Google Ads

Google Ads

Bible Wheel Book

+ Reply to Thread
Page 16 of 54 FirstFirst ... 612131415161718192026 ... LastLast
Results 151 to 160 of 540
  1. #151
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Searching for Language within an Organism

    To test out the idea that DNA might contain a spoken language, I had to obtain the DNA code for an organism. I chose one of the simplest organisms - E.Coli. The DNA of E. Coli can easily be obtained online here http://www.ncbi.nlm.nih.gov/nuccore/X01714.

    E Coli has only 1609 bases

    CAGAGAAAATCAAAAAGCAGGCCACGCAGGGTGATGAATTAACAATAAAA ATGGTTAAAAACCCCGATAT
    CGTCGCAGGCGTTGCCGCACTAAAAGACCATCGACCCTACGTCGTTGGAT TTGCCGCCGAAACAAATAAT
    GTGGAAGAATACGCCCGGCAAAAACGTATCCGTAAAAACCTTGATCTGAT CTGCGCGAACGATGTTTCCC
    AGCCAACTCAAGGATTTAACAGCGACAACAACGCATTACACCTTTTCTGG CAGGACGGAGATAAAGTCTT
    ACCGCTTGAGCGCAAAGAGCTCCTTGGCCAATTATTACTCGACGAGATCG TGACCCGTTATGATGAAAAA
    AATCGACGTTAAGATTCTGGACCCGCGCGTTGGGAAGGAATTTCCGCTCC CGACTTATGCCACCTCTGGC
    TCTGCCGGACTTGACCTGCGTGCCTGTCTCAACGACGCCGTAGAACTGGC TCCGGGTGACACTACGCTGG
    TTCCGACCGGGCTGGCGATTCATATTGCCGATCCTTCACTGGCGGCAATG ATGCTGCCGCGCTCCGGATT
    GGGACATAAGCACGGTATCGTGCTTGGTAACCTGGTAGGATTGATCGATT CTGACTATCAGGGCCAGTTG
    ATGATTTCCGTGTGGAACCGTGGTCAGGACAGCTTCACCATTCAACCTGG CGAACGCATCGCCCAGATGA
    TTTTTGTTCCGGTAGTACAGGCTGAATTTAATCTGGTGGAAGATTTCGAC GCCACCGACCGCGGTGAAGG
    CGGCTTTGGTCACTCTGGTCGTCAGTAACACATACGCATCCGAATAACGT CATAACATAGCCGCAAACAT
    TTCGTTTGCGGTCATAGCGTGGGTGCCGCCTGGCAAGTGCTTATTTTCAG GGGTATTTTGTAACATGGCA
    GAAAAACAAACTGCGAAAAGGAACCGTCGCGAGGAAATACTTCAGTCTCT GGCGCTGATGCTGGAATCCA
    GCGATGGAAGCCAACGTATCACGACGGCAAAACTGGCCGCCTCTGTCGGC GTTTCCGAAGCGGCACTGTA
    TCGCCACTTCCCCAGTAAGACCCGCATGTTCGATAGCCTGATTGAGTTTA TCGAAGATAGCCTGATTACT
    CGCATCAACCTGATTCTGAAAGATGAGAAAGACACCACAGCGCGCCTGCG TCTGATTGTGTTGCTGCTTC
    TCGGTTTTGGTGAGCGTAATCCTGGCCTGACCCGCATCCTCACTGGTCAT GCGCTAATGTTTGAACAGGA
    TCGCCTGCAAGGGCGCATCAACCAGCTGTTCGAGCGTATTGAAGCGCAGC TGCGCCAGGTATTGCGTGAA
    AAGAGAATGCGTGAGGGTGAAGGTTACACCACCGATGAAACCCTGCTGGC AAGCCAGATCCTGGCCTTCT
    GTGAAGGTATGCTGTCACGTTTTGTCCGCAGCGAATTTAAATACCGCCCG ACGGATGATTTTGACGCCCG
    CTGGCCGCTAATTGCGGCCAGTTGCAGTAATATGACGCCGGATGACTTTT CATCCGGCGAGTTTCTTTAA
    ACGCCAAACTCTTCGCGATAGGCCTTAACCGCCGCCAGATGTTCCGCCAT TTCCGGCTTCTCTTCCAGG

    It is amazing that this short code is able to create an entire organism.

    Then I divided this DNA sequence into triplets (codons) using vb.net. The number in brackets is simply the position of this codon in the DNA sequence.

    According to the website here - http://www.ncbi.nlm.nih.gov/nuccore/X01714, the E.Coli DNA has two coding regions. I have highlighted these two coding regions below in red. So the DNA is producing two different proteins. The rest of the DNA is noncoding.


    (1) CAG (4) AGA (7) AAA (10) TCA (13) AAA (16) AGC (19) AGG (22) CCA (25) CGC (28) AGG (31) GTG (34) ATG (37) AAT (40) TAA (43) CAA (46) TAA (49) AAA (52) TGG (55) TTA (58) AAA (61) ACC (64) CCG (67) ATA (70) TCG (73) TCG (76) CAG (79) GCG (82) TTG (85) CCG (88) CAC (91) TAA (94) AAG (97) ACC (100) ATC (103) GAC (106) CCT (109) ACG (112) TCG (115) TTG (118) GAT (121) TTG (124) CCG (127) CCG (130) AAA (133) CAA (136) ATA (139) ATG (142) TGG (145) AAG (148) AAT (151) ACG (154) CCC (157) GGC (160) AAA (163) AAC (166) GTA (169) TCC (172) GTA (175) AAA (178) ACC (181) TTG (184) ATC (187) TGA (190) TCT (193) GCG (196) CGA (199) ACG (202) ATG (205) TTT (208) CCC (211) AGC (214) CAA (217) CTC (220) AAG (223) GAT (226) TTA (229) ACA (232) GCG (235) ACA (238) ACA (241) ACG (244) CAT (247) TAC (250) ACC (253) TTT (256) TCT (259) GGC (262) AGG (265) ACG (268) GAG (271) ATA (274) AAG (277) TCT (280) TAC (283) CGC (286) TTG (289) AGC (292) GCA (295) AAG (298) AGC (301) TCC (304) TTG (307) GCC (310) AAT (313) TAT (316) TAC (319) TCG (322) ACG (325) AGA (328) TCG (331) TGA (334) CCC (337) GTT (340) ATG (343) ATG (346) AAA (349) AAA (352) ATC (355) GAC (358) GTT (361) AAG (364) ATT (367) CTG (370) GAC (373) CCG (376) CGC (379) GTT (382) GGG (385) AAG (388) GAA (391) TTT (394) CCG (397) CTC (400) CCG (403) ACT (406) TAT (409) GCC (412) ACC (415) TCT (418) GGC (421) TCT (424) GCC (427) GGA (430) CTT (433) GAC (436) CTG (439) CGT (442) GCC (445) TGT (448) CTC (451) AAC (454) GAC (457) GCC (460) GTA (463) GAA (466) CTG (469) GCT (472) CCG (475) GGT (478) GAC (481) ACT (484) ACG (487) CTG (490) GTT (493) CCG (496) ACC (499) GGG (502) CTG (505) GCG (508) ATT (511) CAT (514) ATT (517) GCC (520) GAT (523) CCT (526) TCA (529) CTG (532) GCG (535) GCA (538) ATG (541) ATG (544) CTG (547) CCG (550) CGC (553) TCC (556) GGA (559) TTG (562) GGA (565) CAT (568) AAG (571) CAC (574) GGT (577) ATC (580) GTG (583) CTT (586) GGT (589) AAC (592) CTG (595) GTA (598) GGA (601) TTG (604) ATC (607) GAT (610) TCT (613) GAC (616) TAT (619) CAG (622) GGC (625) CAG (628) TTG (631) ATG (634) ATT (637) TCC (640) GTG (643) TGG (646) AAC (649) CGT (652) GGT (655) CAG (658) GAC (661) AGC (664) TTC (667) ACC (670) ATT (673) CAA (676) CCT (679) GGC (682) GAA (685) CGC (688) ATC (691) GCC (694) CAG (697) ATG (700) ATT (703) TTT (706) GTT (709) CCG (712) GTA (715) GTA (718) CAG (721) GCT (724) GAA (727) TTT (730) AAT (733) CTG (736) GTG (739) GAA (742) GAT (745) TTC (748) GAC (751) GCC (754) ACC (757) GAC (760) CGC (763) GGT (766) GAA (769) GGC (772) GGC (775) TTT (778) GGT (781) CAC (784) TCT (787) GGT (790) CGT (793) CAG (796) TAA (799) CAC (802) ATA (805) CGC (808) ATC (811) CGA (814) ATA (817) ACG (820) TCA (823) TAA (826) CAT (829) AGC (832) CGC (835) AAA (838) CAT (841) TTC (844) GTT (847) TGC (850) GGT (853) CAT (856) AGC (859) GTG (862) GGT (865) GCC (868) GCC (871) TGG (874) CAA (877) GTG (880) CTT (883) ATT (886) TTC (889) AGG (892) GGT (895) ATT (898) TTG (901) TAA (904) CAT (907) GGC (910) AGA (913) AAA (916) ACA (919) AAC (922) TGC (925) GAA (928) AAG (931) GAA (934) CCG (937) TCG (940) CGA (943) GGA (946) AAT (949) ACT (952) TCA (955) GTC (958) TCT (961) GGC (964) GCT (967) GAT (970) GCT (973) GGA (976) ATC (979) CAG (982) CGA (985) TGG (988) AAG (991) CCA (994) ACG (997) TAT (1000) CAC (1003) GAC (1006) GGC (1009) AAA (1012) ACT (1015) GGC (1018) CGC (1021) CTC (1024) TGT (1027) CGG (1030) CGT (1033) TTC (1036) CGA (1039) AGC (1042) GGC (1045) ACT (1048) GTA (1051) TCG (1054) CCA (1057) CTT (1060) CCC (1063) CAG (1066) TAA (1069) GAC (1072) CCG (1075) CAT (1078) GTT (1081) CGA (1084) TAG (1087) CCT (1090) GAT (1093) TGA (1096) GTT (1099) TAT (1102) CGA (1105) AGA (1108) TAG (1111) CCT (1114) GAT (1117) TAC (1120) TCG (1123) CAT (1126) CAA (1129) CCT (1132) GAT (1135) TCT (1138) GAA (1141) AGA (1144) TGA (1147) GAA (1150) AGA (1153) CAC (1156) CAC (1159) AGC (1162) GCG (1165) CCT (1168) GCG (1171) TCT (1174) GAT (1177) TGT (1180) GTT (1183) GCT (1186) GCT (1189) TCT (1192) CGG (1195) TTT (1198) TGG (1201) TGA (1204) GCG (1207) TAA (1210) TCC (1213) TGG (1216) CCT (1219) GAC (1222) CCG (1225) CAT (1228) CCT (1231) CAC (1234) TGG (1237) TCA (1240) TGC (1243) GCT (1246) AAT (1249) GTT (1252) TGA (1255) ACA (1258) GGA (1261) TCG (1264) CCT (1267) GCA (1270) AGG (1273) GCG (1276) CAT (1279) CAA (1282) CCA (1285) GCT (1288) GTT (1291) CGA (1294) GCG (1297) TAT (1300) TGA (1303) AGC (1306) GCA (1309) GCT (1312) GCG (1315) CCA (1318) GGT (1321) ATT (1324) GCG (1327) TGA (1330) AAA (1333) GAG (1336) AAT (1339) GCG (1342) TGA (1345) GGG (1348) TGA (1351) AGG (1354) TTA (1357) CAC (1360) CAC (1363) CGA (1366) TGA (1369) AAC (1372) CCT (1375) GCT (1378) GGC (1381) AAG (1384) CCA (1387) GAT (1390) CCT (1393) GGC (1396) CTT (1399) CTG (1402) TGA (1405) AGG (1408) TAT (1411) GCT (1414) GTC (1417) ACG (1420) TTT (1423) TGT (1426) CCG (1429) CAG (1432) CGA (1435) ATT (1438) TAA (1441) ATA (1444) CCG (1447) CCC (1450) GAC (1453) GGA (1456) TGA (1459) TTT (1462) TGA (1465) CGC (1468) CCG (1471) CTG (1474) GCC (1477) GCT (1480) AAT (1483) TGC (1486) GGC (1489) CAG (1492) TTG (1495) CAG (1498) TAA (1501) TAT (1504) GAC (1507) GCC (1510) GGA (1513) TGA (1516) CTT (1519) TTC (1522) ATC (1525) CGG (1528) CGA (1531) GTT (1534) TCT (1537) TTA (1540) AAC (1543) GCC (1546) AAA (1549) CTC (1552) TTC (1555) GCG (1558) ATA (1561) GGC (1564) CTT (1567) AAC (1570) CGC (1573) CGC (1576) CAG (1579) ATG (1582) TTC (1585) CGC (1588) CAT (1591) TTC (1594) CGG (1597) CTT (1600) CTC (1603) TTC (1606) CAG


    Then I simply counted the occurrence of the STOP Codons TAA or TAG in the coding and noncoding regions and compared them.
    Note: The second coding region appears to be shifted one base out of the reading frame compared to the first coding area. The DNA in the noncoding area between the two coding areas must contain an instruction to alter the reading frame.

    Result
    In the non-coding region before the first red area, the stop codon TAA occurs 3 times, whilst it occurs only once in the first coding area. So the first hypothesis is supported -there is a definite difference in the frequency of the STOP CODONS between coding and noncoding areas. In the coding areas, the STOP codons only occur once, at the end of the coding sequence. Whilst in non-coding areas, the stop codons occur with much greater frequency.

    This isn't really anything new. Scientists already use this criteria to identify coding areas.

    Also, the frequency of occurrence of the stop codons in the noncoding area is 3 times in 113 codons = 2.65 %. This is similar to the frequency of occurrence of a letter in the Hebrew alphabet. see here - http://www.sttmedia.com/characterfrequency-hebrew
    Last edited by Craig.Paardekooper; 04-30-2012 at 12:19 AM.

  2. #152
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Another characteristic of Language

    Another characteristic of a spoken language would be the absence of repeating characters. For example, coding areas of DNA might have a sequence such as AATAATAATAATAATAAT. If noncoding areas of DNA represent letters in a spoken language, then I would not expect such repetitions. So it will be interesting to investigate the frequency of repetitions in both areas.

  3. #153
    Join Date
    Nov 2008
    Location
    Not from this world...from the other side
    Posts
    3,233
    Quote Originally Posted by Craig.Paardekooper View Post
    To test out the idea that DNA might contain a spoken language, I had to obtain the DNA code for an organism. I chose one of the simplest organisms - E.Coli. The DNA of E. Coli can easily be obtained online here http://www.ncbi.nlm.nih.gov/nuccore/X01714.

    E Coli has only 1609 bases

    CAGAGAAAATCAAAAAGCAGGCCACGCAGGGTGATGAATTAACAATAAAA ATGGTTAAAAACCCCGATAT
    CGTCGCAGGCGTTGCCGCACTAAAAGACCATCGACCCTACGTCGTTGGAT TTGCCGCCGAAACAAATAAT
    GTGGAAGAATACGCCCGGCAAAAACGTATCCGTAAAAACCTTGATCTGAT CTGCGCGAACGATGTTTCCC
    AGCCAACTCAAGGATTTAACAGCGACAACAACGCATTACACCTTTTCTGG CAGGACGGAGATAAAGTCTT
    ACCGCTTGAGCGCAAAGAGCTCCTTGGCCAATTATTACTCGACGAGATCG TGACCCGTTATGATGAAAAA
    AATCGACGTTAAGATTCTGGACCCGCGCGTTGGGAAGGAATTTCCGCTCC CGACTTATGCCACCTCTGGC
    TCTGCCGGACTTGACCTGCGTGCCTGTCTCAACGACGCCGTAGAACTGGC TCCGGGTGACACTACGCTGG
    TTCCGACCGGGCTGGCGATTCATATTGCCGATCCTTCACTGGCGGCAATG ATGCTGCCGCGCTCCGGATT
    GGGACATAAGCACGGTATCGTGCTTGGTAACCTGGTAGGATTGATCGATT CTGACTATCAGGGCCAGTTG
    ATGATTTCCGTGTGGAACCGTGGTCAGGACAGCTTCACCATTCAACCTGG CGAACGCATCGCCCAGATGA
    TTTTTGTTCCGGTAGTACAGGCTGAATTTAATCTGGTGGAAGATTTCGAC GCCACCGACCGCGGTGAAGG
    CGGCTTTGGTCACTCTGGTCGTCAGTAACACATACGCATCCGAATAACGT CATAACATAGCCGCAAACAT
    TTCGTTTGCGGTCATAGCGTGGGTGCCGCCTGGCAAGTGCTTATTTTCAG GGGTATTTTGTAACATGGCA
    GAAAAACAAACTGCGAAAAGGAACCGTCGCGAGGAAATACTTCAGTCTCT GGCGCTGATGCTGGAATCCA
    GCGATGGAAGCCAACGTATCACGACGGCAAAACTGGCCGCCTCTGTCGGC GTTTCCGAAGCGGCACTGTA
    TCGCCACTTCCCCAGTAAGACCCGCATGTTCGATAGCCTGATTGAGTTTA TCGAAGATAGCCTGATTACT
    CGCATCAACCTGATTCTGAAAGATGAGAAAGACACCACAGCGCGCCTGCG TCTGATTGTGTTGCTGCTTC
    TCGGTTTTGGTGAGCGTAATCCTGGCCTGACCCGCATCCTCACTGGTCAT GCGCTAATGTTTGAACAGGA
    TCGCCTGCAAGGGCGCATCAACCAGCTGTTCGAGCGTATTGAAGCGCAGC TGCGCCAGGTATTGCGTGAA
    AAGAGAATGCGTGAGGGTGAAGGTTACACCACCGATGAAACCCTGCTGGC AAGCCAGATCCTGGCCTTCT
    GTGAAGGTATGCTGTCACGTTTTGTCCGCAGCGAATTTAAATACCGCCCG ACGGATGATTTTGACGCCCG
    CTGGCCGCTAATTGCGGCCAGTTGCAGTAATATGACGCCGGATGACTTTT CATCCGGCGAGTTTCTTTAA
    ACGCCAAACTCTTCGCGATAGGCCTTAACCGCCGCCAGATGTTCCGCCAT TTCCGGCTTCTCTTCCAGG

    It is amazing that this short code is able to create an entire organism.

    Then I divided this DNA sequence into triplets (codons) using vb.net. The number in brackets is simply the position of this codon in the DNA sequence.

    According to the website here - http://www.ncbi.nlm.nih.gov/nuccore/X01714, the E.Coli DNA has two coding regions. I have highlighted these two coding regions below in red. The rest of the DNA is noncoding.


    (1) CAG (4) AGA (7) AAA (10) TCA (13) AAA (16) AGC (19) AGG (22) CCA (25) CGC (28) AGG (31) GTG (34) ATG (37) AAT (40) TAA (43) CAA (46) TAA (49) AAA (52) TGG (55) TTA (58) AAA (61) ACC (64) CCG (67) ATA (70) TCG (73) TCG (76) CAG (79) GCG (82) TTG (85) CCG (88) CAC (91) TAA (94) AAG (97) ACC (100) ATC (103) GAC (106) CCT (109) ACG (112) TCG (115) TTG (118) GAT (121) TTG (124) CCG (127) CCG (130) AAA (133) CAA (136) ATA (139) ATG (142) TGG (145) AAG (148) AAT (151) ACG (154) CCC (157) GGC (160) AAA (163) AAC (166) GTA (169) TCC (172) GTA (175) AAA (178) ACC (181) TTG (184) ATC (187) TGA (190) TCT (193) GCG (196) CGA (199) ACG (202) ATG (205) TTT (208) CCC (211) AGC (214) CAA (217) CTC (220) AAG (223) GAT (226) TTA (229) ACA (232) GCG (235) ACA (238) ACA (241) ACG (244) CAT (247) TAC (250) ACC (253) TTT (256) TCT (259) GGC (262) AGG (265) ACG (268) GAG (271) ATA (274) AAG (277) TCT (280) TAC (283) CGC (286) TTG (289) AGC (292) GCA (295) AAG (298) AGC (301) TCC (304) TTG (307) GCC (310) AAT (313) TAT (316) TAC (319) TCG (322) ACG (325) AGA (328) TCG (331) TGA (334) CCC (337) GTT (340) ATG (343) ATG (346) AAA (349) AAA (352) ATC (355) GAC (358) GTT (361) AAG (364) ATT (367) CTG (370) GAC (373) CCG (376) CGC (379) GTT (382) GGG (385) AAG (388) GAA (391) TTT (394) CCG (397) CTC (400) CCG (403) ACT (406) TAT (409) GCC (412) ACC (415) TCT (418) GGC (421) TCT (424) GCC (427) GGA (430) CTT (433) GAC (436) CTG (439) CGT (442) GCC (445) TGT (448) CTC (451) AAC (454) GAC (457) GCC (460) GTA (463) GAA (466) CTG (469) GCT (472) CCG (475) GGT (478) GAC (481) ACT (484) ACG (487) CTG (490) GTT (493) CCG (496) ACC (499) GGG (502) CTG (505) GCG (508) ATT (511) CAT (514) ATT (517) GCC (520) GAT (523) CCT (526) TCA (529) CTG (532) GCG (535) GCA (538) ATG (541) ATG (544) CTG (547) CCG (550) CGC (553) TCC (556) GGA (559) TTG (562) GGA (565) CAT (568) AAG (571) CAC (574) GGT (577) ATC (580) GTG (583) CTT (586) GGT (589) AAC (592) CTG (595) GTA (598) GGA (601) TTG (604) ATC (607) GAT (610) TCT (613) GAC (616) TAT (619) CAG (622) GGC (625) CAG (628) TTG (631) ATG (634) ATT (637) TCC (640) GTG (643) TGG (646) AAC (649) CGT (652) GGT (655) CAG (658) GAC (661) AGC (664) TTC (667) ACC (670) ATT (673) CAA (676) CCT (679) GGC (682) GAA (685) CGC (688) ATC (691) GCC (694) CAG (697) ATG (700) ATT (703) TTT (706) GTT (709) CCG (712) GTA (715) GTA (718) CAG (721) GCT (724) GAA (727) TTT (730) AAT (733) CTG (736) GTG (739) GAA (742) GAT (745) TTC (748) GAC (751) GCC (754) ACC (757) GAC (760) CGC (763) GGT (766) GAA (769) GGC (772) GGC (775) TTT (778) GGT (781) CAC (784) TCT (787) GGT (790) CGT (793) CAG (796) TAA (799) CAC (802) ATA (805) CGC (808) ATC (811) CGA (814) ATA (817) ACG (820) TCA (823) TAA (826) CAT (829) AGC (832) CGC (835) AAA (838) CAT (841) TTC (844) GTT (847) TGC (850) GGT (853) CAT (856) AGC (859) GTG (862) GGT (865) GCC (868) GCC (871) TGG (874) CAA (877) GTG (880) CTT (883) ATT (886) TTC (889) AGG (892) GGT (895) ATT (898) TTG (901) TAA (904) CAT (907) GGC (910) AGA (913) AAA (916) ACA (919) AAC (922) TGC (925) GAA (928) AAG (931) GAA (934) CCG (937) TCG (940) CGA (943) GGA (946) AAT (949) ACT (952) TCA (955) GTC (958) TCT (961) GGC (964) GCT (967) GAT (970) GCT (973) GGA (976) ATC (979) CAG (982) CGA (985) TGG (988) AAG (991) CCA (994) ACG (997) TAT (1000) CAC (1003) GAC (1006) GGC (1009) AAA (1012) ACT (1015) GGC (1018) CGC (1021) CTC (1024) TGT (1027) CGG (1030) CGT (1033) TTC (1036) CGA (1039) AGC (1042) GGC (1045) ACT (1048) GTA (1051) TCG (1054) CCA (1057) CTT (1060) CCC (1063) CAG (1066) TAA (1069) GAC (1072) CCG (1075) CAT (1078) GTT (1081) CGA (1084) TAG (1087) CCT (1090) GAT (1093) TGA (1096) GTT (1099) TAT (1102) CGA (1105) AGA (1108) TAG (1111) CCT (1114) GAT (1117) TAC (1120) TCG (1123) CAT (1126) CAA (1129) CCT (1132) GAT (1135) TCT (1138) GAA (1141) AGA (1144) TGA (1147) GAA (1150) AGA (1153) CAC (1156) CAC (1159) AGC (1162) GCG (1165) CCT (1168) GCG (1171) TCT (1174) GAT (1177) TGT (1180) GTT (1183) GCT (1186) GCT (1189) TCT (1192) CGG (1195) TTT (1198) TGG (1201) TGA (1204) GCG (1207) TAA (1210) TCC (1213) TGG (1216) CCT (1219) GAC (1222) CCG (1225) CAT (1228) CCT (1231) CAC (1234) TGG (1237) TCA (1240) TGC (1243) GCT (1246) AAT (1249) GTT (1252) TGA (1255) ACA (1258) GGA (1261) TCG (1264) CCT (1267) GCA (1270) AGG (1273) GCG (1276) CAT (1279) CAA (1282) CCA (1285) GCT (1288) GTT (1291) CGA (1294) GCG (1297) TAT (1300) TGA (1303) AGC (1306) GCA (1309) GCT (1312) GCG (1315) CCA (1318) GGT (1321) ATT (1324) GCG (1327) TGA (1330) AAA (1333) GAG (1336) AAT (1339) GCG (1342) TGA (1345) GGG (1348) TGA (1351) AGG (1354) TTA (1357) CAC (1360) CAC (1363) CGA (1366) TGA (1369) AAC (1372) CCT (1375) GCT (1378) GGC (1381) AAG (1384) CCA (1387) GAT (1390) CCT (1393) GGC (1396) CTT (1399) CTG (1402) TGA (1405) AGG (1408) TAT (1411) GCT (1414) GTC (1417) ACG (1420) TTT (1423) TGT (1426) CCG (1429) CAG (1432) CGA (1435) ATT (1438) TAA (1441) ATA (1444) CCG (1447) CCC (1450) GAC (1453) GGA (1456) TGA (1459) TTT (1462) TGA (1465) CGC (1468) CCG (1471) CTG (1474) GCC (1477) GCT (1480) AAT (1483) TGC (1486) GGC (1489) CAG (1492) TTG (1495) CAG (1498) TAA (1501) TAT (1504) GAC (1507) GCC (1510) GGA (1513) TGA (1516) CTT (1519) TTC (1522) ATC (1525) CGG (1528) CGA (1531) GTT (1534) TCT (1537) TTA (1540) AAC (1543) GCC (1546) AAA (1549) CTC (1552) TTC (1555) GCG (1558) ATA (1561) GGC (1564) CTT (1567) AAC (1570) CGC (1573) CGC (1576) CAG (1579) ATG (1582) TTC (1585) CGC (1588) CAT (1591) TTC (1594) CGG (1597) CTT (1600) CTC (1603) TTC (1606) CAG


    Then I simply counted the occurrence of the STOP Codons TAA or TAG in the coding and noncoding regions and compared them.

    Result
    In the non-coding region before the first red area, the stop codon TAA occurs 3 times, whilst it occurs only once in the first coding area. So the first hypothesis is supported -there is a definite difference in the frequency of the STOP CODONS between coding and noncoding areas. In the coding areas, the STOP codons only occur once, at the end of the coding sequence. Whilst in non-coding areas, the stop codons occur with much greater frequency.

    This isn't really anything new. Scientists already use this criteria to identify coding areas.

    Also, the frequency of occurrence of the stop codons in the noncoding area is 3 times in 113 codons = 2.65 %. This is similar to the frequency of occurrence of a letter in the Hebrew alphabet. see here - http://www.sttmedia.com/characterfrequency-hebrew
    When I look at the DNA code that you present, it reminds me of the binary codes used in computers except that God uses code that is made from proteins. It certainly looks complex and more advanced than human binary codes. Just some food for thought, perhaps we could use alphabets instead of 0s and 1s in our binary codes. Another food for thought is that theorectically we can rearrange or manipulate these proteins and create new species of germs from these DNA protein codes of the germ E Coli. Craig, do you know of any research going on in which scientists are doing that to create new species of germs? The reason I asked is so as to prove that germs can be created and not evolved. I do know that you support creation than evolution.

    God's creation amazes me.
    Ask and You shall receive,
    Seek and You shall find,
    Knock and the door will be open unto You.

  4. #154
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    DNA from Larger Creatures

    Here is the DNA for muscles in Wild Pigs. It is called Sus Scrofa Myocin. You can find the code here - http://www.ncbi.nlm.nih.gov/nuccore/NM_214021.1

    CTTATTTGCCCTGTGGTGTGGTGATGATCACAGATGTCTAATTTCCCCTT GCCTGCCATTGAGTTTACCG
    AGCTGGGAGATAGTGGATAACTCACTTCCAAAATGGAGGATGGAAAACCC GTTTGGGCACCACACCCTAC
    AGATGGATTTCAGGTGGGCAATATCGTGGATATTGGCCCTGACAGCTTAA CAATTGAACCCCTGAACCAA
    AAAGGCAAGACCTTTTTGGCTCTCATAAACCAAGTGTTCCCTGCAGAAGA GGACAGTAAGAAAGATGTGG
    AAGATAACTGTTCATTGATGTATTTAAATGAAGCCACACTCCTCCATAAT ATCAAAGTTCGATACAGTAA
    AGACAGAATTTATACATATGTGGCCAACATTCTGATTGCCGTGAACCCAT ACTTTGACATTCCTAAAATC
    TACTCTTCAGAAACAATAAAGTCCTACCAAGGAAAATCTCTTGGGACCAT GCCACCTCATGTCTTTGCAA
    TTGCTGATAAGGCTTTTCGAGACATGAAGGTGCTCAAGCTGAGTCAGTCT ATCATTGTATCTGGAGAATC
    AGGAGCTGGCAAAACGGAAAATACAAAATTTGTTCTAAGATATCTGACTG AATCCTATGGAACCGGTCAA
    GATATTGATGATAGAATTGTTGAAGCTAACCCACTCCTAGAAGCCTTTGG AAATGCAAAGACTGTCCGCA
    ACAATAATAGCAGTCGATTTGGGAAATTTGTAGAAATACATTTTAATGAA AAGAGTTCAGTTGTTGGAGG
    ATTTGTCTCACATTATCTTCTAGAGAAATCTAGGATCTGTGTTCAAGGCA AAGAGGAAAGGAATTATCAT
    ATCTTTTATAGGTTGTGTGCTGGTGCTTCTGAAGATATTAGGGAAAGACT TCATTTGAGCTCCCCAGATA
    ATTTTCGGTATTTAAACCGGGGCTGCACTCGATATTTTGCTAACAAGGAA ACTGACAAACAGATTTTACA
    GAACCGAAAAAGTCCTGAGTACCTTAAGGCAGGTTCCTTGAAAGACCCTT TGTTAGATGACCATGGAGAC
    TTTATTAGAATGTGTACAGCCATGAAAAAAATCGGTTTGGATGATGAAGA AAAGCTCGATCTGTTCCGGG
    TAGTAGCTGGCGTCCTACATCTTGGAAATATTGATTTTGAGGAAGCTGGC AGCACTTCAGGTGGTTGTAA
    CCTGAAGAATAAATCTACTCAGGCATTGGAATATTGTGCAGAAAAATTAC TGGGTTTGGATCAAGACGAT
    CTTCGTGTAAGTTTAACCACAAGAGTCATGCTAACAACAGCAGGGGGCGC CAAAGGAACAGTTATAAAGG
    TGCCCTTGAAAGTGGAGCAAGCAAACAATGCCCGGGATGCCTTGGCAAAG ACTGTCTATAGCCATCTTTT
    TGATCATGTAGTGAACAGAGTAAATCAGTGTTTTCCTTTTGAAACCTCAT CCTATTTTATTGGAGTCCTC
    GACATTGCTGGTTTTGAGTACTTTGAACATAACAGTTTTGAACAATTTTG CATCAACTATTGCAATGAAA
    AACTTCAACAGTTTTTTAATGAAAGGATTCTGAAGGAGGAACAAGAACTC TATCAAAAGGAAGGTTTAGG
    TGTGAATGAAGTACATTACGTGGATAATCAGGACTGTATAGATTTAATTG AAGCAAGATTAGTGGGAATA
    CTGGATATTCTGGATGAAGAAAATCGCCTTCCACAGCCAAGTGATCAACA CTTTACATCTGCAGGTCACC
    AGAAGCACAAAGACCATTTCCGACTCTCTATTCCTAGAAAATCTAAGCTG GCAATCCATAGGAACATAGC
    ATATGACGAAGGTTTCATTATCAGGCATTTTGCAGGGGCAGTTTGCTATG AAACTACTCAGTTCGTGGAA
    AAAAATAATGATGCTTTGCATATGTCTCTCGAGTCCTTAATATGTGAATC CAGGGATAAATTCATCCGGG
    AATTATTTGAATCATCCACAAATAACAACAAAGATACTAAACAAAAAGCA GGAAAACTTAGCTTCATCAG
    TGTGGGAAACAAGTTTAAGACACAGTTAAATTTGCTTCTGGATAAACTTC GAAGTACTGGAGCAAGCTTT
    ATTCGTTGTATCAAACCTAATTTAAAGATGACAAGCCACCACTTTGAAGG TGCTCAGATTTTGTCTCAAC
    TTCAATGTTCAGGTATGGTGTCTGTTTTGGACCTGATGCAGGGCGGGTTT CCATCACGGGCTTCATTTCA
    TGAAGTGTACAACATGTATAAGAAGTCTCTGCCGGATAAGCTTGCAAGAT TAGACCCAAGACTATTTTGT
    AAGGCTCTTTTTAAAGCCCTGGGCTTAAATGAAATTGACTACAAGTTTGG GTTAACAAAAGTATTTTTTA
    GACCTGGCAAGTTTGCAGAATTTGATCAGATTATGAAGTCCGACCCTGAC CACTTAGCAGAGCTGGTTAA
    GAGAGTCAATCACTGGCTTATCTGCAGTCGCTGGAAGAAAGTTCAGTGGT GCTCGCTCTCAGTCATTAAA
    TTGAAAAACAAAATAAAATATCGAGCTGAAGCCTGCATTAAAATGCAGAA AACTATTCGAATGTGGCTTT
    GCAAAAGGAGACACAAACCTCGCATTGACGGCCTTGTTAAGGTGGGCACA CTGAAAAAACGGCTTGACAA
    ATTTAACGAAGTAGTAAGTGCCCTGAAAGATGGAAAACAGGAAATGAGTA AACAGGTCAAGGACCTTGAA
    ATCTCTATTGATGCTTTAATGGCCAAAATTAAGTCTACTATGATGACAAG GGAACAAATTCAGAAAGAAT
    ATGATGCATTAGTTAAAAGCTCAGCCGTCCTCCTCAGTGCATTACAGAAA AAGAAGCAGCAAGAAGAGGA
    AGCAGAAAGGCTGAGGCGTATTCAAGAAGAAATGGAAAAGGAAAGAAAAA GACGTGAAGAAGATGAACAA
    CGTCGAAGAAAGGAGGAGGAGGAAAGGCGGATGAAACTTGAGATGGAAGC AAAGAGAAAACAAGAAGAAG
    AAGAGAGAAAGAAAAGGGAAGATGATGAAAAACGTATTCAGGCTGAGGTG GAGGCGCAGCTGGCCCGACA
    GCGGGAGGAGGAGTCCCAGCAGCAGGCAGTTCTGGAGCAGGAGCGCCGGG ACCGGGAGCTGGCCCTGCGA
    ATTGCCCAGAGCGAGGCAGAGCTCATCAGTGACGAGGCGCAGGCCGACCC TGGGCTGCGCAGAGGCCCTG
    CTGTACAAGCCACCAAAGCGGCTGCTGGTACCAAGAAATATGATCTTAGT AAATGGAAATATGCAGAACT
    ACGGGATACCATCAATACTTCTTGTGATATTGAGCTCCTGGCAGCTTGCA GAGAAGAATTTCATAGGAGA
    CTAAAAGTGTATCATGCTTGGAAGTCCAAGAACAAGAAGAGAAATACTGA AACAGAGCAACGTGCTCCAA
    AGTCTGTTACTGATTATGCTCAGCAGAACCCAGCAGTGCAGCTCCCTGCC AGGCAGCAGGAGATCGAAAT
    GAACCGGCAGCAGCGTTTCTTCCGCATTCCGTTCATCCGTTCTGCGGACC AGTACAAAGACCCTCAGAAT
    AAGAAGAAAGGCTGGTGGTATGCCCATTTTGATGGACCGTGGATCGCCCG GCAAATGGAACTTCATCCTG
    ACAAACCACCCATCCTCCTTGTGGCTGGTAAGGATGACATGGAGATGTGT GAGCTGAATCTTGAAGAGAC
    AGGCCTGACTCGAAAGCGTGGTGCAGAGATTTTGCCAAGACAGTTCGAAG AAATTTGGGAACGCTGTGGA
    GGCATCCAGTATCTTCAGAATGCAATTGAGAGCAGACAGGCTAGGCCCAC ATATGCCACGGCCATGCTGC
    AGAACCTGTTAAAGTAGAAGTTGCACTAACCTTGCAGCTGGGAGCTCTTG CCATGGTACTGGGTAGGGAG
    TGTGCCCCAGACATTGACCCATTCCAGGATCCAGTTAGAGTTATGTAAAC AAAGTGAACAGATTTTATTA
    ATCATGGCTTTTTGTTAATTTAAGGTTAATTACAGTAGTGAATTGGGGAC CTGAAAATTAGTTTCTTGTA
    TCCAGCTATAACTGTTGAACCTCTCATGATTTTAATACTTGTTACACTTG GGCAGATTCTGAACCATTTC
    TCATTCTTTGCCAACTGACTACCTTAAATCTATCATCACTGTTCTTGAGG AAAGAAGTTTTTTAAAAAAA
    TGCAGATTTCTTGCTTTTTAAGAATGACACAGTACCATATAACTGGAATA AAGAAAACTTAGTTTCAGTT
    TTCCTACAAAACTAAGGCGCTTAAAATGATAAAGCACTGATGTTTTGATC TGAAAGCTGTGAATTTTATT
    CATTTTTTCAGAAATTAATGGCATTTCCGTCAAAGGTAGAAATTTTTATT TTCCTCACTCTTTTGCAGTG
    TTTTATTTGAGTAAAGCAATTTACCTGAAATTCTAGAATTCTGGAAGAAC CTAAATGTATTTGATGCTAT
    CTGTGACAAAGAAGGTACATAGTATCCTGCAGAGATGTGTTTTGGTTTTC TGTCACATTGTATTGCTGTA
    AGAATATGTTTCATGGACAAATAAAGGAAATTCAGATCAAAAAAAAAAAA AAAAAA

    There is a coding area from base 103 to base 3867 shaded in red below. The rest is non coding

    (1) CTT (4) ATT (7) TGC (10) CCT (13) GTG (16) GTG (19) TGG (22) TGA (25) TGA (28) TCA (31) CAG (34) ATG (37) TCT (40) AAT (43) TTC (46) CCC (49) TTG (52) CCT (55) GCC (58) ATT (61) GAG (64) TTT (67) ACC (70) GAG (73) CTG (76) GGA (79) GAT (82) AGT (85) GGA (88) TAA (91) CTC (94) ACT (97) TCC (100) AAA (103) ATG (106) GAG (109) GAT (112) GGA (115) AAA (118) CCC (121) GTT (124) TGG (127) GCA (130) CCA (133) CAC (136) CCT (139) ACA (142) GAT (145) GGA (148) TTT (151) CAG (154) GTG (157) GGC (160) AAT (163) ATC (166) GTG (169) GAT (172) ATT (175) GGC (178) CCT (181) GAC (184) AGC (187) TTA (190) ACA (193) ATT (196) GAA (199) CCC (202) CTG (205) AAC (208) CAA (211) AAA (214) GGC (217) AAG (220) ACC (223) TTT (226) TTG (229) GCT (232) CTC (235) ATA (238) AAC (241) CAA (244) GTG (247) TTC (250) CCT (253) GCA (256) GAA (259) GAG (262) GAC (265) AGT (268) AAG (271) AAA (274) GAT (277) GTG (280) GAA (283) GAT (286) AAC (289) TGT (292) TCA (295) TTG (298) ATG (301) TAT (304) TTA (307) AAT (310) GAA (313) GCC (316) ACA (319) CTC (322) CTC (325) CAT (328) AAT (331) ATC (334) AAA (337) GTT (340) CGA (343) TAC (346) AGT (349) AAA (352) GAC (355) AGA (358) ATT (361) TAT (364) ACA (367) TAT (370) GTG (373) GCC (376) AAC (379) ATT (382) CTG (385) ATT (388) GCC (391) GTG (394) AAC (397) CCA (400) TAC (403) TTT (406) GAC (409) ATT (412) CCT (415) AAA (418) ATC (421) TAC (424) TCT (427) TCA (430) GAA (433) ACA (436) ATA (439) AAG (442) TCC (445) TAC (448) CAA (451) GGA (454) AAA (457) TCT (460) CTT (463) GGG (466) ACC (469) ATG (472) CCA (475) CCT (478) CAT (481) GTC (484) TTT (487) GCA (490) ATT (493) GCT (496) GAT (499) AAG (502) GCT (505) TTT (508) CGA (511) GAC (514) ATG (517) AAG (520) GTG (523) CTC (526) AAG (529) CTG (532) AGT (535) CAG (538) TCT (541) ATC (544) ATT (547) GTA (550) TCT (553) GGA (556) GAA (559) TCA (562) GGA (565) GCT (568) GGC (571) AAA (574) ACG (577) GAA (580) AAT (583) ACA (586) AAA (589) TTT (592) GTT (595) CTA (598) AGA (601) TAT (604) CTG (607) ACT (610) GAA (613) TCC (616) TAT (619) GGA (622) ACC (625) GGT (628) CAA (631) GAT (634) ATT (637) GAT (640) GAT (643) AGA (646) ATT (649) GTT (652) GAA (655) GCT (658) AAC (661) CCA (664) CTC (667) CTA (670) GAA (673) GCC (676) TTT (679) GGA (682) AAT (685) GCA (688) AAG (691) ACT (694) GTC (697) CGC (700) AAC (703) AAT (706) AAT (709) AGC (712) AGT (715) CGA (718) TTT (721) GGG (724) AAA (727) TTT (730) GTA (733) GAA (736) ATA (739) CAT (742) TTT (745) AAT (748) GAA (751) AAG (754) AGT (757) TCA (760) GTT (763) GTT (766) GGA (769) GGA (772) TTT (775) GTC (778) TCA (781) CAT (784) TAT (787) CTT (790) CTA (793) GAG (796) AAA (799) TCT (802) AGG (805) ATC (808) TGT (811) GTT (814) CAA (817) GGC (820) AAA (823) GAG (826) GAA (829) AGG (832) AAT (835) TAT (838) CAT (841) ATC (844) TTT (847) TAT (850) AGG (853) TTG (856) TGT (859) GCT (862) GGT (865) GCT (868) TCT (871) GAA (874) GAT (877) ATT (880) AGG (883) GAA (886) AGA (889) CTT (892) CAT (895) TTG (898) AGC (901) TCC (904) CCA (907) GAT (910) AAT (913) TTT (916) CGG (919) TAT (922) TTA (925) AAC (928) CGG (931) GGC (934) TGC (937) ACT (940) CGA (943) TAT (946) TTT (949) GCT (952) AAC (955) AAG (958) GAA (961) ACT (964) GAC (967) AAA (970) CAG (973) ATT (976) TTA (979) CAG (982) AAC (985) CGA (988) AAA (991) AGT (994) CCT (997) GAG (1000) TAC (1003) CTT (1006) AAG (1009) GCA (1012) GGT (1015) TCC (1018) TTG (1021) AAA (1024) GAC (1027) CCT (1030) TTG (1033) TTA (1036) GAT (1039) GAC (1042) CAT (1045) GGA (1048) GAC (1051) TTT (1054) ATT (1057) AGA (1060) ATG (1063) TGT (1066) ACA (1069) GCC (1072) ATG (1075) AAA (1078) AAA (1081) ATC (1084) GGT (1087) TTG (1090) GAT (1093) GAT (1096) GAA (1099) GAA (1102) AAG (1105) CTC (1108) GAT (1111) CTG (1114) TTC (1117) CGG (1120) GTA (1123) GTA (1126) GCT (1129) GGC (1132) GTC (1135) CTA (1138) CAT (1141) CTT (1144) GGA (1147) AAT (1150) ATT (1153) GAT (1156) TTT (1159) GAG (1162) GAA (1165) GCT (1168) GGC (1171) AGC (1174) ACT (1177) TCA (1180) GGT (1183) GGT (1186) TGT (1189) AAC (1192) CTG (1195) AAG (1198) AAT (1201) AAA (1204) TCT (1207) ACT (1210) CAG (1213) GCA (1216) TTG (1219) GAA (1222) TAT (1225) TGT (1228) GCA (1231) GAA (1234) AAA (1237) TTA (1240) CTG (1243) GGT (1246) TTG (1249) GAT (1252) CAA (1255) GAC (1258) GAT (1261) CTT (1264) CGT (1267) GTA (1270) AGT (1273) TTA (1276) ACC (1279) ACA (1282) AGA (1285) GTC (1288) ATG (1291) CTA (1294) ACA (1297) ACA (1300) GCA (1303) GGG (1306) GGC (1309) GCC (1312) AAA (1315) GGA (1318) ACA (1321) GTT (1324) ATA (1327) AAG (1330) GTG (1333) CCC (1336) TTG (1339) AAA (1342) GTG (1345) GAG (1348) CAA (1351) GCA (1354) AAC (1357) AAT (1360) GCC (1363) CGG (1366) GAT (1369) GCC (1372) TTG (1375) GCA (1378) AAG (1381) ACT (1384) GTC (1387) TAT (1390) AGC (1393) CAT (1396) CTT (1399) TTT (1402) GAT (1405) CAT (1408) GTA (1411) GTG (1414) AAC (1417) AGA (1420) GTA (1423) AAT (1426) CAG (1429) TGT (1432) TTT (1435) CCT (1438) TTT (1441) GAA (1444) ACC (1447) TCA (1450) TCC (1453) TAT (1456) TTT (1459) ATT (1462) GGA (1465) GTC (1468) CTC (1471) GAC (1474) ATT (1477) GCT (1480) GGT (1483) TTT (1486) GAG (1489) TAC (1492) TTT (1495) GAA (1498) CAT (1501) AAC (1504) AGT (1507) TTT (1510) GAA (1513) CAA (1516) TTT (1519) TGC (1522) ATC (1525) AAC (1528) TAT (1531) TGC (1534) AAT (1537) GAA (1540) AAA (1543) CTT (1546) CAA (1549) CAG (1552) TTT (1555) TTT (1558) AAT (1561) GAA (1564) AGG (1567) ATT (1570) CTG (1573) AAG (1576) GAG (1579) GAA (1582) CAA (1585) GAA (1588) CTC (1591) TAT (1594) CAA (1597) AAG (1600) GAA (1603) GGT (1606) TTA (1609) GGT (1612) GTG (1615) AAT (1618) GAA (1621) GTA (1624) CAT (1627) TAC (1630) GTG (1633) GAT (1636) AAT (1639) CAG (1642) GAC (1645) TGT (1648) ATA (1651) GAT (1654) TTA (1657) ATT (1660) GAA (1663) GCA (1666) AGA (1669) TTA (1672) GTG (1675) GGA (1678) ATA (1681) CTG (1684) GAT (1687) ATT (1690) CTG (1693) GAT (1696) GAA (1699) GAA (1702) AAT (1705) CGC (1708) CTT (1711) CCA (1714) CAG (1717) CCA (1720) AGT (1723) GAT (1726) CAA (1729) CAC (1732) TTT (1735) ACA (1738) TCT (1741) GCA (1744) GGT (1747) CAC (1750) CAG (1753) AAG (1756) CAC (1759) AAA (1762) GAC (1765) CAT (1768) TTC (1771) CGA (1774) CTC (1777) TCT (1780) ATT (1783) CCT (1786) AGA (1789) AAA (1792) TCT (1795) AAG (1798) CTG (1801) GCA (1804) ATC (1807) CAT (1810) AGG (1813) AAC (1816) ATA (1819) GCA (1822) TAT (1825) GAC (1828) GAA (1831) GGT (1834) TTC (1837) ATT (1840) ATC (1843) AGG (1846) CAT (1849) TTT (1852) GCA (1855) GGG (1858) GCA (1861) GTT (1864) TGC (1867) TAT (1870) GAA (1873) ACT (1876) ACT (1879) CAG (1882) TTC (1885) GTG (1888) GAA (1891) AAA (1894) AAT (1897) AAT (1900) GAT (1903) GCT (1906) TTG (1909) CAT (1912) ATG (1915) TCT (1918) CTC (1921) GAG (1924) TCC (1927) TTA (1930) ATA (1933) TGT (1936) GAA (1939) TCC (1942) AGG (1945) GAT (1948) AAA (1951) TTC (1954) ATC (1957) CGG (1960) GAA (1963) TTA (1966) TTT (1969) GAA (1972) TCA (1975) TCC (1978) ACA (1981) AAT (1984) AAC (1987) AAC (1990) AAA (1993) GAT (1996) ACT (1999) AAA (2002) CAA (2005) AAA (2008) GCA (2011) GGA (2014) AAA (2017) CTT (2020) AGC (2023) TTC (2026) ATC (2029) AGT (2032) GTG (2035) GGA (2038) AAC (2041) AAG (2044) TTT (2047) AAG (2050) ACA (2053) CAG (2056) TTA (2059) AAT (2062) TTG (2065) CTT (2068) CTG (2071) GAT (2074) AAA (2077) CTT (2080) CGA (2083) AGT (2086) ACT (2089) GGA (2092) GCA (2095) AGC (2098) TTT (2101) ATT (2104) CGT (2107) TGT (2110) ATC (2113) AAA (2116) CCT (2119) AAT (2122) TTA (2125) AAG (2128) ATG (2131) ACA (2134) AGC (2137) CAC (2140) CAC (2143) TTT (2146) GAA (2149) GGT (2152) GCT (2155) CAG (2158) ATT (2161) TTG (2164) TCT (2167) CAA (2170) CTT (2173) CAA (2176) TGT (2179) TCA (2182) GGT (2185) ATG (2188) GTG (2191) TCT (2194) GTT (2197) TTG (2200) GAC (2203) CTG (2206) ATG (2209) CAG (2212) GGC (2215) GGG (2218) TTT (2221) CCA (2224) TCA (2227) CGG (2230) GCT (2233) TCA (2236) TTT (2239) CAT (2242) GAA (2245) GTG (2248) TAC (2251) AAC (2254) ATG (2257) TAT (2260) AAG (2263) AAG (2266) TCT (2269) CTG (2272) CCG (2275) GAT (2278) AAG (2281) CTT (2284) GCA (2287) AGA (2290) TTA (2293) GAC (2296) CCA (2299) AGA (2302) CTA (2305) TTT (2308) TGT (2311) AAG (2314) GCT (2317) CTT (2320) TTT (2323) AAA (2326) GCC (2329) CTG (2332) GGC (2335) TTA (2338) AAT (2341) GAA (2344) ATT (2347) GAC (2350) TAC (2353) AAG (2356) TTT (2359) GGG (2362) TTA (2365) ACA (2368) AAA (2371) GTA (2374) TTT (2377) TTT (2380) AGA (2383) CCT (2386) GGC (2389) AAG (2392) TTT (2395) GCA (2398) GAA (2401) TTT (2404) GAT (2407) CAG (2410) ATT (2413) ATG (2416) AAG (2419) TCC (2422) GAC (2425) CCT (2428) GAC (2431) CAC (2434) TTA (2437) GCA (2440) GAG (2443) CTG (2446) GTT (2449) AAG (2452) AGA (2455) GTC (2458) AAT (2461) CAC (2464) TGG (2467) CTT (2470) ATC (2473) TGC (2476) AGT (2479) CGC (2482) TGG (2485) AAG (2488) AAA (2491) GTT (2494) CAG (2497) TGG (2500) TGC (2503) TCG (2506) CTC (2509) TCA (2512) GTC (2515) ATT (2518) AAA (2521) TTG (2524) AAA (2527) AAC (2530) AAA (2533) ATA (2536) AAA (2539) TAT (2542) CGA (2545) GCT (2548) GAA (2551) GCC (2554) TGC (2557) ATT (2560) AAA (2563) ATG (2566) CAG (2569) AAA (2572) ACT (2575) ATT (2578) CGA (2581) ATG (2584) TGG (2587) CTT (2590) TGC (2593) AAA (2596) AGG (2599) AGA (2602) CAC (2605) AAA (2608) CCT (2611) CGC (2614) ATT (2617) GAC (2620) GGC (2623) CTT (2626) GTT (2629) AAG (2632) GTG (2635) GGC (2638) ACA (2641) CTG (2644) AAA (2647) AAA (2650) CGG (2653) CTT (2656) GAC (2659) AAA (2662) TTT (2665) AAC (2668) GAA (2671) GTA (2674) GTA (2677) AGT (2680) GCC (2683) CTG (2686) AAA (2689) GAT (2692) GGA (2695) AAA (2698) CAG (2701) GAA (2704) ATG (2707) AGT (2710) AAA (2713) CAG (2716) GTC (2719) AAG (2722) GAC (2725) CTT (2728) GAA (2731) ATC (2734) TCT (2737) ATT (2740) GAT (2743) GCT (2746) TTA (2749) ATG (2752) GCC (2755) AAA (2758) ATT (2761) AAG (2764) TCT (2767) ACT (2770) ATG (2773) ATG (2776) ACA (2779) AGG (2782) GAA (2785) CAA (2788) ATT (2791) CAG (2794) AAA (2797) GAA (2800) TAT (2803) GAT (2806) GCA (2809) TTA (2812) GTT (2815) AAA (2818) AGC (2821) TCA (2824) GCC (2827) GTC (2830) CTC (2833) CTC (2836) AGT (2839) GCA (2842) TTA (2845) CAG (2848) AAA (2851) AAG (2854) AAG (2857) CAG (2860) CAA (2863) GAA (2866) GAG (2869) GAA (2872) GCA (2875) GAA (2878) AGG (2881) CTG (2884) AGG (2887) CGT (2890) ATT (2893) CAA (2896) GAA (2899) GAA (2902) ATG (2905) GAA (2908) AAG (2911) GAA (2914) AGA (2917) AAA (2920) AGA (2923) CGT (2926) GAA (2929) GAA (2932) GAT (2935) GAA (2938) CAA (2941) CGT (2944) CGA (2947) AGA (2950) AAG (2953) GAG (2956) GAG (2959) GAG (2962) GAA (2965) AGG (2968) CGG (2971) ATG (2974) AAA (2977) CTT (2980) GAG (2983) ATG (2986) GAA (2989) GCA (2992) AAG (2995) AGA (2998) AAA (3001) CAA (3004) GAA (3007) GAA (3010) GAA (3013) GAG (3016) AGA (3019) AAG (3022) AAA (3025) AGG (3028) GAA (3031) GAT (3034) GAT (3037) GAA (3040) AAA (3043) CGT (3046) ATT (3049) CAG (3052) GCT (3055) GAG (3058) GTG (3061) GAG (3064) GCG (3067) CAG (3070) CTG (3073) GCC (3076) CGA (3079) CAG (3082) CGG (3085) GAG (3088) GAG (3091) GAG (3094) TCC (3097) CAG (3100) CAG (3103) CAG (3106) GCA (3109) GTT (3112) CTG (3115) GAG (3118) CAG (3121) GAG (3124) CGC (3127) CGG (3130) GAC (3133) CGG (3136) GAG (3139) CTG (3142) GCC (3145) CTG (3148) CGA (3151) ATT (3154) GCC (3157) CAG (3160) AGC (3163) GAG (3166) GCA (3169) GAG (3172) CTC (3175) ATC (3178) AGT (3181) GAC (3184) GAG (3187) GCG (3190) CAG (3193) GCC (3196) GAC (3199) CCT (3202) GGG (3205) CTG (3208) CGC (3211) AGA (3214) GGC (3217) CCT (3220) GCT (3223) GTA (3226) CAA (3229) GCC (3232) ACC (3235) AAA (3238) GCG (3241) GCT (3244) GCT (3247) GGT (3250) ACC (3253) AAG (3256) AAA (3259) TAT (3262) GAT (3265) CTT (3268) AGT (3271) AAA (3274) TGG (3277) AAA (3280) TAT (3283) GCA (3286) GAA (3289) CTA (3292) CGG (3295) GAT (3298) ACC (3301) ATC (3304) AAT (3307) ACT (3310) TCT (3313) TGT (3316) GAT (3319) ATT (3322) GAG (3325) CTC (3328) CTG (3331) GCA (3334) GCT (3337) TGC (3340) AGA (3343) GAA (3346) GAA (3349) TTT (3352) CAT (3355) AGG (3358) AGA (3361) CTA (3364) AAA (3367) GTG (3370) TAT (3373) CAT (3376) GCT (3379) TGG (3382) AAG (3385) TCC (3388) AAG (3391) AAC (3394) AAG (3397) AAG (3400) AGA (3403) AAT (3406) ACT (3409) GAA (3412) ACA (3415) GAG (3418) CAA (3421) CGT (3424) GCT (3427) CCA (3430) AAG (3433) TCT (3436) GTT (3439) ACT (3442) GAT (3445) TAT (3448) GCT (3451) CAG (3454) CAG (3457) AAC (3460) CCA (3463) GCA (3466) GTG (3469) CAG (3472) CTC (3475) CCT (3478) GCC (3481) AGG (3484) CAG (3487) CAG (3490) GAG (3493) ATC (3496) GAA (3499) ATG (3502) AAC (3505) CGG (3508) CAG (3511) CAG (3514) CGT (3517) TTC (3520) TTC (3523) CGC (3526) ATT (3529) CCG (3532) TTC (3535) ATC (3538) CGT (3541) TCT (3544) GCG (3547) GAC (3550) CAG (3553) TAC (3556) AAA (3559) GAC (3562) CCT (3565) CAG (3568) AAT (3571) AAG (3574) AAG (3577) AAA (3580) GGC (3583) TGG (3586) TGG (3589) TAT (3592) GCC (3595) CAT (3598) TTT (3601) GAT (3604) GGA (3607) CCG (3610) TGG (3613) ATC (3616) GCC (3619) CGG (3622) CAA (3625) ATG (3628) GAA (3631) CTT (3634) CAT (3637) CCT (3640) GAC (3643) AAA (3646) CCA (3649) CCC (3652) ATC (3655) CTC (3658) CTT (3661) GTG (3664) GCT (3667) GGT (3670) AAG (3673) GAT (3676) GAC (3679) ATG (3682) GAG (3685) ATG (3688) TGT (3691) GAG (3694) CTG (3697) AAT (3700) CTT (3703) GAA (3706) GAG (3709) ACA (3712) GGC (3715) CTG (3718) ACT (3721) CGA (3724) AAG (3727) CGT (3730) GGT (3733) GCA (3736) GAG (3739) ATT (3742) TTG (3745) CCA (3748) AGA (3751) CAG (3754) TTC (3757) GAA (3760) GAA (3763) ATT (3766) TGG (3769) GAA (3772) CGC (3775) TGT (3778) GGA (3781) GGC (3784) ATC (3787) CAG (3790) TAT (3793) CTT (3796) CAG (3799) AAT (3802) GCA (3805) ATT (3808) GAG (3811) AGC (3814) AGA (3817) CAG (3820) GCT (3823) AGG (3826) CCC (3829) ACA (3832) TAT (3835) GCC (3838) ACG (3841) GCC (3844) ATG (3847) CTG (3850) CAG (3853) AAC (3856) CTG (3859) TTA (3862) AAG (3865) TAG (3868) AAG (3871) TTG (3874) CAC (3877) **TAA (3880) CCT (3883) TGC (3886) AGC (3889) TGG (3892) GAG (3895) CTC (3898) TTG (3901) CCA (3904) TGG (3907) TAC (3910) TGG (3913) GTA (3916) GGG (3919) AGT (3922) GTG (3925) CCC (3928) CAG (3931) ACA (3934) TTG (3937) ACC (3940) CAT (3943) TCC (3946) AGG (3949) ATC (3952) CAG (3955) TTA (3958) GAG (3961) TTA (3964) TGT (3967) AAA (3970) CAA (3973) AGT (3976) GAA (3979) CAG (3982) ATT (3985) TTA (3988) TTA (3991) ATC (3994) ATG (3997) GCT (4000) TTT (4003) TGT (4006) **TAA (4009) TTT (4012) AAG (4015) GTT (4018) AAT (4021) TAC (4024) AGT (4027) AGT (4030) GAA (4033) TTG (4036) GGG (4039) ACC (4042) TGA (4045) AAA (4048) TTA (4051) GTT (4054) TCT (4057) TGT (4060) ATC (4063) CAG (4066) CTA (4069) **TAA (4072) CTG (4075) TTG (4078) AAC (4081) CTC (4084) TCA (4087) TGA (4090) TTT (4093) **TAA (4096) TAC (4099) TTG (4102) TTA (4105) CAC (4108) TTG (4111) GGC (4114) AGA (4117) TTC (4120) TGA (4123) ACC (4126) ATT (4129) TCT (4132) CAT (4135) TCT (4138) TTG (4141) CCA (4144) ACT (4147) GAC (4150) TAC (4153) CTT (4156) AAA (4159) TCT (4162) ATC (4165) ATC (4168) ACT (4171) GTT (4174) CTT (4177) GAG (4180) GAA (4183) AGA (4186) AGT (4189) TTT (4192) TTA (4195) AAA (4198) AAA (4201) TGC (4204) AGA (4207) TTT (4210) CTT (4213) GCT (4216) TTT (4219) **TAA (4222) GAA (4225) TGA (4228) CAC (4231) AGT (4234) ACC (4237) ATA (4240) **TAA (4243) CTG (4246) GAA (4249) **TAA (4252) AGA (4255) AAA (4258) CTT (4261) AGT (4264) TTC (4267) AGT (4270) TTT (4273) CCT (4276) ACA (4279) AAA (4282) CTA (4285) AGG (4288) CGC (4291) TTA (4294) AAA (4297) TGA (4300) **TAA (4303) AGC (4306) ACT (4309) GAT (4312) GTT (4315) TTG (4318) ATC (4321) TGA (4324) AAG (4327) CTG (4330) TGA (4333) ATT (4336) TTA (4339) TTC (4342) ATT (4345) TTT (4348) TCA (4351) GAA (4354) ATT (4357) AAT (4360) GGC (4363) ATT (4366) TCC (4369) GTC (4372) AAA (4375) GGT (4378) AGA (4381) AAT (4384) TTT (4387) TAT (4390) TTT (4393) CCT (4396) CAC (4399) TCT (4402) TTT (4405) GCA (4408) GTG (4411) TTT (4414) TAT (4417) TTG (4420) AGT (4423) AAA (4426) GCA (4429) ATT (4432) TAC (4435) CTG (4438) AAA (4441) TTC (4444) TAG (4447) AAT (4450) TCT (4453) GGA (4456) AGA (4459) ACC (4462) ** TAA (4465) ATG (4468) TAT (4471) TTG (4474) ATG (4477) CTA (4480) TCT (4483) GTG (4486) ACA (4489) AAG (4492) AAG (4495) GTA (4498) CAT (4501) AGT (4504) ATC (4507) CTG (4510) CAG (4513) AGA (4516) TGT (4519) GTT (4522) TTG (4525) GTT (4528) TTC (4531) TGT (4534) CAC (4537) ATT (4540) GTA (4543) TTG (4546) CTG (4549) **TAA (4552) GAA (4555) TAT (4558) GTT (4561) TCA (4564) TGG (4567) ACA (4570) AAT (4573) AAA (4576) GGA (4579) AAT (4582) TCA (4585) GAT (4588) CAA (4591) AAA (4594) AAA (4597) AAA (4600) AAA (4603) AAA

    In the entire red area, a Stop Codon occurs only once, whilst in the non-coding area stop codons occur 12 times over 280 codons = 4.2%
    Last edited by Craig.Paardekooper; 04-30-2012 at 10:01 AM.

  5. #155
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Linguistic Properties of NonCoding Areas of DNA

    Statistical and linguistic features of DNA sequences.
    Havlin S, Buldyrev SV, Goldberger AL, Mantegna RN, Peng CK, Simons M, Stanley HE.
    Center for Polymer Studies and Department of Physics, Boston University, MA 02215, USA.


    Abstract

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.


    http://cps.bu.edu/hes/articles/mbghpss94.pdf


    "Linguistic features of noncoding DNA sequences."
    Mantegna RN, Buldyrev SV, Goldberger AL, Havlin S, Peng CK, Simons M, Stanley HE.
    Center for Polymer Studies and Department of Physics, Boston University, Massachusetts 02215, USA.


    Abstract

    We extend the Zipf approach to analyzing linguistic texts to the statistical study of DNA base pair sequences and find that the noncoding regions are more similar to natural languages than the coding regions.
    Last edited by Craig.Paardekooper; 05-01-2012 at 02:20 PM.

  6. #156
    Join Date
    Jun 2007
    Location
    Yakima, Wa
    Posts
    14,703
    Quote Originally Posted by Craig.Paardekooper View Post
    Statistical and linguistic features of DNA sequences.
    Havlin S, Buldyrev SV, Goldberger AL, Mantegna RN, Peng CK, Simons M, Stanley HE.
    Center for Polymer Studies and Department of Physics, Boston University, MA 02215, USA.


    Abstract

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.


    http://cps.bu.edu/hes/articles/mbghpss94.pdf


    "Linguistic features of noncoding DNA sequences."
    Mantegna RN, Buldyrev SV, Goldberger AL, Havlin S, Peng CK, Simons M, Stanley HE.
    Center for Polymer Studies and Department of Physics, Boston University, Massachusetts 02215, USA.


    Abstract

    We extend the Zipf approach to analyzing linguistic texts to the statistical study of DNA base pair sequences and find that the noncoding regions are more similar to natural languages than the coding regions.
    Fascinating! Thanks.

    • Skepticism is the antiseptic of the mind.
    • Remember why we debate. We have nothing to lose but the errors we hold. Who but a stubborn fool would hold to errors once they have been exposed?

    Check out my blog site

  7. #157
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Substituting Letters for Codons

    If there are language areas within noncoding DNA, then the 64 codons would map onto the letters of an alphabet. For example, the 64 codons could map onto the 22 letters of the Hebrew alphabet.

    We could test this by taking a DNA string and substituting each codon for a Hebrew letter, and then seeing if any intelligible words emerge.

    In this scenario, a codon could represent any of the 22 letters. If we took a string of 5 different codons, then a software program could loop through each of these possible letters, and produce a list of 5 letter "words". If any of these words were then found in the dictionary, then we might have discovered something.

    For 5 codons, the number of possible permutations is 22 x 21 x 20 x 19 x 18 = 3,160,080. This should produce a list of 5 letter words, most of which are meaningless. But some of the words will be meaningful. We would have to match each word to a Hebrew dictionary - using a spell-check program. If the word was the correct spelling of a Hebrew word, then it would be saved together with the codon sequence.

    I would use a database of 22 columns, with each column representing a letter in the alphabet. When a meaningful word is found, it would be inserted into the database, so that the codon matching each letter, would be entered in the column for that letter

    If this was repeated with 100 different groups of 5 codons, then we should end up with a batch of meaningful words matched with codons. In each case, the codons matching each letter would have been recorded.

    The database could then be queried to determine the codons occurring with highest frequency for each letter. This would possibly reveal the genetic alphabet.

    STEP 1
    Create a looping program to substitute codons with letters - this will produce 3,160,080 "words"

    STEP 2
    Use a "spell-check" program to isolate "words" with correct spellings.

    STEP 3
    Enter the codons for correctly spelled words into a database.

    STEP 4
    Repeat with other codon sequences

    STEP 5
    Determine codons that occur with highest frequency in each database column (column = letter)

    I think that this would work, but I am not sure if it is the best way to crack this code. Perhaps an easier method would be to find out what the most common word in the Hebrew dictionary is, then find out what are the most common noncoding codon sequences, and then see if a match can be found.
    Last edited by Craig.Paardekooper; 05-01-2012 at 03:39 PM.

  8. #158
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Matching codon frequency to letter frequency

    I decided that a faster method would be to determine the frequency of codons in the entire human genome, then see if I could match these with the frequency of occurrence of each of the 22 leters in the Hebrew alphabet. My reasoning was that the most commonly occurring Hebrew letters would match the most commonly occurring codons, and le least common hebrew letters would match the least common codons.

    First I obtained the frequency of occurrence of every codon

    Dim TTT As Double = 36530115
    Dim ATT As Double = 23669701
    Dim TCT As Double = 20990387
    Dim TTA As Double = 19750578
    Dim TAT As Double = 19568343
    Dim CTG As Double = 19195946
    Dim TGT As Double = 19152113
    Dim CTT As Double = 18944797
    Dim TTC As Double = 18708048
    Dim TCA As Double = 18565027
    Dim TTG As Double = 18005020
    Dim TGG As Double = 17480496
    Dim CAT As Double = 17423117
    Dim CCT As Double = 16835177
    Dim CTC As Double = 15942742
    Dim AGT As Double = 15266057
    Dim GGA As Double = 14619310
    Dim GTG As Double = 14252868
    Dim GTT As Double = 13852086
    Dim TGC As Double = 13649076
    Dim GCT As Double = 13252828
    Dim GAT As Double = 12658530
    Dim GGG As Double = 12446600
    Dim TAG As Double = 12240281
    Dim GCC As Double = 11268094
    Dim GGT As Double = 11026602
    Dim GTA As Double = 10766854
    Dim GTC As Double = 8955434
    Dim CCG As Double = 2606672
    Dim CGT As Double = 2379612
    Dim GCG As Double = 2247440
    Dim TCG As Double = 2087242
    Dim AAA As Double = 36381293
    Dim AAT As Double = 23634011
    Dim AGA As Double = 20948987
    Dim TAA As Double = 19721149
    Dim ATA As Double = 19548709
    Dim CAG As Double = 19176935
    Dim ACA As Double = 19073189
    Dim AAG As Double = 18894716
    Dim GAA As Double = 18678084
    Dim TGA As Double = 18562015
    Dim CAA As Double = 17927956
    Dim CCA As Double = 17444649
    Dim ATG As Double = 17409063
    Dim AGG As Double = 16810797
    Dim GAG As Double = 15939419
    Dim ACT As Double = 15251455
    Dim TCC As Double = 14614789
    Dim CAC As Double = 14214421
    Dim AAC As Double = 13794251
    Dim GCA As Double = 13635427
    Dim AGC As Double = 13242724
    Dim ATC As Double = 12650299
    Dim CCC As Double = 12428986
    Dim CTA As Double = 12217331
    Dim GGC As Double = 11258126
    Dim ACC As Double = 11007307
    Dim TAC As Double = 10755607
    Dim GAC As Double = 8938833
    Dim CGG As Double = 2604253
    Dim ACG As Double = 2372235
    Dim CGC As Double = 2244432
    Dim CGA As Double = 2085226

    There are more codons than there are letters in the alphabet, so I reasoned that maybe a letter can be coded for by more than one codon. This would mean that they may have a redundancy pattern similar to the amino acids. So I calculated the frequency the codons matching each amino acid in the human genome

    17409063 MET 1.83%
    17480496 TRP 1.84%
    21597363 ASP 2.27%
    30323950 TYR 3.19%
    31637538 HIS 3.33%
    32801189 CYS 3.46%
    34617503 Glu 3.65%
    37104891 Gln 3.91%
    37428262 Asn 3.94%
    40403789 Ala 4.26%
    47073307 Arg 4.96%
    47704186 Thr 5.03%
    47827242 Val 5.04%
    49315484 Pro 5.20%
    49350638 Gly 5.206%
    50523445 STOP 5.33%
    55238163 Phe 5.82%
    55276009 Lys 5.83%
    55868709 Ile 5.89%
    84766226 Ser 8.94%
    104056414 LEU 10.97%

    Now I can begin to make some tentative codon letter matches

    Here are the frequencies of each letter in the Hebrew alphabet




    Character

    Frequency
    א
    6,11%
    ב
    4,57%
    ג
    1,26%
    ד
    2,49%
    ה
    10,48%
    ו
    10,01%
    ז
    1,28%
    ח
    2,39%
    ט
    1,19%
    י
    10,67%
    ך
    0,78%
    כ
    2,60%
    ל
    7,12%
    ם
    2,92%
    מ
    4,43%
    ן
    1,06%
    נ
    2,76%
    ס
    1,43%
    ע
    3,11%
    ף
    0,26%
    פ
    1,63%
    ץ
    0,12%
    צ
    1,20%
    ק
    2,06%
    ר
    5,40%
    ש
    4,25%
    ת
    4,84%
    י
    11,03%
    ה
    10,84%
    ו
    10,35%
    ל
    7,36%
    א
    6,32%
    ר
    5,59%
    ת
    5,00%
    ב
    4,73%
    מ
    4,58%
    ש
    4,39%
    ע
    3,22%
    ם
    3,02%
    נ
    2,85%
    כ
    2,69%
    ד
    2,58%
    ח
    2,47%
    ק
    2,13%
    פ
    1,68%
    ס
    1,48%
    ז
    1,32%
    ג
    1,30%
    צ
    1,24%
    ט
    1,23%
    ן
    1,09%
    ך
    0,81%
    ף
    0,27%
    ץ
    0,12%
    Last edited by Craig.Paardekooper; 05-03-2012 at 06:17 AM.

  9. #159
    Krakers Guest

    coming out of retirement

    Some years ago I put up a website that argued for the possibility that DNA could be translated into Hebrew.
    I took it down but someone thought enough of it to put up a copy.

    http://www.bibliotecapleyades.net/ci...x.htm#CONTENTS

    I have waited a long time to see if someone would continue on with the idea and provide additional paths
    for research.

    I have been reading the essays of Paardekoop, Jenkins, et al, hoping that one or more would land on the
    idea of searching the human genome for messages in a human language. It's the kind of fringe idea that
    leads to novels, such as:

    "The Messiah Code" Michael Cordy
    "The Genesis Code" John Case
    "The Genesis Code" Christopher Forrest"

    Such an idea might also lead to new interpretations for traditional religions or to entirely new stories that
    may serve to produce new religions.

    Might I suggest that one examine the alternate genetic code found in the human mitochondrial DNA. The
    mitochondrial genome has some interesting structural qualities that may connect to elements within the
    biblical Genesis account of human history up to the deluge. The length of that genome divided by 10 and
    the number of "biblical years" from Adam to deluge seems provocative within the framework of the hidden
    messages hypothesis.

    regards,
    Steve Krakowski

  10. #160
    Join Date
    Jul 2008
    Location
    London UK
    Posts
    663

    Response to Kraker

    Dear Kraker

    Please could you let me know what were the resulting matches between codons and letters that you arrived at?

    Also, did you apply your alphabet to DNA using a computer program?
    Last edited by Craig.Paardekooper; 05-07-2012 at 04:25 PM.

Thread Information

Users Browsing this Thread

There are currently 1 users browsing this thread. (0 members and 1 guests)

Tags for this Thread

Bookmarks

Posting Permissions

  • You may not post new threads
  • You may post replies
  • You may not post attachments
  • You may edit your posts
  •