    AGGGCAACCCTAACA POSIT: 266226 DIFF : -488373
    AGGGCAACCCTAACA POSIT: 266424 DIFF : 198 = 66 x 3
    AGGGCAACCCTAACA POSIT: 266556 DIFF : 132 = 66 x 2
    AGGGCAACCCTAACA POSIT: 266688 DIFF : 132 = 66 x 2
    AGGGCAACCCTAACA POSIT: 266754 DIFF : 66 = 66 x 1
    AGGGCAACCCTAACA POSIT: 266886 DIFF : 132 = 66 x 2

    CAAAAACGTCGTGTC POSIT: 515665 DIFF : 168 = 21 x 8
    CAAAAACGTCGTGTC POSIT: 588740 DIFF : 84 = 21 x 4

    CAACATGTCCTACAG POSIT: 515599 DIFF : -239040
    CAACATGTCCTACAG POSIT: 586527 DIFF : 84 = 21 x 4
    CAACATGTCCTACAG POSIT: 754573 DIFF : 84 = 21 x 4
    CAACATGTCCTACAG POSIT: 754657 DIFF : 84 = 21 x 4

    CCCGACAACATGTCC POSIT: 515594 DIFF : -239063
    CCCGACAACATGTCC POSIT: 515762 DIFF : 168 = 21 x 8
    CCCGACAACATGTCC POSIT: 586438 DIFF : 84 = 21 x 4
    CCCGACAACATGTCC POSIT: 754484 DIFF : 168046 = 73 x 2302
    CCCGACAACATGTCC POSIT: 754568 DIFF : 84 = 21 x 4

    CCGACAACATGTCCT POSIT: 515511 DIFF : -239057 = 13 x -18389
    CCGACAACATGTCCT POSIT: 515595 DIFF : 84 = 21 x 4
    CCGACAACATGTCCT POSIT: 586439 DIFF : 84 = 21 x 4
    CCGACAACATGTCCT POSIT: 754485 DIFF : 168046 = 73 x 2302
    CCGACAACATGTCCT POSIT: 754569 DIFF : 84 = 21 x 4

    CGACAACATGTCCTA POSIT: 515512 DIFF : -239057 = 13 x -18389
    CGACAACATGTCCTA POSIT: 515596 DIFF : 84 = 21 x 4
    CGACAACATGTCCTA POSIT: 586440 DIFF : 84 = 21 x 4
    CGACAACATGTCCTA POSIT: 754486 DIFF : 168046 = 73 x 2302
    CGACAACATGTCCTA POSIT: 754570 DIFF : 84 = 21 x 4

    CGGATATTAAAAAAG POSIT: 517436 DIFF : -237134
    CGGATATTAAAAAAG POSIT: 681215 DIFF : 1887 = 37 x 51

    CTGCGTAAGCCGGGG POSIT: 1258898 DIFF : 343136

    GAAAAAAGGATTTAC POSIT: 371981 DIFF : -886917
    GAAAAAAGGATTTAC POSIT: 1109475 DIFF : 391419 = 21 x 18639
    GAAAAAAGGATTTAC POSIT: 1210522 DIFF : 101047 = 37 x 2731
    GAAAAAAGGATTTAC POSIT: 1362664 DIFF : 152142

    GACAACATGTCCTAC POSIT: 515513 DIFF : -847151
    GACAACATGTCCTAC POSIT: 515597 DIFF : 84 = 21 x 4
    GACAACATGTCCTAC POSIT: 586441 DIFF : 84 = 21 x 4
    GACAACATGTCCTAC POSIT: 754487 DIFF : 168046 = 73 x 2302
    GACAACATGTCCTAC POSIT: 754571 DIFF : 84 = 21 x 4

    GATATTAAAAAAGTA POSIT: 150373 DIFF : -604198
    GATATTAAAAAAGTA POSIT: 681217 DIFF : 1887 = 37 x 51

    GCCCGACAACATGTC POSIT: 515593 DIFF : -330471 = 73 x -4527
    GCCCGACAACATGTC POSIT: 515761 DIFF : 168 = 21 x 8
    GCCCGACAACATGTC POSIT: 586437 DIFF : 84 = 21 x 4
    GCCCGACAACATGTC POSIT: 754483 DIFF : 168046 = 73 x 2302
    GCCCGACAACATGTC POSIT: 754567 DIFF : 84 = 21 x 4

    GGATATTAAAAAAGT POSIT: 517437 DIFF : -237130
    GGATATTAAAAAAGT POSIT: 681216 DIFF : 1887 = 37 x 51

    TATGCCTATAATTAA POSIT: 623262 DIFF : 239427 = 37 x 6471
    TATGCCTATAATTAA POSIT: 1259464 DIFF : 399099

    TCTTTTGTTTCAAAG POSIT: 276820 DIFF : -982644 = 13 x -75588
    TCTTTTGTTTCAAAG POSIT: 1271716 DIFF : 305298 = 21 x 14538

    TGCAATACAGTGAAG POSIT: 586644 DIFF : -685072
    TGCAATACAGTGAAG POSIT: 587034 DIFF : 390 = 13 x 30
    TGCAATACAGTGAAG POSIT: 587160 DIFF : 126 = 21 x 6
    TGCAATACAGTGAAG POSIT: 754774 DIFF : 165815 = 13 x 12755
    TGCAATACAGTGAAG POSIT: 755068 DIFF : 294 = 21 x 14

    TGCCCGACAACATGT POSIT: 515592 DIFF : -239476
    TGCCCGACAACATGT POSIT: 515760 DIFF : 168 = 21 x 8
    TGCCCGACAACATGT POSIT: 586436 DIFF : 84 = 21 x 4
    TGCCCGACAACATGT POSIT: 754482 DIFF : 168046 = 73 x 2302
    TGCCCGACAACATGT POSIT: 754566 DIFF : 84 = 21 x 4

    TTGTTTCAAAGCTTC POSIT: 1271720 DIFF : 305298 = 21 x 14538

    TTTGTTTCAAAGCTT POSIT: 868560 DIFF : -403160
    TTTGTTTCAAAGCTT POSIT: 1271719 DIFF : 305298 = 21 x 14538

    TTTTGTTTCAAAGCT POSIT: 868559 DIFF : -403160
    TTTTGTTTCAAAGCT POSIT: 1271718 DIFF : 305298 = 21 x 14538


    AAAAACGTCGTGTCC POSIT: 515498 DIFF : -756220
    AAAAACGTCGTGTCC POSIT: 515666 DIFF : 168 = 21 x 8
    AAAAACGTCGTGTCC POSIT: 588741 DIFF : 84 = 21 x 4
    AAAAACGTCGTGTCC POSIT: 1100016 DIFF : 345376

    AGTGAAGACGGAGCG POSIT: 586652 DIFF : -513364
    AGTGAAGACGGAGCG POSIT: 587042 DIFF : 390 = 13 x 30
    AGTGAAGACGGAGCG POSIT: 587168 DIFF : 126 = 21 x 6
    AGTGAAGACGGAGCG POSIT: 587294 DIFF : 126 = 21 x 6
    AGTGAAGACGGAGCG POSIT: 754782 DIFF : 252 = 21 x 12

    ATAAAAAAGCCCCGC POSIT: 1288630 DIFF : 377189

    GACGGAGCGTGCTGC POSIT: 515562 DIFF : -773068
    GACGGAGCGTGCTGC POSIT: 515730 DIFF : 168 = 21 x 8
    GACGGAGCGTGCTGC POSIT: 587048 DIFF : 84 = 21 x 4
    GACGGAGCGTGCTGC POSIT: 587174 DIFF : 126 = 21 x 6
    GACGGAGCGTGCTGC POSIT: 587300 DIFF : 126 = 21 x 6

    GCAATACAGTGAAGA POSIT: 586645 DIFF : -167891
    GCAATACAGTGAAGA POSIT: 587035 DIFF : 390 = 13 x 30
    GCAATACAGTGAAGA POSIT: 587161 DIFF : 126 = 21 x 6
    GCAATACAGTGAAGA POSIT: 587287 DIFF : 126 = 21 x 6
    GCAATACAGTGAAGA POSIT: 754775 DIFF : 165815 = 13 x 12755
    GCAATACAGTGAAGA POSIT: 755069 DIFF : 294 = 21 x 14

    GTGAAGACGGAGCGT POSIT: 586653 DIFF : -168416
    GTGAAGACGGAGCGT POSIT: 587043 DIFF : 390 = 13 x 30
    GTGAAGACGGAGCGT POSIT: 587169 DIFF : 126 = 21 x 6
    GTGAAGACGGAGCGT POSIT: 587295 DIFF : 126 = 21 x 6
    GTGAAGACGGAGCGT POSIT: 754783 DIFF : 252 = 21 x 12

    TTCTTTTGTTTCAAA POSIT: 276819 DIFF : -477964
    TTCTTTTGTTTCAAA POSIT: 1271715 DIFF : 267857

    TTTCTTTTGTTTCAA POSIT: 276818 DIFF : -994897
    TTTCTTTTGTTTCAA POSIT: 1271714 DIFF : 267857


    AAGACGGAGCGTGCT POSIT: 515560 DIFF : -756154
    AAGACGGAGCGTGCT POSIT: 515728 DIFF : 168 = 21 x 8
    AAGACGGAGCGTGCT POSIT: 587046 DIFF : 84 = 21 x 4
    AAGACGGAGCGTGCT POSIT: 587172 DIFF : 126 = 21 x 6
    AAGACGGAGCGTGCT POSIT: 587298 DIFF : 126 = 21 x 6

    ACAGTGAAGACGGAG POSIT: 586566 DIFF : -167968
    ACAGTGAAGACGGAG POSIT: 586650 DIFF : 84 = 21 x 4
    ACAGTGAAGACGGAG POSIT: 587040 DIFF : 390 = 13 x 30
    ACAGTGAAGACGGAG POSIT: 587166 DIFF : 126 = 21 x 6
    ACAGTGAAGACGGAG POSIT: 587292 DIFF : 126 = 21 x 6
    ACAGTGAAGACGGAG POSIT: 754780 DIFF : 84 = 21 x 4

    AGACGGAGCGTGCTG POSIT: 515561 DIFF : -239219
    AGACGGAGCGTGCTG POSIT: 515729 DIFF : 168 = 21 x 8
    AGACGGAGCGTGCTG POSIT: 587047 DIFF : 84 = 21 x 4
    AGACGGAGCGTGCTG POSIT: 587173 DIFF : 126 = 21 x 6
    AGACGGAGCGTGCTG POSIT: 587299 DIFF : 126 = 21 x 6

    AGAGGACAAGCGTAC POSIT: 515620 DIFF : -238915
    AGAGGACAAGCGTAC POSIT: 586548 DIFF : 84 = 21 x 4
    AGAGGACAAGCGTAC POSIT: 588863 DIFF : 84 = 21 x 4
    AGAGGACAAGCGTAC POSIT: 754594 DIFF : 84 = 21 x 4
    AGAGGACAAGCGTAC POSIT: 754678 DIFF : 84 = 21 x 4

    AGGACAAGCGTACAA POSIT: 515622 DIFF : -239056
    AGGACAAGCGTACAA POSIT: 586550 DIFF : 84 = 21 x 4
    AGGACAAGCGTACAA POSIT: 588865 DIFF : 84 = 21 x 4
    AGGACAAGCGTACAA POSIT: 754596 DIFF : 84 = 21 x 4
    AGGACAAGCGTACAA POSIT: 754680 DIFF : 84 = 21 x 4

    CAGTGAAGACGGAGC POSIT: 586567 DIFF : -168113 = 31 x -5423
    CAGTGAAGACGGAGC POSIT: 586651 DIFF : 84 = 21 x 4
    CAGTGAAGACGGAGC POSIT: 587041 DIFF : 390 = 13 x 30
    CAGTGAAGACGGAGC POSIT: 587167 DIFF : 126 = 21 x 6
    CAGTGAAGACGGAGC POSIT: 587293 DIFF : 126 = 21 x 6
    CAGTGAAGACGGAGC POSIT: 754781 DIFF : 84 = 21 x 4

    CGTGTCCCGCAACAT POSIT: 515674 DIFF : -239107
    CGTGTCCCGCAACAT POSIT: 589043 DIFF : 294 = 21 x 14
    CGTGTCCCGCAACAT POSIT: 589169 DIFF : 126 = 21 x 6
    CGTGTCCCGCAACAT POSIT: 754648 DIFF : 252 = 21 x 12

    GAAGACGGAGCGTGC POSIT: 515559 DIFF : -250729
    GAAGACGGAGCGTGC POSIT: 515727 DIFF : 168 = 21 x 8
    GAAGACGGAGCGTGC POSIT: 587045 DIFF : 84 = 21 x 4
    GAAGACGGAGCGTGC POSIT: 587171 DIFF : 126 = 21 x 6
    GAAGACGGAGCGTGC POSIT: 587297 DIFF : 126 = 21 x 6

    GACAAGCGTACAATA POSIT: 515624 DIFF : -238909 = 37 x -6457
    GACAAGCGTACAATA POSIT: 586552 DIFF : 84 = 21 x 4
    GACAAGCGTACAATA POSIT: 588867 DIFF : 84 = 21 x 4
    GACAAGCGTACAATA POSIT: 754598 DIFF : 84 = 21 x 4
    GACAAGCGTACAATA POSIT: 754682 DIFF : 84 = 21 x 4

    GAGGACAAGCGTACA POSIT: 515621 DIFF : -239061
    GAGGACAAGCGTACA POSIT: 586549 DIFF : 84 = 21 x 4
    GAGGACAAGCGTACA POSIT: 588864 DIFF : 84 = 21 x 4
    GAGGACAAGCGTACA POSIT: 754595 DIFF : 84 = 21 x 4
    GAGGACAAGCGTACA POSIT: 754679 DIFF : 84 = 21 x 4

    GGACAAGCGTACAAT POSIT: 515623 DIFF : -239056
    GGACAAGCGTACAAT POSIT: 586551 DIFF : 84 = 21 x 4
    GGACAAGCGTACAAT POSIT: 588866 DIFF : 84 = 21 x 4
    GGACAAGCGTACAAT POSIT: 754597 DIFF : 84 = 21 x 4
    GGACAAGCGTACAAT POSIT: 754681 DIFF : 84 = 21 x 4

    GTGTCCCGCAACATG POSIT: 515675 DIFF : -239006
    GTGTCCCGCAACATG POSIT: 589044 DIFF : 294 = 21 x 14
    GTGTCCCGCAACATG POSIT: 589170 DIFF : 126 = 21 x 6
    GTGTCCCGCAACATG POSIT: 754649 DIFF : 252 = 21 x 12

    TACAGTGAAGACGGA POSIT: 586565 DIFF : -179724
    TACAGTGAAGACGGA POSIT: 586649 DIFF : 84 = 21 x 4
    TACAGTGAAGACGGA POSIT: 587039 DIFF : 390 = 13 x 30
    TACAGTGAAGACGGA POSIT: 587165 DIFF : 126 = 21 x 6
    TACAGTGAAGACGGA POSIT: 587291 DIFF : 126 = 21 x 6
    TACAGTGAAGACGGA POSIT: 754779 DIFF : 84 = 21 x 4

    TGAAGACGGAGCGTG POSIT: 586654 DIFF : -168125
    TGAAGACGGAGCGTG POSIT: 587044 DIFF : 84 = 21 x 4
    TGAAGACGGAGCGTG POSIT: 587170 DIFF : 126 = 21 x 6
    TGAAGACGGAGCGTG POSIT: 587296 DIFF : 126 = 21 x 6
    TGAAGACGGAGCGTG POSIT: 754784 DIFF : 252 = 21 x 12


    AATACAGTGAAGACG POSIT: 586563 DIFF : -168221
    AATACAGTGAAGACG POSIT: 586647 DIFF : 84 = 21 x 4
    AATACAGTGAAGACG POSIT: 587037 DIFF : 390 = 13 x 30
    AATACAGTGAAGACG POSIT: 587163 DIFF : 126 = 21 x 6
    AATACAGTGAAGACG POSIT: 587289 DIFF : 126 = 21 x 6
    AATACAGTGAAGACG POSIT: 754777 DIFF : 84 = 21 x 4
    AATACAGTGAAGACG POSIT: 755071 DIFF : 294 = 21 x 14

    ATACAGTGAAGACGG POSIT: 586564 DIFF : -168507
    ATACAGTGAAGACGG POSIT: 586648 DIFF : 84 = 21 x 4
    ATACAGTGAAGACGG POSIT: 587038 DIFF : 390 = 13 x 30
    ATACAGTGAAGACGG POSIT: 587164 DIFF : 126 = 21 x 6
    ATACAGTGAAGACGG POSIT: 587290 DIFF : 126 = 21 x 6
    ATACAGTGAAGACGG POSIT: 754778 DIFF : 84 = 21 x 4
    ATACAGTGAAGACGG POSIT: 755072 DIFF : 294 = 21 x 14

    CAATACAGTGAAGAC POSIT: 586562 DIFF : -168510
    CAATACAGTGAAGAC POSIT: 586646 DIFF : 84 = 21 x 4
    CAATACAGTGAAGAC POSIT: 587036 DIFF : 390 = 13 x 30
    CAATACAGTGAAGAC POSIT: 587162 DIFF : 126 = 21 x 6
    CAATACAGTGAAGAC POSIT: 587288 DIFF : 126 = 21 x 6
    CAATACAGTGAAGAC POSIT: 754776 DIFF : 84 = 21 x 4
    CAATACAGTGAAGAC POSIT: 755070 DIFF : 294 = 21 x 14


    AAAATCAATTCTCGG POSIT: 266146 DIFF : -488924
    AAAATCAATTCTCGG POSIT: 266211 DIFF : 65 = 13 x 5
    AAAATCAATTCTCGG POSIT: 266277 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266343 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266409 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266475 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266541 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266607 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266673 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266739 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266805 DIFF : 66 = 66 x 1
    AAAATCAATTCTCGG POSIT: 266937 DIFF : 132 = 66 x 2
    AAAATCAATTCTCGG POSIT: 267003 DIFF : 66 = 66 x 1

    AAATCAATTCTCGGA POSIT: 266212 DIFF : 65 = 13 x 5
    AAATCAATTCTCGGA POSIT: 266278 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266344 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266410 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266476 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266542 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266608 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266674 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266740 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266806 DIFF : 66 = 66 x 1
    AAATCAATTCTCGGA POSIT: 266938 DIFF : 132 = 66 x 2
    AAATCAATTCTCGGA POSIT: 267004 DIFF : 66 = 66 x 1

    AATCAATTCTCGGAG POSIT: 266213 DIFF : 65 = 13 x 5
    AATCAATTCTCGGAG POSIT: 266279 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266345 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266411 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266477 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266543 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266609 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266675 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266741 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266807 DIFF : 66 = 66 x 1
    AATCAATTCTCGGAG POSIT: 266939 DIFF : 132 = 66 x 2
    AATCAATTCTCGGAG POSIT: 267005 DIFF : 66 = 66 x 1

    ATAAAATCAATTCTC POSIT: 266144 DIFF : -861 = 21 x -41
    ATAAAATCAATTCTC POSIT: 266209 DIFF : 65 = 13 x 5
    ATAAAATCAATTCTC POSIT: 266275 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266341 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266407 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266473 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266539 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266605 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266671 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266737 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266803 DIFF : 66 = 66 x 1
    ATAAAATCAATTCTC POSIT: 266935 DIFF : 132 = 66 x 2
    ATAAAATCAATTCTC POSIT: 267001 DIFF : 66 = 66 x 1

    ATCAATTCTCGGAGG POSIT: 266214 DIFF : 65 = 13 x 5
    ATCAATTCTCGGAGG POSIT: 266280 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266346 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266412 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266478 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266544 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266610 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266676 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266742 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266808 DIFF : 66 = 66 x 1
    ATCAATTCTCGGAGG POSIT: 266940 DIFF : 132 = 66 x 2
    ATCAATTCTCGGAGG POSIT: 267006 DIFF : 66 = 66 x 1

    ATTCTATAAAATCAA POSIT: 266204 DIFF : 65 = 13 x 5
    ATTCTATAAAATCAA POSIT: 266270 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266336 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266402 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266468 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266534 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266600 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266666 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266732 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266798 DIFF : 66 = 66 x 1
    ATTCTATAAAATCAA POSIT: 266930 DIFF : 132 = 66 x 2
    ATTCTATAAAATCAA POSIT: 266996 DIFF : 66 = 66 x 1

    CTATAAAATCAATTC POSIT: 266207 DIFF : 65 = 13 x 5
    CTATAAAATCAATTC POSIT: 266273 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266339 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266405 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266471 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266537 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266603 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266669 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266735 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266801 DIFF : 66 = 66 x 1
    CTATAAAATCAATTC POSIT: 266933 DIFF : 132 = 66 x 2
    CTATAAAATCAATTC POSIT: 266999 DIFF : 66 = 66 x 1

    TAAAATCAATTCTCG POSIT: 266210 DIFF : 65 = 13 x 5
    TAAAATCAATTCTCG POSIT: 266276 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266342 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266408 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266474 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266540 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266606 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266672 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266738 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266804 DIFF : 66 = 66 x 1
    TAAAATCAATTCTCG POSIT: 266936 DIFF : 132 = 66 x 2
    TAAAATCAATTCTCG POSIT: 267002 DIFF : 66 = 66 x 1

    TATAAAATCAATTCT POSIT: 266208 DIFF : 65 = 13 x 5
    TATAAAATCAATTCT POSIT: 266274 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266340 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266406 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266472 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266538 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266604 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266670 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266736 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266802 DIFF : 66 = 66 x 1
    TATAAAATCAATTCT POSIT: 266934 DIFF : 132 = 66 x 2
    TATAAAATCAATTCT POSIT: 267000 DIFF : 66 = 66 x 1

    TCTATAAAATCAATT POSIT: 266206 DIFF : 65 = 13 x 5
    TCTATAAAATCAATT POSIT: 266272 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266338 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266404 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266470 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266536 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266602 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266668 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266734 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266800 DIFF : 66 = 66 x 1
    TCTATAAAATCAATT POSIT: 266932 DIFF : 132 = 66 x 2
    TCTATAAAATCAATT POSIT: 266998 DIFF : 66 = 66 x 1

    TTCTATAAAATCAAT POSIT: 266140 DIFF : -858 = 66 x -13
    TTCTATAAAATCAAT POSIT: 266205 DIFF : 65 = 13 x 5
    TTCTATAAAATCAAT POSIT: 266271 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266337 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266403 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266469 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266535 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266601 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266667 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266733 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266799 DIFF : 66 = 66 x 1
    TTCTATAAAATCAAT POSIT: 266931 DIFF : 132 = 66 x 2
    TTCTATAAAATCAAT POSIT: 266997 DIFF : 66 = 66 x 1


    AATTCTCGGAGGGCA POSIT: 266152 DIFF : -845 = 13 x -65
    AATTCTCGGAGGGCA POSIT: 266217 DIFF : 65 = 13 x 5
    AATTCTCGGAGGGCA POSIT: 266283 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266349 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266415 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266481 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266547 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266613 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266679 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266745 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266811 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266877 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 266943 DIFF : 66 = 66 x 1
    AATTCTCGGAGGGCA POSIT: 267009 DIFF : 66 = 66 x 1

    ATTCTCGGAGGGCAA POSIT: 266218 DIFF : 65 = 13 x 5
    ATTCTCGGAGGGCAA POSIT: 266284 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266350 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266416 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266482 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266548 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266614 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266680 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266746 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266812 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266878 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 266944 DIFF : 66 = 66 x 1
    ATTCTCGGAGGGCAA POSIT: 267010 DIFF : 66 = 66 x 1

    CAATTCTCGGAGGGC POSIT: 266216 DIFF : 65 = 13 x 5
    CAATTCTCGGAGGGC POSIT: 266282 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266348 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266414 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266480 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266546 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266612 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266678 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266744 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266810 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266876 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 266942 DIFF : 66 = 66 x 1
    CAATTCTCGGAGGGC POSIT: 267008 DIFF : 66 = 66 x 1

    CGGAGGGCAACCCTA POSIT: 266223 DIFF : 65 = 13 x 5
    CGGAGGGCAACCCTA POSIT: 266289 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266355 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266421 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266487 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266553 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266619 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266685 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266751 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266817 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266883 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 266949 DIFF : 66 = 66 x 1
    CGGAGGGCAACCCTA POSIT: 267015 DIFF : 66 = 66 x 1

    CTCGGAGGGCAACCC POSIT: 266221 DIFF : 65 = 13 x 5
    CTCGGAGGGCAACCC POSIT: 266287 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266353 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266419 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266485 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266551 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266617 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266683 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266749 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266815 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266881 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 266947 DIFF : 66 = 66 x 1
    CTCGGAGGGCAACCC POSIT: 267013 DIFF : 66 = 66 x 1

    GAGGGCAACCCTAAC POSIT: 266225 DIFF : 65 = 13 x 5
    GAGGGCAACCCTAAC POSIT: 266291 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266357 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266423 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266489 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266555 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266621 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266687 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266753 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266819 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266885 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 266951 DIFF : 66 = 66 x 1
    GAGGGCAACCCTAAC POSIT: 267017 DIFF : 66 = 66 x 1

    GGAGGGCAACCCTAA POSIT: 266159 DIFF : -858 = 66 x -13
    GGAGGGCAACCCTAA POSIT: 266224 DIFF : 65 = 13 x 5
    GGAGGGCAACCCTAA POSIT: 266290 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266356 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266422 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266488 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266554 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266620 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266686 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266752 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266818 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266884 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 266950 DIFF : 66 = 66 x 1
    GGAGGGCAACCCTAA POSIT: 267016 DIFF : 66 = 66 x 1

    TCAATTCTCGGAGGG POSIT: 266215 DIFF : 65 = 13 x 5
    TCAATTCTCGGAGGG POSIT: 266281 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266347 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266413 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266479 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266545 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266611 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266677 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266743 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266809 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266875 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 266941 DIFF : 66 = 66 x 1
    TCAATTCTCGGAGGG POSIT: 267007 DIFF : 66 = 66 x 1

    TCGGAGGGCAACCCT POSIT: 266222 DIFF : 65 = 13 x 5
    TCGGAGGGCAACCCT POSIT: 266288 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266354 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266420 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266486 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266552 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266618 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266684 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266750 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266816 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266882 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 266948 DIFF : 66 = 66 x 1
    TCGGAGGGCAACCCT POSIT: 267014 DIFF : 66 = 66 x 1

    TCTCGGAGGGCAACC POSIT: 266220 DIFF : 65 = 13 x 5
    TCTCGGAGGGCAACC POSIT: 266286 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266352 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266418 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266484 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266550 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266616 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266682 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266748 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266814 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266880 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 266946 DIFF : 66 = 66 x 1
    TCTCGGAGGGCAACC POSIT: 267012 DIFF : 66 = 66 x 1

    TTCTCGGAGGGCAAC POSIT: 266154 DIFF : -858 = 66 x -13
    TTCTCGGAGGGCAAC POSIT: 266219 DIFF : 65 = 13 x 5
    TTCTCGGAGGGCAAC POSIT: 266285 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266351 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266417 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266483 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266549 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266615 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266681 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266747 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266813 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266879 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 266945 DIFF : 66 = 66 x 1
    TTCTCGGAGGGCAAC POSIT: 267011 DIFF : 66 = 66 x 1

  2. #272
    Join Date
    Jul 2008
    London UK

    Pattern in Cenarchaeum symbiosum A

    Here are the patterns in Cenarchaeum symbiosum A
    I looked at all strings of length 25 letters that repeat atleast 15 times


    AGATGGCCGAGAACATCAAGGGCAT POSIT: 692825 DIFF : 692825 = 37 x 18725

    ATCGTCATCGTCGTGCTCCCTGCCG POSIT: 1101950 DIFF : 394373 = 7 x 56339










































  3. #273
    Join Date
    Jul 2008
    London UK

    Perez's Paper

    Here are some quotes from Perez's paper

    Perez has found a fractal nature in DNA - see the diagrams shown below -

    Name:  DNAFractals.gif
Views: 172
Size:  62.0 KB

    You might compare this to Vernon's pattern found in Genesis 1 v 1 -

    Name:  Tri2701_703.gif
Views: 170
Size:  4.7 KB

    3.3. Fractals are Pervasive in Nature; both the Cerebellar Brain Cells and the DNA are Fractal Objects
    Mandelbrot [1983] coined the term “fractal” in his epoch-making book only about a quarter of a Century ago, but the impact of
    identifying fractal geometry intrinsic to Nature is already profound.

    3.3.1. The Zipf-School Suspected that the DNA contained a Fractal Language
    The first “hints” that the A, C, T and G nucleotide-sequences of DNA (especially of non-coding DNA) possibly
    harbored a (mathematical) “language” was published before the epoch of “massive whole genome sequencing”, in 1994 in Science, see
    Fig. 1 in Flam, [1994]. Its original captation: “Line of evidence. Plotting frequency against rank of arbitrary ‘words’ in noncoding yeast
    DNA yields the linear plot found in human language” reveals the key word “arbitrary”. Note that “words” of the non-coding DNA were 3-8
    bases, sampled in an unjustified manner. Neither graph appeared to conform to the straight “Line of evidence” of Zipf’s law.
    The study reported by Flam was based on a comparison with the empirical “Zipf’s law”, that applies to natural languages Zipf [1949].
    The distribution of frequencies (actual occurrences) of words in a large corpus of data versus their rank is generally a power-law
    distribution, with exponent close to one. Zipf's law is thus an experimental law, not a theoretical one. Zipf-like distributions are
    commonly observed, in many kinds of phenomena. However, the causes of Zipf-like distributions in real life are a matter of some
    controversy, with DNA being no exception.
    While the early observations applied to DNA in 1994 were found worthy of reporting in Science and were widely heralded that
    “something interesting was lurking in the junk [DNA]” the “Zipf-test” was inconclusive. Review by Simons and Pellionisz [2006a] pointed
    out that investigators failed to detect "well-defined scaling or fractal exponents"; Chatzidimitriou et al, [1996] or “any signs of hidden
    language in non-coding DNA"; Bonhoeffer et al, [1997].
    Empirical law aside, the biggest problem was the definition of "words" in the DNA. First, Harvard linguistics professor Zipf (1902-1950)
    established his “law”, based on observations on the English language, in which “words” are taken for granted. He found that in text
    samples the frequency of any word was roughly inversely proportional when plotted against the rank of how common each word was;
    the frequency of the k-th most common word in a text was roughly proportional to 1/k. Plotting both frequency and rank on a logarithmic
    scale, “Zipf’s law” was expected to yield a declining linear graph also for “words” of the DNA.
    When applying this natural language lingustics to DNA the results were not entirely convincing (Fig. 1 of Flam, 1994) . The problem was
    not only that the graphs did not quite conform to the linear Zipf’s law. It is unacceptable that the definition in the noncoding DNA was
    completely and explicitly arbitrary. Of course, there was no definition at that time of what A, C, T andG strings might constitute “words”.
    In the analysis conducted by Mantegna et al [1994]: “when the group arbitrarily divided up their samples of junk [DNA] into “words”
    between 3 and 8 bases long and applied the Zipf test, the telltale linear plot emerged”.
    Looking at the reproduced Fig. 1 of Flam (1994), the plot (for non-coding DNA “words” open squares on a log-log scale) starts fairly
    close to linear, but drops off remarkably at the tail end. The original Flam-diagram of the Zipf-law for DNA was even more controversial
    when it was applied to the “coding regions” of the DNA (see graph of open circles in Fig. 1 from Flam, 1994). Here, Flam claimed that
    Chapter in: Handbook: “The Cerebellum and Cerebellar Disorders”. Ed. Dr. Mario Manto, Springer Verlag. Submitted Oct. 20, Accepted Nov. 1, 2011.
    Pellionisz et al. Recursive Genome Function: Geometric Unification of Neuroscience and Genomics Page 10
    the Zipf-law “failed” – and the reason cited was that “The coding part [of the DNA] has no grammar – each triplet of bases corresponds
    to an amino acid in a protein. There’s no higher structure to it”.
    Today, both the “definition” of arbitrarily picked 3-8 letter strings for “words” and the “axiom” that there is no higher structure to coding
    DNA appear demonstrably dogmatic.
    Zipf's law is most easily observed by scatterplot the data, with the axes being log(rank order) and log(frequency). The simplest case of
    Zipf's law is a "1/f function". Given a set of Zipf-like distributed frequencies, sorted from most common to least common, the second
    most common frequency will occur 1/2 as often as the first. The nth most common frequency will occur 1/n as often as the first. However,
    this cannot hold precisely true, because items must occur an integer number of times: there cannot be 2.5 occurrences of a word.
    Nevertheless, over fairly wide ranges, and to a fairly good approximation, many natural phenomena obey Zipf's Law.
    3.3.2. The Genome is Fractal: Grosberg-School Suspected that the DNA Showed Fractal Folding

    The classic book of the mathematician who coined the word “fractal” (as a measure of dimension of roughness of results
    of recursive procedures), Mandelbrot [1983] generated a huge impetus into the direction of pulling away from looking at the genome as
    a language, and looking at fractals more as the “geometry of nature”. The twin schools of thought, towards approaching the structure of
    the genome – and the protein-structures whose development it governs, manifested in the seminal work by Grosberg et al [1988, 1993]
    to claim that the folding of DNA strands were fractal. Decades later, as an eminent example how established methods of biochemistry
    can be used to support paradigm-shifts, the Science cover article appeared [Erez-Lieberman et al. 2009], in effect the Science Adviser
    to the US President, Eric Lander appealing “Mr. President, the Genome is Fractal!” Inspired by the Hilbert-curve, a recursive folding
    that provides the much needed propensities. First, it is knot-free to permit uninterrupted transcription. Second, it is ultra-dense to enable
    squeezing the 2m-long DNA strand into the nucleus of a cell with 6 micron diameter. Remarkably, the Hilbert-curve is capable of filling
    the entire space available, in its 3D form its fractal dimension is 3.0. Third, it also provides the advantage that is paramount for The
    Principle of Recursive Genome Function, Pellionisz [2008a,b] that the DNA can be read not only serially, from one end to the thread to
    the other, but because all segments of the DNA are in maximal proximity to one-other, they can also be read in parallel.

    3.3.3. The Perez-school shows that the DNA is Fractal at DNA, Codon- and Full Chromosome Set
    and whole Genome Levels
    The Perez-school of study of recursive systems was interdisciplinary [Perez 2011b] and showed first results in 1988
    [Perez 1988a and 1991].The fractal nature of A, T, C and G coding or non-coding nucleotide sequences, chromosomes and genomes
    was evidenced over two decades, see review Perez [2011a]. Details, e.g. Perez [1991] and Marcer [1992] are comprised in two books;
    Perez [1997 and [2009a]. The results spanning from recursive studies through DNA and full genome analysis, including full set of
    chromosome levels, Perez [2008] are likely to be a serious candidate to the measure of “Abstract DNA Roughness” as proposed in
    Section 5.2. Fractals to DNA numerical decoding: towards the Golden ratio. “Small is beautiful”. Inspired by
    the recursive “Game of Life”; Gardner [1970] using the largest computers in the time a cellular automata a large random 0/1 cell
    populations was run in 1988 [Perez 1988a and 20089b. After 110 parallel network iterations, with a recursive single-line code, a “clown”
    pattern (see Panel 1 of Fig. 5) emerged from the small 7 cells “U” (see upper left corner of Panel 1 of Fig. 5 from Perez [1988a]). A
    strong illustration of « small is beautiful » is the discovery of a predictive formula of the Mendeleev’s Elements periodic table
    architecture, Perez [ 2009a and 2009c]. The “Fractal Chaos” artificial Neural Network. In the eighties, various parallel artificial neural
    networks were explored Perez [1988a 1988b], with a particular interest in discrete waves and by fractals. The fractal chaos is
    summarized by right-bottom Panel 5 of Fig. 5. In the dynamics of the fractal, a curious focal point seems to emerge: the “Golden ratio”.
    The fractal network also provides “déja vu” recall memory and holographic-like memory, Perez [1990a and 1990c]. At that time chaos in
    the DNA was also searched, but it is discrete; A, T, C and G bases could be coded by integers while chaos theory is based on real
    numbers. Note that the ratio between 2 Fibonacci integers is near to the Golden ratio. This raised the question of an integer-based
    chaos theory. Indeed, a hyper-sensitivity of the fractal for inputs based on recursive Fibonacci numbers was demonstrated; Perez
    [1990b]. “DNA SUPRACODE” overview. A connection between DNA coding regions sequences as gene
    sequences A, T, C and G patterned proportions and Golden ratio based Fibonacci/Lucas integer numbers was proposed; Perez [1991],
    Marcer |1992], see also Fig. 5. Panel 2. Correlation samples were established in genes or gene-rich small genomes with evolution or
    pathogenicity (example of HIV genome particularly; see the book Perez [1997]). “Resonances” were analyzed, where a resonance is a
    Fibonacci number of contiguous A, T, C and G nucleotides (i.e.144). If this sub-sequence contains exactly 55 bases T and 89 bases C,
    A, or G, this set was called a “resonance”. Thousands of resonances were discovered (see upper right corner of Panel 2 of Fig.5. from
    Perez [1991]) : in HIV -the whole genome is long of about 9000 bases-, there are resonances overlapping about 2/3 of the genome.
    Chapter in: Handbook: “The Cerebellum and Cerebellar Disorders”. Ed. Dr. Mario Manto, Springer Verlag. Submitted Oct. 20, Accepted Nov. 1, 2011.
    Pellionisz et al. Recursive Genome Function: Geometric Unification of Neuroscience and Genomics Page 11 In single-stranded DNA Human genome, codons population are fine tuned in Golden ratio
    proportions. A new Bioinformatics bridge between Genomics and Mathematics emerged; Perez [2010]. This “Universal “Fractal
    Genome Code Law” states that the frequency of each of the 64 codons across the entire human genome is controlled by the codon's
    position in the Universal Genetic Code table. The frequency of distribution of the 64 codons (codon usage) within single-stranded DNA
    sequences was analyzed. Concatenating 24 Human chromosomes, it was demonstrated that the entire human genome employs the
    well-known universal genetic code table as a macro structural model.
    Fig. 5. Examples from the Perez School of Recursive Results. Panel 1: “Clown” emerging from U (upper left corner), citing original recursions
    in 1988 by Perez. Reproduced from Perez [2009b]. Panel 2: DNA supracode and recursive Fibonacci series: 1 1 2 3 5 8 13 21 34 55 89... Example of
    resonances in HUMC1A1 gene. Reproduced from Perez [2011a]. Panel 3: Chromosome 1-8. The Evidence of Binary Proteomics Code (red) and Modulated Genomics
    Code (blue) at the Whole Human Genome Scale. Green: Genomic, Red: Proteomic. Reproduced from Perez [2011a]. Panel 3: Chromosome 9-Y. Reproduced from Perez
    [2011a]. Panel 5: Perez [2010] Fig. 5. Fractals to DNA numerical decoding: the Golden ratio. Evidence of Golden ratio hypersensitivity in a
    specific region of the “Fractal Chaos” recursive.
    The position of each codon within this table precisely dictates its population. So the Universal Genetic Code Table not only maps
    codons to amino acids, but serves as a global checksum matrix. Frequencies of the 64 codons in the whole human genome scale are a
    self-similar fractal expansion of the universal genetic code. The original genetic code kernel governs not only the micro scale but the
    macro scale as well. Particularly, the 6 folding steps of codon populations modeled by the binary divisions of the “Dragon fractal paper
    folding curve” show evidence of 2 attractors. The numerical relationship between the attractors is derived from the Golden ratio. It was
    demonstrated that:
    Chapter in: Handbook: “The Cerebellum and Cerebellar Disorders”. Ed. Dr. Mario Manto, Springer Verlag. Submitted Oct. 20, Accepted Nov. 1, 2011.
    Pellionisz et al. Recursive Genome Function: Geometric Unification of Neuroscience and Genomics Page 12
    (i) The whole Human Genome Structure uses the Universal Genetic Code Table as a tuning model. It predetermines global
    codons proportions and populations. The Universal Genetic Code Table governs both micro and macro behavior of the genome.
    (ii) The Chargaff's second rule from the domain of single A, T, C and G nucleotides was extended to the larger domain of
    codon triplets.
    (iii) Codon frequencies in the human genome were found to be clustered around 2 fractal-like attractors, strongly linked to the
    Golden ratio 1.618; Perez [2010]. A strange Meta-Architecture organizes our 24 Human Chromosomes. A curious interaction
    network was found among our 24 human chromosomes Perez [2011a], see Fig. 5, Panels 3-4 for human Chromosomes 1-8 and 9-Y,
    respectively. It was proven that the entire human genome codon population is fine-tuned around the "Golden ratio”; Perez [2010].
    Across the entire human genome, there appears to be an overall balance in the whole single-stranded DNA. This digital balance fits
    neatly around two attractors with predominant values of 1 and (3-Phi)/2, where Phi is the Golden ratio. Yet, the same analysis applied
    individually to each of the 24 chromosomes of humans and to each of the 25 chromosomes of the chimpanzee which reveals a 99.99%
    correlation between both genomes but diversity and heterogeneity particularly in the case of our chromosomes 16 17 19 20 and 22; see
    the book “Codex Biogenesis”, Perez [2009a]. Thus, a paradox emerges. The same analysis shows a global unity across the genome,
    whereas, applied to each of the constituent chromosomes of this same genome a great heterogeneity between these chromosomes is
    revealed. With the objective to analyze this paradox in greater depth, a meta-structure was discovered that overlaps all 24 human
    chromosomes. It is based on a set of strong numerical constraints based particularly on Pi, Phi and integer numbers such as 2, 3 etc. A
    functionality of this fine-tuned structure appears: the structure is 90% correlated with the density of genes per chromosome from the
    Human Genome project. It is 89% correlated with the chromosome's permeability to intrusion by retroviruses like HIV, 94% with CpG
    density and 62% with SNP inserts/deletes. Finally, a classification network of the 24 human chromosomes was discovered, including
    one measuring scale, ranging from 1/Phi (chromosome 4) to 1/Phi + 1/Pi (chromosome 19), which is both correlated with the increasing
    density of genes and permeability to the insertion of external viruses or vaccines. Unifying all Biological Components of Life: DNA, RNA, Proteins. A powerful basic Pi, Phi
    based numerical projection law of the C O N H S P bio-atoms average atomic weights was established; Perez [2009a], methods will be
    published in a forthcoming paper; [Perez [2012]. An integer-based code unifies the 3 worlds of genetic information: DNA, RNA and
    Protein-aggregating amino acids. Correlating, synchronizing and matching Genomics/Proteomics global patterned images in all
    coding/noncoding DNA sequences, all biologic data is unified from bio-atoms to genes, proteins and genomes. This code applies to the
    whole sequence of human genome, produces generalized discrete waveforms. In the case of the whole double-stranded human
    genome DNA, the mappings of these waves fully correlate with the well-known Karyotype alternate dark/grey/light bands. This
    “unification of all biological components” is illustrated in Panels 3-4 of Fig. 5; Perez [1988a]. A complete proof of self-similarity within the
    whole human genome is provided by Perez [2008]. In this “binary code” which emerges from whole human DNA, the ratio between both
    bistable states is exactly equal to “2” (the space between two successive octaves in music). As shown in Perez [2008] the Top State is
    exactly matching with a Golden ratio, the Bottom State is also related to the Golden ratio. If PHI = 1.618, it is the Golden ratio, and is
    phi = 0.618 = 1/PHI, then the “Top” level = phi = 1 / PHI and the “Bottom” level = phi/2 = 1 / 2 PHI. Top / Bottom = 2.

    References from Perez's Paper

    1. Amari S (1991) Dualistic Geometry of the Manifold of Higher-Order Neurons. Neural Networks 4(4):443-451
    2. Anderson JA (1990) 351-355 In: Anderson JA, Pellionisz A, Rosenfeld E. Neurocomputing II. Directions of Research. MIT Press,
    3. Anderson JA, Pellionisz A, Rosenfeld E (1990) Neurocomputing 2. Directions of Research. MIT Press
    4. Arneth BM (2010) Sequence variability and sequence evolution: An explanation of molecular polymorphisms and why many molecular structures can be preserved
    although they are not predominant. DNA Cell Biol. 29(10) Pp. 571-576. DOI: 10.1089/dna.2009.0942
    5. Bailey, Timothy L, Gribskov M (1998) Methods and statistics for combining match scores (MEME, MAST). J of Comput. Biol. 5211-221)
    6. Barnsley MF (2006) Superfractals. Cambridge Univ. Press
    7. Barski JJ, Lauth M, Meyer M (2002) Genetic targeting of cerebellar Purkinje cells: History, current status and novel strategies. The Cerebellum:1:111-118
    8. Bonhoeffer S, Herz AV, Boerlijst MC, Nee S, Nowak MA, May RM (1997) No signs of hidden language in noncoding DNA. Phys. Rev. Lett. 76(11)
    9. Battelle Technology Partnership (2011) Economic Impact of the Human Genome Project. How a $3.8 Bn investment drove $796 billion in economic impact,
    created 310,000 jobs and launched the genomic revolution
    10. Bertalanffy L von (1934) Untersuchungen über die Gesetzlichkeit des Wachstums. I. Allgemeine Grundlagen der Theorie; mathematische und physiologische
    Gesetzlichkeiten des Wachstums bei Wassertieren. Arch. Entwicklungsmech.131:613-652
    11. Berthelsen CL, Glazier JA, Skolnick MH (1992) Global fractal dimension of human DNA sequences treated as pseudorandom walks. Phys. Rev. 45(12)
    12. Bieberich E (1999) Structure in human consciousness: Fractal approach to the topology of the self perceiving an outer world in an inner space.
    13. Bieberich E (2011) Introduction to the Fractality Principle of Consciousness and the Sentyon Postulate. Cogn Comput. DOI 10.1007/s12559-011-9104-5
    14. Bloedel JR, Tillery SI, Pellionisz AJ (1988) Experimental-theoretical analysis of the intrinsic geometry of limb movements. Neurosci. Abst. 14:952
    15. Borovik AS, Grosberg AY, Frank-Kamenetskii MD (1994) Fractality of DNA texts. J of Biomol. Structure and Dynamics. 12(3):655-669
    16. Braitenberg V (1967) Is the cerebellar cortex a biological clock in the millisecond range? Progr Brain Res. 25:334-346
    17. Cartieri FJ (2009) Darwinism and Lamarckism before and after Weisman: A historical, philosophical, and methodological analysis. Univ. Pittsburg; 1-54.
    18. Castaldo I, Pinelli M, Monticelli A, Acquaviva F, Giacchetti M, Filla A, et al (2008) DNA methylation in intron 1 of the frataxin gene is related to GAA repeat length
    and age of onset in Friedreich ataxia patients. J Med Genet. 45(12):808-12.
    19. Chatzidimitriou-Dreismann CA, Steffer RM, Larhammar D (1996) Lack of biological significance in the "linguistic features” of noncoding DNA - a quantitative
    analysis. Nucleic Acids Res; 24(9):1676-81
    20. Church GM (2005) The personal genome project. EMBO and Nature Pub. Group, Mol Syst Biol. 1:30
    21. Chiappelli F, Shapshak P, Commins D, Singer E, Minagar E, Oluwadara O, et al. (2008) Molecular epigenetics, chromatin, and NeuroAIDS/HIV:
    Immunopathological implications. Bioinformation. 3(1): 47–52
    Chapter in: Handbook: “The Cerebellum and Cerebellar Disorders”. Ed. Dr. Mario Manto, Springer Verlag. Submitted Oct. 20, Accepted Nov. 1, 2011.
    Pellionisz et al. Recursive Genome Function: Geometric Unification of Neuroscience and Genomics Page 21
    22. Churchland PS (1986) Neurophilosophy: toward a unified science of the mind-brain. MIT Press
    23. Collins F (2007) New findings challenge established views on Human Genome, Nature, June 14, 2007;
    24. Crick F (1970, seminal notion 1956) Central Dogma of Molecular Biology. Nature 227(8):561-563 1956: see
    25. Dahmane N, Ruiz i Altaba A (1999) Sonic hedgehog regulates the growth and patterning of the cerebellum. Development 126, 3089-3100
    26. Descartes R (1629) Treatise of man. Prometheus Books (in English, 2003)
    27. Daunicht W, Pellionisz A (1987) Spatial arrangement of the vestibular and the oculomotor system in the rat. Brain Res. 435:48-56.
    28. Dokukin ME, Guz NV, Gaikwad RM, Woodworth CD, Sokolov I, (2011) Cell surface as fractal: Normal and cancerous cervical cells demonstrate different fractal
    behavior of surface adhesion maps at the nanoscale, Phys. Rev. Lett. 107:028101
    29. Dupré J, Barnes SB (2008) Genomes and what to make of them. Univ. of Chicago Press
    30. Dow RS, Moruzzi G (1958) The physiology and pathology of the cerebellum. Univ.Minnesota Press
    31. D’Angelo E, Mazzarello P, Prestori F, Mapelli J, Solinas S, Lombardo P, Cesana E, Gandolfi D, Congi L (2010) The cerebellar network: From structure to function
    and dynamics. Brain Res. Rev. 5-15 Published by Elsevier
    32. Elnitski L, Piontkivska H, Welch JR (2011) Advances in genomic sequence analysis and pattern discovery; Science, Engineering and Biology Informatics, Vol. 7
    World Scientific Publishing, Chapter 3. by Fedorov A, Fedorava L; 65-93
    33. Erez Lieberman-Aiden et al. (2009) The comprehensive mapping of long-range interactions reveals folding principles of the Human Genome. Science 326. DOI:
    34. Eccles J, Ito M, Szentágothai J (1967) The cerebellum as a neural machine. Springer Verlag
    35. Eckmiller R (1990) Advanced neural computers. North Holland
    36. Finger S (1994) Origins of neuroscience: a history of explorations into brain function, Oxford Univ. Press
    37. Fiori S (2008) Lie-group-type neural system learning by manifold retractions. Neural Networks. 21(10):1524-1529
    38. Fire A, Xu S, Montgomery M, Kostas S, Driver S, Mello C (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
    Nature 391 (6669): 806–11. doi:10.1038/35888. PMID 9486653
    39. Flam F (1994) Hints of a language in junk DNA. Science 266:1320
    40. Flourens MJP (1824) Recherces expérimentalses fur les propriétés et les sonctions du systéme nerveux dans les anomaux vertébres. Crevot, Paris
    41. Foucher I, Montesinos ML, Volovitch M, Prochiantz A, Trembleau A (2003) Joint regulation of the MAP1B promoter by HNF3β/Foxa2 and Engrailed is the result of
    a highly conserved mechanism for direct interaction of homeoproteins and Fox transcription factors. Development 130, 1867-187 doi:10.1242/dev.00414
    42. Francis J (2008) Philosophy of mathematics, Global Vision Publishing House
    43. Fraser CM, Gocayne JD, White O, Adams MD, Clayton RA, Fleischmann RD et al. (1955) The minimal gene complement of Mycoplasma genitalium.
    Science.;270(5235):397-403 NCBI ascension number NCBI L43927
    44. Gardner M (1970) Mathematical games. The fantastic combinations of John Conway’s new solitaire game “life”. Scientific American 223(Oct):120-123
    45. Gazalé MJ (1999) Gnomonl: from pharaohs to fractals. Princeton Univ. Press
    46. Gibbs RA, Jeffrey Rogers J, Katze MG, Bumgarner R, Weinstock GM, Mardis ER et al (2007) Evolutionary and biomedical insights from the rhesus macaque
    genome science 316(5822)222-234
    47. Gielen CCAM, van Zuylen EJ (1985) Coordination of arm muscles during flexion and supination: Application of the tensor analysis approach. Neuroscience, 17,
    48. Glasner ME, Yen CC, Ekland EH, Bartel DP (2000) Recognition of nucleoside triphosphates during RNA-Catalyzed primer extension. Biochemistry, 39:15556-
    49. Grosberg AY, Nechaev SK, Shakhnovich EI, (1988) The role of topological constraints in the kinetics of collapse of macromolecules, J. Phys. France 49,;2095-
    50. Grosberg A, Rabin Y, Havlin S, Neer A (1993) Crumpled globule model of the three-dimensional structure of DNA. Europhys. Lett. 23;373-378
    51. Hansen KD (2011) Increased methylation variation in epigenetic domains across cancer types. Nature Genetics pp. 1-8
    52. Haussler D (1995) A generalized hidden Markov model for DNA parsing. Extended abstract of talk for the Workshop on Gene-Finding and Gene Structure
    Prediction, Univ. of Pennsylvania
    53. Hood LR (2002) My life and adventures integrating biology and technology. Commemorative lecture given when awarded the 2002 Kyoto Prize in Advanced
    54. Hopfield JJ (1982) Neural networks and physical systems with emergent collective computational properties. Proc. Nat. Acad. Sci. (USA) 79:2554-2558
    55. Izzo JA, Kim N, Elmetwaly S, Schlick T (2011) RAG: An update to the RNA-As-Graphs resource. BMC Bioinformatics 2011, 12:219
    56. Jacob F, Monod JJ (1961) Genetic regulatory mechanisms in the synthesis of proteins. Mol. Biol. 3:318-56
    57. Jansen J, Brodal A (1954) Aspects of cerebellar anatomy. The Wistar Institute of Anatomy and Biology
    58. Jensen KL , Styczynsk MPi, Rigoutsos I, Stephanopoulos GN (2006) A generic motif discovery algorithm for sequential data (GEMODA) Bioinformatics 22(1):21-
    59. Jetten AM (2009) Retinoid-related orphan receptors (RORs): critical roles in development, immunity, circadian rhythm, and cellular metabolism. Nuclear Receptor
    7; 1-32, DOI: 10.1621/nrs.07003;
    60. Kornberg A, Baker TA (1992) DNA replication. Univ. Science Book
    61. Kuhn TS, (1962) The structure of scientific revolutions, 1st. ed., Chicago: Univ. of Chicago Press
    62. Kyle LJ, Styczynski MP, Rigoutsos I, Stephanopoulos GN (2006) A generic motif discovery algorithm for sequential data. Bioinformatics, 22 (1);21–28
    63. Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J (et al.) (2001) Initial sequencing and analysis of the human genome. Nature 409:860-921
    64. Laczkó J, Pellionisz AJ Peterson BW. and Buchanan TS (1987) Multidimensional sensorimotor "patterns" arising from a graphics-based tensorial model of the
    neck-motor system. Soc. Neurosci. Absts. 13., V.1. p. 372.
    65. Laczkó J, Pellionisz A, Jongen, H and Gielen CCCM (1988) Computer modeling of human forelimb muscle activation in multidimensional intrinsic coordinate
    frames. Soc. Neurosci. Absts. pp. 14-2:955
    66. Lestienne F, Liverneaux P, Pellionisz A (1988) Morpho-anatomy of sub-occipital muscles in monkey: a tensor model of the musculo-skeletal head-neck system.
    Reunion Commune de la Physiological Society et de l'Association des Physiologistes, France 2 July 1988. Proc. Physiol. Soc. J. Physiol. (Lond) 2P
    67. Llinás R, Roy S (2009) The ‘prediction imperative’ as the basis for self-awareness Phil. Trans. R. Soc. B (2009) 364, 1301–1307 doi:10.1098/rstb.2008.0309
    68. Lorente De No, R. (1933) Vestibulo-ocular reflex arc. Arch. Neurol. Psychiat. (Chicago), 30:245-291.
    69. Mandelbrot B (1967) How long is the coast of Britain? Statistical self-similarity and fractional dimension. Science 5(156):3775 pp. 636-
    638 DOI: 10.1126/science.156.3775.636
    70. Mandelbrot BB (1983) The fractal geometry of nature, Freeman, New York, ed. 2, 1983
    71. Manfred R, Roy S (2001), (Quantum) space-time as a statistical geometry of fuzzy lumps and the connection with random metric spaces, Classical and
    Quantum.Grav. 18, p. 3039.
    72. Mantegna RNSV, Buldyrev AL, Goldberger S, Havlin C, Peng K, Simons M, Stanley HE, (1994) Linguistic features of noncoding DNA sequences, Phys Rev Lett
    73, pp. 3169–3172
    Chapter in: Handbook: “The Cerebellum and Cerebellar Disorders”. Ed. Dr. Mario Manto, Springer Verlag. Submitted Oct. 20, Accepted Nov. 1, 2011.
    Pellionisz et al. Recursive Genome Function: Geometric Unification of Neuroscience and Genomics Page 22
    73. Manto M (2008) The cerebellum, cerebellar disorders, and cerebellar research-two centuries of discoveries, Cerebellum. 7(4):505-16
    74. Manto M, Marmolino D. (2009) Cerebellar ataxias. Curr. Opin. Neurol. 22(4):419-29
    75. Marmolino D, Acquaviva F (2009) Friedreich's Ataxia: from the (GAA)n repeat mediated silencing to new promising molecules for therapy. The
    Cerebellum. 8(3):245-59
    76. Marcer P.J. (1992) Order and chaos in DNA – the Denis Guichard Prizewinner: Jean-Claude Perez, in KIBERNETES 1992, vol 21, n°2, pp.60-61, ISSN 0368-
    77. Mardis ER (2006) Anticipating the $1000 genome. Genome Biol. 7(7):112. .doi: 10.1186/gb-2006-7-7-112
    78. Marr D (1969) A theory of cerebellar cortex. J. Physiol., 202:437-470
    79. Marr D (1982) Vision: A computational Investigation into the human representation and processing of visual information. New York: Freeman
    80. Mattick JS [2001] Non-coding RNAs: the architects of eukaryotic complexity. EMBO reports 2(11):986–991
    81. Mattick JS (2004) The hidden genetic code of complex organisms. Scientific American, 291(4) pp. 60-67
    82. Mattick JS (2005) The functional genomics of noncoding RNA. Science 309(5740) pp. 1527-1528
    83. Mendel JG (1866). Versuche über PflanzenhybridenVerhandlungen des naturforschenden Vereines in Brünn, Bd. IV für das Jahr, 1865 Abhandlungen:3–47. For
    the English translation, see: Druery CT and William Bateson (1901). "Experiments in plant hybridization". J of the Royal Horticultural Society 26: 1–32. Retrieved
    84. McCulloch WS, Pitts WH (1943) A logical calculus of the ideas immanent in nervous activity. Bull Math Biophys 5:115-133
    85. Meyerson M, Gabriel S, Getz G (2011). Advances in understanding cancer genomes through second-generation sequencing Nature Rev Gen 11, 685–696
    | doi:10.1038/nrg2841
    86. Minsky M, Papert S (1969) Perceptrons: An Introduction to computational geometry, The MIT Press, Cambridge MA, ISBN: 0 262 63022 2
    87. Moruzzi G (1950) Problems in cerebellar physiology, Springfield, Ill. : C. C. Thomas, cop.
    88. Neumann J (1958) The computer and the brain (Mrs. Hepsa Ely Silliman Memorial Lectures). Second Edition 2000, with Introduction by Patricia Churchland and
    Paul Churchland, Yale Univ. Press.
    89. Oberdick J, Schilling K, Smeyne RJ, Corbin JG, Bocchiaro C, Morgan JI (1993) Control of segment-like patterns of gene expression in the mouse cerebellum.
    Neuron 10(6):1007-1018 doi:10.1016/0896-6273(93)90050-2
    90. Ohno S (1972) So much ‘Junk DNA’’ in our genome. Brookhaven Symposia in Biology, (23):366-370
    91. Oller JW (2010) The antithesis of entropy: Biosemiotic communication from genetics to human language with special emphasis on the Iimmune systems. Entropy
    12:631-705; doi:10.3390/e12040631
    92. Ozery-Flato M, Linhart C, Trakhtenbrot L, Izraeli S, Shamir R (2011) Large-scale analysis of chromosomal aberrations in cancer karyotypes reveals two distinct
    paths to aneuploidy Genome Biology 12:R61 doi:10.1186/gb-2011-12-6-r61
    93. Pandolfo M (2008) Friedreich ataxia. Arch Neurol 65(10)
    94. Pellionisz A, Szentágothai J (1973) Dynamic single unit simulation of a realistic cerebellar network model, 1973, Brain Res. , 49:83-99 Elsevier
    95. Pellionisz AJ, Llinás R (1980) Tensorial approach to the geometry of brain function. Cerebellar coordination via a metric tensor. Neuroscience, 5:1761-1770.
    96. Pellionisz AJ (1984) Coordination: A vector-matrix description of transformations of overcomplete CNS coordinates and a tensorial solution using the Moore-
    Penrose generalized inverse. J of Theoretical Biology, 110, 353-375.
    97. Pellionisz A (1985) Tensorial aspects of the multidimensional approach to the vestibulo-oculomotor reflex and gaze. In: Reviews of Oculomotor Research. I.
    Adaptive Mechanisms in Gaze Control. (ed. by Berthoz A and Melvill-Jones G). Elsevier, Amsterdam, 281-296
    98. Pellionisz AJ (1985) Tensor network theory of the central nervous system and sensorimotor modeling. In Brain theory, Palm G, Aertsen A (Eds.) Berlin,
    Heidelberg, New York: Springer-Verlag 121-145.
    99. Pellionisz AJ, Llinás R (1985) Tensor network theory of the metaorganization of functional geometries in the CNS. Neuroscience, 16, 245-273
    100. Pellionisz A (1986) David Marr's theory of the cerebellar cortex: A model in brain theory for the "Galilean Combination of Simplification, Unification and
    Mathematization". In: Brain Theory (eds. Palm G., & Aertsen, A.), Springer Verlag, Berlin-Heidelberg-New York, 253-257
    101. Pellionisz A (1987) Tensor network theory of the Central Nervous System. Encyclopaedia of Neuroscience (ed. G. Adelman), Birkhauser, p. 1196-1198
    102. Pellionisz A, Graf W (1987) Tensor Network Model of the "Three-Neuron Vestibulo-Ocular Reflex-Arc" in Cat. J. Theoretical Neurobiology, (5)127-151.
    103. Pellionisz AJ (1989) Neural geometry: Towards a fractal model of neurons. In: Models of brain function, ed. By Cotterill, RMJ, Cambridge Univ. Press; 453-464
    104. Pellionisz AJ, LeGoff B, Laczko J, Berthoz A (1991) Multidimensional geometry intrinsic to head movements around distributed centers of rotation: A
    Neurocomputer Paradigm. In:The head-neck sensory-motor system/ Oxford Univ. Press. Eds. A. Berthoz, W.Graf and P. Vidal 117-125
    105. Pellionisz AJ, Jorgensen CC, Werbos PJ (1992) Cerebellar neurocontroller project for aerospace applications. IJCNN International Joint Conf. on Neural Networks
    IEEE Catalog Number: 92CH3114-6 ISBN: Softbound Edition 0-7803-0559-0
    106. Pellionisz A (2002) FractoGene: Utility to use self-similar repetitions in the language-like genetic information as fractal sets. US Patent Application (Aug. 1st, 2002).
    In: Simons MJ, Pellionisz AJ (2006a), see also SF-gate, Nov.22;
    107. Pellionisz A (2003) FractoGene: Design-tool for protein-based self-assembling nanostructures, materials and application. Invited Keynote Lecture at Nano-Bio
    Technology Session. Proc. Of the 204th Meeting of The Electrochemical Society, p. 1195
    108. Pellionisz A (2006) PostGenetics: The journey of discovering “junk DNA”; Genetics beyond genes. Invited Keynote Lecture of European Inaugural Satellite
    Symposium of International PostGenetics Society, Proceedings of International Congress of Immunogenomics and Immunomics
    109. Pellionisz A (2008a) The principle of recursive genome function. The Cerebellum, 7(3) 348-359, DOI 10.1007/s12311-008-0035-y
    110. Pellionisz A (2008b) Is IT ready for the dreaded DNA data deluge?
    111. Pellionisz A (2009a) From the principle of recursive genome function to interpretation of HoloGenome Regulation by Personal Genome Computers. Cold Spring
    Harbor Laboratory; Personal Genomes, Sept. 14-17
    112. Pellionisz A (2009b) Personal genome computing: Breakthroughs, risks and opportunities, Churchill Club Panel
    113. Pellionisz A (2010) Shop for your life - HolGenTech at PMWC2010
    114. Perez JC (1988a) De nouvelles voies vers l'Intelligence Artificielle: pluri-disciplinarité, auto-organisation et réseaux neuronaux, Masson Paris, ISBN 2-225-81815-
    115. Perez JC et al. (1988b) Fractal chaos: a new neural network holographic model - INNS conference Boston, USA. Neural Networks
    116. Perez JC (1990a) Digital holograms computers, concepts and applications, in Neural networks: biological computers or electronic brains, Les entretiens de Lyon,
    Springer Verlag, ISBN 2-287-00051-8.
    117. Perez JC (1990b) Integers neural network systems (INNS) using resonance properties of a Fibonacci’s chaotic golden neuron. Neural Networks 1, 859–865. IEEE
    90CH2879-5. INSPEC Accession Number: 3926657
    118. Perez JC (1991) Chaos, DNA, and neuro-computers: A golden link: The hidden language of genes, global language and order in the human genome. Speculations
    in Science and Technology 14, 336–346
    119. Perez JC (1997) L’ADN décrypté, Résurgence, Liège Belgium. ISBN 2-87211-017-8
    Chapter in: Handbook: “The Cerebellum and Cerebellar Disorders”. Ed. Dr. Mario Manto, Springer Verlag. Submitted Oct. 20, Accepted Nov. 1, 2011.
    Pellionisz et al. Recursive Genome Function: Geometric Unification of Neuroscience and Genomics Page 23
    120. Perez JC (2008) Scale invariance embedded votes and self-emerging binary logics in the whole human genome. Relating the paper: What is complexity? by Gell-
    Mann PM. Complexity. 1(1) 1995, John Wiley and Sons
    121. Perez JC (2009a) Codex Biogenesis. Resurgence, Liege Belgium. ISBN 2-87434-044-8. and
    122. Perez JC (2009b) Golden ratio and numbers in DNA and http://golden-ratio-in-dna.blogspot....perezsgeneric-
    123. Perez JC, Bertille JM (1990c) A spatio temporal novelty detector using Fractal Chaos model, IJCNN Conference Washington; Neural Networks, INNS USA
    124. Perez JC (2010) Codon population in single-stranded whole human genome DNA are fractal and fine-tuned by the Golden Ration 1.618. Interdisciplinary
    Sciences: Computational Life Sciences Vol 2, Number 3, 228-340 DOI: 10.1007/s12539-010-0022-0
    125. Perez JC (2011a) Decoding non-coding DNA codes: Human genome meta-chromosomes architecture (support from Pr Luc Montagnier FMPRS World AIDS
    Foundation UNESCO and Jean-rené Fourtou Vivendi Universal chairman), BIT Life Sciences’ Third Annual World Vaccine Congress-2011, Beijing March 2011
    126. Perez JC (2011b) Caminos Interdisciplinaios, Seminario CLAVE_INTER, Espacio Interdisciplinario, Universidad de la Republica Montevideo Uruguay, 27 de
    Octubre 2011.
    127. Perez JC (2012) paper in preparation: DNA, Waveforms and Numbers: Unifying all 1496 HIV1 whole genomes
    128. Peterson BW, Baker JA, Pellionisz AJ (1987) Multidimensional analysis of vestibulo-ocular and vestibulo-colllic reflexes (VOR and VCR). In: Proceedings of the
    International Symposium on Basic and Applied Aspects of Vestibular Function, Hong Kong
    129. Peterson BW, Pellionisz AJ, Baker JA, Keshner EA (1989) Functional morphology and neural control of neck muscles in mammals. Am. Zoology, 29:139-149
    130. Petoukhov S, He M (2010) Symmetrical analysis techniques for genetic systems and bioinformatics: Advanced patterns and applications. Medical Information
    Science Reference. ISBN 978-1605661247
    131. Rigoutsos I (2006) BM Watson Research Center
    132. Rigoutsos I, Floratos A, (1998) A. Combinatorial pattern discovery in biological sequences: The TEIRESIAS algorithm. Bioinformatics; 14(1) 55-67. pmid:9520502
    133. Rigoutsos I, Huynh T, Miranda K, Tsirigos A, McHardy A, Platt D (2006) Short blocks from the noncoding parts of the human genome have instances within nearly
    all known genes and relate to biological processes. PNAS April 25, 2006 vol. 103 no. 17 6605-6610
    134. Roy S, Llinás R (2007) Dynamic geometry, brain function modeling, and consciousness. Progress in Brain Res. . Vol. 168, pp 133-144. doi:10.1016/S0079-
    135. Schadt EE, Linderman MD, Sorenson J, Lee L, Nolan GP, Computational solutions to large-scale data management and analysis. (2010) Nature Rev. Genetics.
    (11) 647-657
    136. Schrıdinger E. (1944) What is life? Dublin Institute for Advanced Studies at Trinity College, Dublin, in February 1943
    137. Shannon CE (1948) A Mathematical theory of communication, Bell System Technical Journal, 27, pp. 379–423 & 623–656
    138. Shapshak P, Chiappelli, F, Commins D, Singer E, Levine AJ, Somboonwit C, Minagar A, Pellionisz, A. (2008) Molecular epigenetics, chromatin, and
    NeuroAIDS/HIV: Translational implications. Bioinformation. 3(1): 53–57. PMCID: PMC2586134
    139. Shepelyansky DL (2008) Fractal Weyl law for quantum fractal eigenstates. Physical Rev E 77, 015202
    140. Simons M, Pellionisz A (2006a) Genomics, morphogenesis and biophysics: Triangulation of Purkinje cell development. The Cerebellum. 5(1):27-35
    141. Simons M, Pellionisz A (2006b) Implications of fractal organization of DNA on disease risk genomic mapping and immune function analysis. Australasian and
    Southeast Asian Tissue Typing Association; 30th scientific meeting 22-24 November 2006, Chiangmai, Thailand
    142. Stagnaro S (2011) Glycocalix quantum-biophysical-semeiotic evaluation plays a central role in demonstration of water memory-information
    143. Stagnaro S, Caramel S (2011) A new way of therapy based on water memory-information: the Quantum biophysical approach
    144. Sylvester JJ (1853) On a theory of the syzygetic relations of two rational integral functions, Comprising an application to the theory of Sturm's functions, and that of
    the greatest algebraical common measure, Philosophical Trans. of the Royal Society of London (The Royal Society) 143: 407–548, doi:10.1098/rstl.1853.0018,
    see also and
    145. Szentágothai J (1949) The elementary vestibulo-ocular reflex arc. J Neurophysiol. 136)395-407
    146. Timchenko LT, Caskey CT (1999) Triplet repeat disorders: discussion of molecular mechanisms. Cell Mol Life Sci. 55(11):1432-47.
    147. Zipf GK (1949) Human behaviour and the principle of least-effort, Addison-Wesley, Cambridge MA
    148. Zhuangzi (around the 4th century BC) Stanford encyclopedia of philosophy
    149. Venter C (2010) Multiple personal genomes await Nature 464, 676-677 (1 April 2010) | doi:10.1038/464676a; Published online 31 March 2010
    150. Wang L, Brown SJ (2006) Bind N: A web-based tool for efficient prediction of DNA and RNA binding sites in amino acid sequences. Nucleic Acids Res., 34:W243-
    W248 and
    151. Watson JD (2008) Editorial: The failed war on cancer, People against cancer.
    152. Watson JD (2009) To fight cancer, know the enemy. New York Times August 6, A29
    153. Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG (et al) (2001) Science 291(5507):1304-1351. DOI: 10.1126/science.1058040,
    154. Weyl H (1912) Das asymptotisce lerteihingsgesetz der Eigenwerte linearer partieller Differentialgleichungen. Math. Ann. 71:441-479, see also in
    155. Wiener N (1948) Cybernetics or control and communication in the cnimal and the machine, Hermann & Cie Editeurs, Paris, The Technology Press, Cambridge,
    Mass., John Wiley & Sons Inc., New York;
    156. Yamashita S, Tsujino Y, Moriguchi K, Tatematsu M, Ushijima T (2006) Chemical genomic screening for methylation-silenced genes in gastric cancer cell lines
    using 5-aza-2'-deoxycytidine treatment and oligonucleotide microarray. Cancer Sci 97:64-71,
    Last edited by Craig.Paardekooper; 08-17-2012 at 11:26 AM.

  4. #274
    Join Date
    Jul 2008
    London UK

    Paper by Natasa

    Here is a paper by Natasa Z. Misic which contains some new ideas that extend the work of Shcherbak

    Name:  Misic.jpg
Views: 176
Size:  165.3 KB

    This hypercube arrangement is interesting. It generates sums of 6 x 6 x 37 and (6 + 6 + 6) x (6 + 6 + 6) * 37
    Last edited by Craig.Paardekooper; 08-17-2012 at 11:58 AM.

  5. #275
    Join Date
    Jul 2008
    London UK

    Meeting with a Code Breaker

    Last night I was in Chelsea, sitting in the Gallery Mess on my own, everyone else being outside on such a warm evening. It was peaceful and quiet and a good time to take a closer look at Perez's paper. After a couple of hours I looked up to see one other person had joined me in the cafe - a woman sitting at some distance from me and reading a book - the book was The Code Book.

    I introduced myself, and she told me that she was a professional code breaker working for a large financial institution based in the City. She was involved in using code-breaking techniques to detect patterns in the News using mathematical algorithms.

    I thought that these same techniques might help us discover patterns in the genetic code, so she recommended some books on code-breaking, and also some free distance courses in code breaking run by MIT.

    One of the books is called "The Code Book". I will post details of the MIT courses as soon as she emails them to me.
    Last edited by Craig.Paardekooper; 08-18-2012 at 07:06 PM.

  6. #276
    Join Date
    Jul 2008
    London UK

    What will shortly appear

    Ezekiel had a vision of wheels within wheels. ....What seems to be appearing is a similar vision encoded within the DNA of all living things. I refer to a hierarchy of nested cycles - wheels within wheels - with each cycle being based on prime number 037.

    DNA is fractal in nature precisely because it consists of this nested hierarchy of cycles.

    For example, here is a quote from Natasa Misic - "The Self-similar Numbers as a Special Case of Cyclic Numbers and Their Relation to the Cyclic (Genetic) Codes"

    The genetic code is analyzed as one of the major
    natural codes, which as such can reveal the deeper principles
    of optimal coding. The analysis is based on a discovery that
    the symmetrical architecture of genetic code and the nucleon
    number of its constituents – the free canonical amino acids
    and bases, are strictly determined by the prime number with
    a cycling digit property – 037.
    A detailed derivation for all
    types of analogues of 037 is given and shown that they
    represent a special case of cyclic numbers whose digits and
    multipliers are equidistant. The derived generic formula for
    analogues of 037 is correlated with cyclotomic and generalized
    Golden Mean polynomials, by which is shown their relation
    with discrete self-similarity, why author named them the
    Self-similar Numbers. Also it is given their relationship with
    the cyclic codes, which is with fact that the genetic code is
    arranged in multiple ways at different levels as a cyclic code,
    generally indicate that the hierarchically nested cyclicality is
    one of the principles of fractal organization of the genetic
    , as well as the other organic codes in the living organisms.
    The emergence of such a pattern - I believe - would be of great symbolic meaning to our generation - serving as a Philosophers Stone - as a foundation stone for the philosophies that shape human cultures.

    That emergence is now upon us.
    Last edited by Craig.Paardekooper; 08-22-2012 at 01:47 AM.

  7. #277
    Join Date
    Jun 2007
    Yakima, Wa
    Quote Originally Posted by Craig.Paardekooper View Post
    Ezekiel had a vision of wheels within wheels. ....What is shortly to appear is a similar vision encoded within the DNA of all living things. I refer to a hierarchy of nested cycles - wheels within wheels - with each cycle being based on prime number 037.

    DNA is fractal in nature precisely because it consists of this nested hierarchy of cycles.

    For example, here is a quote from Natasa Misic - "The Self-similar Numbers as a Special Case of Cyclic Numbers and Their Relation to the Cyclic (Genetic) Codes"
    Very interesting stuff. I'll need to read the scientific papers.

    Quote Originally Posted by Craig.Paardekooper View Post
    The emergence of this pattern - I believe - will be of great symbolic meaning to our generation - serving as a Philosophers Stone - as a foundation stone for the philosophies that shape human cultures.

    This emergence is now upon us - and with each day it is gaining clarity.
    That's exactly how I felt about the Bible Wheel. It will be interesting to see if anything comes of this.
    • Skepticism is the antiseptic of the mind.
    • Remember why we debate. We have nothing to lose but the errors we hold. Who but a stubborn fool would hold to errors once they have been exposed?

    Check out my blog site

  8. #278
    Join Date
    Jun 2007
    Yakima, Wa
    Quote Originally Posted by Craig.Paardekooper View Post
    Last night I was in Chelsea, sitting in the Gallery Mess on my own, everyone else being outside on such a warm evening. It was peaceful and quiet and a good time to take a closer look at Perez's paper. After a couple of hours I looked up to see one other person had joined me in the cafe - a woman sitting at some distance from me and reading a book - the book was The Code Book.

    I introduced myself, and she told me that she was a professional code breaker working for a large financial institution based in the City. She was involved in using code-breaking techniques to detect patterns in the News using mathematical algorithms.

    I thought that these same techniques might help us discover patterns in the genetic code, so she recommended some books on code-breaking, and also some free distance courses in code breaking run by MIT.

    One of the books is called "The Code Book". I will post details of the MIT courses as soon as she emails them to me.
    That's a pretty cool synchronicity!

    Do you know how Perez's research has been received by "those in the know"?
    • Skepticism is the antiseptic of the mind.
    • Remember why we debate. We have nothing to lose but the errors we hold. Who but a stubborn fool would hold to errors once they have been exposed?

    Check out my blog site

  9. #279

    Thanks paardekooper

    For getting me interested in this again, since im unscholared about how DNA works, im trying to understand how it works, and im looking at Vernon jenkins pages to understand about the patterns there in the aminoacids, its so crazy that the molar mass of those 20 universal amino acids sums up to 2738,00 exactly
    2738 is 37*74
    74 being the number nucleons of standard block in those amino acids. And the crazy number 37, so cool. I will soon try to understand what you writ here on this thread.
    God bless

  10. #280
    Join Date
    Jul 2008
    London UK


    Here is a quote from Perez -

    Perez [1991],
    Marcer |1992], see also Fig. 5. Panel 2. Correlation samples were established in genes or gene-rich small genomes with evolution or
    pathogenicity (example of HIV genome particularly; see the book Perez [1997]). “Resonances” were analyzed, where a resonance is a
    Fibonacci number of contiguous A, T, C and G nucleotides (i.e.144). If this sub-sequence contains exactly 55 bases T and 89 bases C,
    A, or G, this set was called a “resonance”. Thousands of resonances were discovered (see upper right corner of Panel 2 of Fig.5. from
    Perez [1991]) : in HIV -the whole genome is long of about 9000 bases-, there are resonances overlapping about 2/3 of the genome.
    Here Perez examined every sequence of length 144 bases within a gene-rich small genome. He discovered that in a high percentage of these sequences the ratio of the number of T bases to the number of C + G + A bases is 55 : 89

    T : C + G + A = 55 : 89 = 1 : 1.618 = the Golden Ratio.

    References :

    Perez JC (1991) Chaos, DNA, and neuro-computers: A golden link: The hidden language of genes, global language and order in the human genome. Speculations
    in Science and Technology 14, 336–346

    Marcer P.J. (1992) Order and chaos in DNA – the Denis Guichard Prizewinner: Jean-Claude Perez, in KIBERNETES 1992, vol 21, n°2, pp.60-61, ISSN 0368-

    Perez JC (1997) L’ADN décrypté, Résurgence, Liège Belgium. ISBN 2-87211-017-8
    Chapter in: Handbook: “The Cerebellum and Cerebellar Disorders”. Ed. Dr. Mario Manto, Springer Verlag. Submitted Oct. 20, Accepted Nov. 1, 2011.
    Pellionisz et al. Recursive Genome Function: Geometric Unification of Neuroscience and Genomics Page 23

    An Investigation of This Phenomena

    It would be easy to investigate this phenomena for myself. Microbes tend to be gene-rich, since most of their genome is coding-dna. And the genomes of all microbes are easily available online for download.

    I can loop through the DNA sequence of each microbe, extracting each 144 letter substring, then simply counting the frequency of each letter T, C, G, and A. I can then record how many times the frequency of T = 55 or a near integer. The software will also record the position of the "resonance"

    The code I will use will look something like this -

    For i = 0 to Sequence.length - 144
    TestSequence = Sequence.Substring(i, 144)

    Tfreq = CountLetters(TestSequence)

    If TFreq = 55 then
    StringOutput &= TFreq & " at position " & i & vbcrlf
    x += 1
    StringOutput2 &= TFreq & " at position " & i & vbcrlf
    z =+ 1
    End If


    TextBox1.Text = "Resonances found = " & x & vbcrlf & StringOutput1 & vbcrlf & vbcrlf
    TextBox1.Text &= "Non-Resonances found = " & z & vbcrlf & vbcrlf
    TextBox1.Text &= "Resonant Percentage = 100 * x/(x + z) & "%"

    Function CountLetters(TestSequence) as Integer
    Dim Y as Integer = 0
    Dim LetterArray() as Char
    Dim Letter as Char

    LetterArray = TestSequence.tochararray()

    For Each Letter in LetterArray
    If Letter.ToString = "T" then
    Y += 1

    Return Y
    End Function

    It will be interesting to see the percentage of occurence of "resonances" in different genomes.

    Results of Searching Acidianus Hospitalis

    I searched the first 30000 bases of this microbe.
    I recorded the number of times that T occurred in strings of length 144 within the genome. Here are the results for Acidianus hospitalis (0-30000)




    28 15
    29 51
    30 90
    31 151
    32 298
    33 341
    34 503
    35 672
    36 922
    37 1011
    38 1260
    39 1437
    40 1678
    41 1812
    42 2040
    43 2034
    44 2253
    45 2330
    46 2381
    47 2425
    48 2587
    49 2607
    50 2472
    51 2553
    52 2435
    53 2514
    54 2511
    55 2306
    56 2153
    57 2021
    58 1882
    59 1535
    60 1238
    61 1085
    62 1013
    63 844
    64 694
    65 420
    66 434
    67 320
    68 253
    69 204
    70 189
    71 90
    72 44
    73 29
    74 31
    75 16
    76 3
    77 3

    The results show no special concentration at Frequency = 55. If There was a resonance then I would expect atleast a minor peak at Frequency = 55, but there is no outstanding peak. I repeated the experiment with Yeast - still there was no peak at Frequency 55. I will have to take a closer look at Perez's work - maybe I am missing something.


    When the frequency of a letter is 55 within a particular string of 144 letters then we have a fibonnacci ratio for that letter. However, perhaps other instances of Fibonnaccci ratios also occur in that same string. I can investrigate this by using the start position of those strings and extending the length to 233 letters then seeing if any of the bases occur with a frequency of 89 times within those extended strings.

    Results for Extended Strings of 233, 377 and 610 Length

    So I looked for a letter occurring 55 times in a string of 144 letters AND the same letter occurring 89 times in a string of 233 letters AND the same letter occurring 144 times in a string of 377 letters with each of these three strings starting at the same position.

    I found only 39 instances in the first microbe that I tested (range 0 10 250000 bases). And I found only 3 instances in Yeast.

    The frequency of occurrence of any letter within strings of length 144, 233 or 307 does not show any tendency towards a Fibonacci number for microbes in general.
    Last edited by Craig.Paardekooper; 08-25-2012 at 03:14 AM.

Thread Information

Users Browsing this Thread

There are currently 1 users browsing this thread. (0 members and 1 guests)

Tags for this Thread


Posting Permissions

  • You may not post new threads
  • You may post replies
  • You may not post attachments
  • You may edit your posts