Google Ads

Google Ads

Bible Wheel Book

Google Ads

+ Reply to Thread
Results 1 to 3 of 3

Thread: Eternal Life

  1. #1

    The Biology of Eternal Life

    You may be surprised to learn that you are already immortal - or atleast part of you is - the bit you pass on to the next generation - that's why children are not born old. A new born child receives cells and DNA that will last them a lifetime, compared with the old cells and DNA of the parents. So some cells in our bodies can copy themselves indefinitely - they are renewed with each generation and these cells are passed on to our children. The question is "What makes these cells immortal?" If we could understand this, then we might be able to slow down aging, and prolong youth.

    If you believe the Genesis record which talks about 1000 year lifespan, then perhaps it is normal for us to be longlived, and by comparison our present state is impoverished.

    Looking back even further - you might ponder the fossil record. TV series such as "Walking with Beasts" clearly show that there were larger and longer lived animals upon this earth in the past. (How do you get that big without growing for longer?). There were bigger versions of everything we see today.

    So why do we age?

    We age because our cells can only copy themselves a fixed number of times - this is called the "Hayflick Limit". (In humans, the Hayflick limit is 52 times.) It is already known that every time a cell copies itself, a few DNA letters on the ends of the chromosomes are deleted each time. To protect chromosomes from this deletion, nature has added on an extra string of repeating letters to each end of each Chromosome - this acts as a kind of cap. These extra strings are many thousands of letters long, and do not contain vital information - it is this extra string that normally gets deleted bit by bit rather than the essential DNA information. However, after a certain number of copies, this extra string is completely used up and then the core DNA begins to be deleted. That's when the cell stops functioning properly and dies.

    The letters that are found in this "cap" string are repetitions of TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG etc etc

    It is possible that an additional length of these letters could be spliced into the egg cell, then they would have a hayflick limit that was much higher - perhaps twice as great. If we could do this, then we would probably double our lifespan straight away - and during our life we would age far less, since DNA info would not suffer deletion with each copy.

    The conceptually simple idea of splicing a repeating sequence onto the end of chromosomes at conception should raise the hayflick limit which means that cells can copy themselves more often before dying - which means longer life perhaps?

    Of course, all such experiments would be performed on cell cultures rather than on animals or people. Experiments are already afoot right across the globe.

    Here is a link to some of the research. http://www.senescence.info/telomeres_telomerase.html

    As a measure of how far our science has currently progressed in this field in just 20 years, here is a quote -

    Confirming these suspicions, inhibition of p53 and pRb by antisense technology caused cells to endure 50 CPDs more than normal (Hara et al., 1991).
    Bearing in mind that the Hayflick Limit for humans is 52 times, this means that human cell cultures have undergone 50 more copies than normal - which is approximately a doubling of lifespan !! Of course this is only in a cell culture rather than an organism. But it is remarkable that our scientists have already doubled lifespan in the lab.

    Here are some videos about what has come to be known as "cell immortalisation" -

    http://www.youtube.com/watch?v=GlZeRRt5JkE

    http://www.youtube.com/watch?v=DV3Xj...feature=fvwrel


    References :

    Hara, E., Tsurui, H., Shinozaki, A., Nakada, S., and Oda, K. (1991). "Cooperative effect of antisense-Rb and antisense-p53 oligomers on the extension of life span in human diploid fibroblasts, TIG-1." Biochem Biophys Res Commun 179(1):528-534. PubMed






    Edit Post Reply With Quote
    Last edited by Craig.Paardekooper; 04-26-2012 at 09:11 PM.

  2. #2
    In 1961 Leonard Hayflick discovered the limit that bears his name: normal cells can divide only so many times–roughly fifty–before running out of steam. At #3 is a paper, from Serge Lichtsteiner of the Geron Corporation and Woodring Wright of University of Texas Southwestern Medical Center at Dallas, and their colleagues, proving that telomerase, an enzyme, underpins the Hayflick Limit.

    The key question was whether telomeres had anything to do with cell aging. The telomere is a repetitive stretch of DNA found at each end of a chromosome. In 1986, Howard Cooke, of the Medical Research Council's Human Genetics Unit in Edinburgh, Scotland, noticed that the telomeres capping sex chromosomes were much longer when those chromosomes came from a germline cell than when they came from a normal body cell. Because of the way DNA replicates, telomeres are shortened each time a cell divides. An enzyme, telomerase, which extends the telomere, had been discovered just before, and Cooke wondered whether it might be inactive in normal human cells. The progressive shortening of the telomere would then impose the Hayflick Limit on the cell's ability to divide.

    The analogy is with a shoestring–more specifically, the little plastic bit at each end. I don't know who first came up with it, but it is a striking analogy. Just as the little plastic bit (it couldn't possibly have a name, could it?) stops the lace fraying and makes it possible to thread the lace through the eyelets, so the telomere stops the end of the chromosome fraying. And just as one might have to abandon a perfectly good shoelace, just because it has become unlaced after the little plastic bit has been destroyed by wear and tear, so the cell sometimes has to abandon a perfectly good chromosome (and die in the process) just because the telomere has been destroyed. Telomerase, then, is the little bit of Scotch tape that gives new life to a frayed shoelace.

    Cooke's theory gained support from a great deal of evidence. Crucially, telomerase is present, but inactive, in most normal cells. And it is active in tumor cells, which do not grow old and know no reproductive limit. But the evidence was circumstantial or correlative. The Bodnar et al. paper at #3 offers the first definitive proof that shortened telomeres cause cell senescence. The paper does so by activating telomerase in normal cells–producing, as the authors proclaim, an "extension of life span."

    The approach depended on two previous discoveries that were hot papers in their time. First, the isolation by Thomas Cech and his colleagues of TRT, the reverse transcriptase subunit of telomerase, the bit that actually adds the repetitive TTAGGG sequence that characterizes telomeres. That sequence, taken from a protozoan, was then used to fish for hTRT, the human version, allowing Wright's group to insert hTRT into normal human cells.

    "The results," as one commentator put it, "were strikingly unequivocal." The telomeres in cells with hTRT lengthened, and the cells themselves kept on multiplying, through the Hayflick limit and well beyond. At the time the paper was submitted they had made 20 or more "extra" divisions, yet they looked young, vigorous, and essentially normal.

    Immediately after publication there was interest in blocking telomerase to treat cancers, which skeptics criticized because the telomeres would take too long to shorten. According to Jerry Shay, a member of the team at UTSMC, that's a straw man: no one would consider anti-telomerase as a front-line therapy. "Realistically," Shay tells Science Watch, "I believe telomerase inhibitors will be used after surgery and perhaps in combination with chemotherapy or radiotherapy in a clinical setting of minimal residual disease." The hope is that with the main tumor under control anti-telomerase might target small hidden metastases, shortening their telomeres enough to prevent or delay cancer relapse.

    Equally exciting is the possibility that telomerase could act as a marker for cancers that are otherwise difficult to detect. Early detection improves clinical outcome enormously, but many cancers, for example bladder cancer, are hard to detect early. A kit targetting telomerase–and Geron has licensed the technology to Roche–would enable routine screening of urine samples in high-risk patients. Shay tells Science Watch that in many cancers the expression of telomerase is a good indication of prognosis, and there are now opportunities for measuring telomerase. "This knowledge," he says, "may help oncologists decide when additional surgery or therapy is needed."

  3. #3

    Neanderthal DNA as a clue to Immortality

    There is some evidence that human lifespan was greater in the distant past. I published some of this evidence in one of my books here - http://www.craigdemo.co.uk/enochvid2.htm

    Well, it so happens that scientists now have samples of Neanderthal DNA. These are the oldest remains of human DNA that exist. If Neanderthals lived considerably longer than modern humans, then we should be able to see this difference in their DNA.

    By comparing modern DNA with Neanderthal dNA we will be able to find the DNA that made them live so much longer.

Thread Information

Users Browsing this Thread

There are currently 1 users browsing this thread. (0 members and 1 guests)

Bookmarks

Posting Permissions

  • You may not post new threads
  • You may post replies
  • You may not post attachments
  • You may edit your posts
  •